Mercurial > repos > devteam > fastq_to_tabular

comparison fastq_to_tabular.xml @ 3:a63d1aa8e829 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/galaxy_sequence_utils/fastq_to_tabular commit f2582539542b33240234e8ea6093e25d0aee9b6a
author devteam
date Sat, 30 Sep 2017 13:53:46 -0400
parents 81c9b58760ff
children 672ad99bbfe4
comparison
equal deleted inserted replaced
2:9616277d3d39 3:a63d1aa8e829
1 <tool id="fastq_to_tabular" name="FASTQ to Tabular" version="1.1.0"> 1 <tool id="fastq_to_tabular" name="FASTQ to Tabular" version="1.1.1">
2 <description>converter</description> 2 <description>converter</description>
3 <requirements> 3 <requirements>
4 <requirement type="package" version="1.0.0">galaxy_sequence_utils</requirement> 4 <requirement type="package" version="1.1.1">galaxy_sequence_utils</requirement>
5 </requirements> 5 </requirements>
6 <command interpreter="python">fastq_to_tabular.py '$input_file' '$output_file' $descr_columns '${input_file.extension[len( 'fastq' ):]}'</command> 6 <command><![CDATA[
7 <inputs> 7 gx-fastq-to-tabular '$input_file' '$output_file' $descr_columns '${input_file.extension[len('fastq'):]}'
8 <param name="input_file" type="data" format="fastqsanger,fastqcssanger,fastqillumina,fastqsolexa" label="FASTQ file to convert" /> 8 ]]></command>
9 <param name="descr_columns" type="integer" value="1" label="How many columns to divide title string into?" help="Typically 2 to take the ID (first word) and decription (rest) as two columns, or 1 to give a single column"> 9 <inputs>
10 <validator type="in_range" min="1" /> 10 <param name="input_file" type="data" format="fastqsanger,fastqcssanger,fastqillumina,fastqsolexa,fastqsanger.gz,fastqcssanger.gz,fastqillumina.gz,fastqsolexa.gz,fastqsanger.bz2,fastqcssanger.bz2,fastqillumina.bz2,fastqsolexa.bz2" label="FASTQ file to convert" />
11 </param> 11 <param name="descr_columns" type="integer" min="1" value="1" label="How many columns to divide title string into?" help="Typically 2 to take the ID (first word) and decription (rest) as two columns, or 1 to give a single column" />
12 </inputs> 12 </inputs>
13 <outputs> 13 <outputs>
14 <data name="output_file" format="tabular" /> 14 <data name="output_file" format="tabular" />
15 </outputs> 15 </outputs>
16 <tests> 16 <tests>
17 <!-- basic test --> 17 <!-- basic test -->
18 <test> 18 <test>
19 <param name="input_file" value="sanger_full_range_original_sanger.fastqsanger" ftype="fastqsanger" /> 19 <param name="input_file" value="sanger_full_range_original_sanger.fastqsanger" ftype="fastqsanger" />
20 <param name="descr_columns" value="1"/> 20 <param name="descr_columns" value="1"/>
21 <output name="output_file" file="fastq_to_tabular_out_1.tabular" /> 21 <output name="output_file" file="fastq_to_tabular_out_1.tabular" />
22 </test> 22 </test>
23 <!-- color space test --> 23 <!-- compression test -->
24 <test> 24 <test>
25 <param name="input_file" value="sanger_full_range_as_cssanger.fastqcssanger" ftype="fastqcssanger" /> 25 <param name="input_file" value="sanger_full_range_original_sanger.fastqsanger.gz" ftype="fastqsanger.gz" />
26 <param name="descr_columns" value="1"/> 26 <param name="descr_columns" value="1"/>
27 <output name="output_file" file="fastq_to_tabular_out_2.tabular" /> 27 <output name="output_file" file="fastq_to_tabular_out_1.tabular" />
28 </test> 28 </test>
29 <!-- split title into columns --> 29 <!-- color space test -->
30 <test> 30 <test>
31 <param name="input_file" value="sanger_full_range_original_sanger.fastqsanger" ftype="fastqsanger" /> 31 <param name="input_file" value="sanger_full_range_as_cssanger.fastqcssanger" ftype="fastqcssanger" />
32 <param name="descr_columns" value="2"/> 32 <param name="descr_columns" value="1"/>
33 <output name="output_file" file="fastq_to_tabular_out_3.tabular" /> 33 <output name="output_file" file="fastq_to_tabular_out_2.tabular" />
34 </test> 34 </test>
35 </tests> 35 <!-- split title into columns -->
36 <help> 36 <test>
37 37 <param name="input_file" value="sanger_full_range_original_sanger.fastqsanger" ftype="fastqsanger" />
38 <param name="descr_columns" value="2"/>
39 <output name="output_file" file="fastq_to_tabular_out_3.tabular" />
40 </test>
41 </tests>
42 <help><![CDATA[
38 **What it does** 43 **What it does**
39 44
40 This tool converts FASTQ sequencing reads to a Tabular file. 45 This tool converts FASTQ sequencing reads to a Tabular file.
