diff fastq_paired_end_splitter.xml @ 3:fec4c8314668 draft

planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/galaxy_sequence_utils/fastq_paired_end_splitter commit f2582539542b33240234e8ea6093e25d0aee9b6a

--- a/fastq_paired_end_splitter.xml	Fri Dec 18 19:30:11 2015 -0500
+++ b/fastq_paired_end_splitter.xml	Sat Sep 30 13:53:09 2017 -0400
@@ -1,27 +1,29 @@
-<tool id="fastq_paired_end_splitter" name="FASTQ splitter" version="1.0.0">
-  <description>on joined paired end reads</description>
-  <requirements>
-    <requirement type="package" version="1.0.0">galaxy_sequence_utils</requirement>
-  </requirements>
-  <command interpreter="python">fastq_paired_end_splitter.py '$input1_file' '${input1_file.extension[len( 'fastq' ):]}' '$output1_file' '$output2_file'</command>
-  <inputs>
-    <param name="input1_file" type="data" format="fastqsanger,fastqcssanger" label="FASTQ reads" />
-  </inputs>
-  <outputs>
-    <data name="output1_file" format="input" />
-    <data name="output2_file" format="input" />
-  </outputs>
-  <tests>
-    <test>
-      <param name="input1_file" value="3.fastqsanger" ftype="fastqsanger" />
-      <output name="output1_file" file="split_pair_reads_1.fastqsanger" />
-      <output name="output2_file" file="split_pair_reads_2.fastqsanger" />
-    </test>
-  </tests>
-  <help>
+<tool id="fastq_paired_end_splitter" name="FASTQ splitter" version="1.1.1">
+    <description>on joined paired end reads</description>
+    <requirements>
+        <requirement type="package" version="1.1.1">galaxy_sequence_utils</requirement>
+    </requirements>
+    <command><![CDATA[
+gx-fastq-paired-end-splitter '$input1_file' '${input1_file.extension[len('fastq'):]}' '$output1_file' '$output2_file'
+    ]]></command>
+    <inputs>
+        <param name="input1_file" type="data" format="fastqsanger,fastqcssanger,fastqsanger.gz,fastqcssanger.gz,fastqsanger.bz2,fastqcssanger.bz2" label="FASTQ reads" />
+    </inputs>
+    <outputs>
+        <data name="output1_file" format_source="input1_file" />
+        <data name="output2_file" format_source="input1_file" />
+    </outputs>
+    <tests>
+        <test>
+            <param name="input1_file" value="3.fastqsanger" ftype="fastqsanger" />
+            <output name="output1_file" file="split_pair_reads_1.fastqsanger" ftype="fastqsanger" />
+            <output name="output2_file" file="split_pair_reads_2.fastqsanger" ftype="fastqsanger" />
+        </test>
+    </tests>
+    <help><![CDATA[
 **What it does**
 
-Splits a single fastq dataset representing paired-end run into two datasets (one for each end). This tool works only for datasets where both ends have **the same** length.  
+Splits a single fastq dataset representing paired-end run into two datasets (one for each end). This tool works only for datasets where both ends have **the same** length.
 
 Sequence identifiers will have /1 or /2 appended for