41 46
42 It is conventional to take the first word of the FASTQ "@" title line as the identifier, and any remaining text to be a free form description. 47 It is conventional to take the first word of the FASTQ "@" title line as the identifier, and any remaining text to be a free form description.
43 It is therefore often useful to split this text into two columns in Galaxy (identifier and any description) by setting **How many columns to divide title string into?** to **2**. 48 It is therefore often useful to split this text into two columns in Galaxy (identifier and any description) by setting **How many columns to divide title string into?** to **2**.
44 In some cases the description can be usefully broken up into more columns -- see the examples . 49 In some cases the description can be usefully broken up into more columns -- see the examples .
45 50
46 Tab characters, if present in the source FASTQ title, will be converted to spaces. 51 Tab characters, if present in the source FASTQ title, will be converted to spaces.
47 52
48 ----- 53 -----
49 54
50 **Example** 55 **Example**
51 56
52 Consider the following two 454 reads in Sanger FASTQ format (using line wrapping for display, but do note not all tools will accept line wrapped FASTQ files):: 57 Consider the following two 454 reads in Sanger FASTQ format (using line wrapping for display, but do note not all tools will accept line wrapped FASTQ files)::
53 58
57 ttatttattccacaagcaggtttaaattttaaatttaaattattgcagaagactttaaattaacctcgttgtcggagtca 62 ttatttattccacaagcaggtttaaattttaaatttaaattattgcagaagactttaaattaacctcgttgtcggagtca
58 tttgttcggttattggtcgaaagtaaccncgggaagtgccgaaaactaacaaacaaaagaagatagtgaaattttaatta 63 tttgttcggttattggtcgaaagtaaccncgggaagtgccgaaaactaacaaacaaaagaagatagtgaaattttaatta
59 aaanaaatagccaaacgtaactaactaaaacggacccgtcgaggaactgccaacggacgacacagggagtagnnn 64 aaanaaatagccaaacgtaactaactaaaacggacccgtcgaggaactgccaacggacgacacagggagtagnnn
60 +FSRRS4401BE7HA [length=395] [gc=36.46] [flows=800] [phred_min=0] [phred_max=40] [trimmed_length=95] 65 +FSRRS4401BE7HA [length=395] [gc=36.46] [flows=800] [phred_min=0] [phred_max=40] [trimmed_length=95]
61 FFFDDDDDDDA666?688FFHGGIIIIIIIIIIIIIIIIIIHHHIIIIIIIIIGHGFFFFF====DFFFFFFFFFFFFFF 66 FFFDDDDDDDA666?688FFHGGIIIIIIIIIIIIIIIIIIHHHIIIIIIIIIGHGFFFFF====DFFFFFFFFFFFFFF
62 D???:3104/76=:5...4.3,,,366////4&lt;ABBAAA=CCFDDDDDDDD:666CDFFFF=&lt;ABA=;:333111&lt;===9 67 D???:3104/76=:5...4.3,,,366////4<ABBAAA=CCFDDDDDDDD:666CDFFFF=<ABA=;:333111<===9
63 9;B889FFFFFFDDBDBDDD=8844231..,,,-,,,,,,,,1133..---17111,,,,,22555131121.--.,333 68 9;B889FFFFFFDDBDBDDD=8844231..,,,-,,,,,,,,1133..---17111,,,,,22555131121.--.,333
64 11,.,,3--,,.,,--,3511123..--!,,,,--,----9,,,,8=,,-,,,-,,,,---26:9:5-..1,,,,11//, 69 11,.,,3--,,.,,--,3511123..--!,,,,--,----9,,,,8=,,-,,,-,,,,---26:9:5-..1,,,,11//,
65 ,,,!,,1917--,,,,-3.,--,,17,,,,---+11113.030000,,,044400036;96662.//;7&gt;&lt;;!!! 70 ,,,!,,1917--,,,,-3.,--,,17,,,,---+11113.030000,,,044400036;96662.//;7><;!!!
66 @FSRRS4401BRRTC [length=145] [gc=38.62] [flows=800] [phred_min=0] [phred_max=38] [trimmed_length=74] 71 @FSRRS4401BRRTC [length=145] [gc=38.62] [flows=800] [phred_min=0] [phred_max=38] [trimmed_length=74]
67 tcagCCAGCAATTCCGACTTAATTGTTCTTCTTCCATCATTCATCTCGACTAACAGTTCTACGATTAATGAGTTTGGCtt 72 tcagCCAGCAATTCCGACTTAATTGTTCTTCTTCCATCATTCATCTCGACTAACAGTTCTACGATTAATGAGTTTGGCtt
68 taatttgttgttcattattgtcacaattacactactgagactgccaaggcacncagggataggnn 73 taatttgttgttcattattgtcacaattacactactgagactgccaaggcacncagggataggnn
69 +FSRRS4401BRRTC [length=145] [gc=38.62] [flows=800] [phred_min=0] [phred_max=38] [trimmed_length=74] 74 +FSRRS4401BRRTC [length=145] [gc=38.62] [flows=800] [phred_min=0] [phred_max=38] [trimmed_length=74]
70 FFFFFFFFFDDDDFFFFGFDDDDBAAAAA=&lt;4444@@B=555:BBBBB@@?8:8&lt;?&lt;89898&lt;84442;==3,,,514,, 75 FFFFFFFFFDDDDFFFFGFDDDDBAAAAA=<4444@@B=555:BBBBB@@?8:8<?<89898<84442;==3,,,514,,
71 ,11,,,.,,21777555513,..--1115758.//34488&gt;&lt;&lt;;;;;9944/!/4,,,57855!! 76 ,11,,,.,,21777555513,..--1115758.//34488><<;;;;9944/!/4,,,57855!!
72 77
73 By default this is converted into a 3 column tabular file, with the full FASTQ title used as column 1: 78 By default this is converted into a 3 column tabular file, with the full FASTQ title used as column 1:
74 79
75 =================================================================================================== ============== ============== 80 =================================================================================================== ============== ==============
76 FSRRS4401BE7HA [length=395] [gc=36.46] [flows=800] [phred_min=0] [phred_max=40] [trimmed_length=95] tcagTTAA...nnn FFFDDDDD...!!! 81 FSRRS4401BE7HA [length=395] [gc=36.46] [flows=800] [phred_min=0] [phred_max=40] [trimmed_length=95] tcagTTAA...nnn FFFDDDDD...!!!
90 FSRRS4401BE7HA [length=395] [gc=36.46] [flows=800] [phred_min=0] [phred_max=40] [trimmed_length=95] tcagTTAA...nnn FFFDDDDD...!!! 95 FSRRS4401BE7HA [length=395] [gc=36.46] [flows=800] [phred_min=0] [phred_max=40] [trimmed_length=95] tcagTTAA...nnn FFFDDDDD...!!!
91 FSRRS4401BRRTC [length=145] [gc=38.62] [flows=800] [phred_min=0] [phred_max=38] [trimmed_length=74] tcagCCAG...gnn FFFFFFFF...5!! 96 FSRRS4401BRRTC [length=145] [gc=38.62] [flows=800] [phred_min=0] [phred_max=38] [trimmed_length=74] tcagCCAG...gnn FFFFFFFF...5!!
92 ============== ============ ========== =========== ============= ============== =================== ============== ============== 97 ============== ============ ========== =========== ============= ============== =================== ============== ==============
93 98
94 Note the sequences and quality strings have been truncated for display purposes in the above tables. 99 Note the sequences and quality strings have been truncated for display purposes in the above tables.
95 100 ]]></help>
96 ------ 101 <citations>
97 102 <citation type="doi">10.1093/bioinformatics/btq281</citation>
98 </help> 103 </citations>
99
100 <citations>
101 <citation type="doi">10.1093/bioinformatics/btq281</citation>
102 </citations>
103
104 </tool> 104 </tool>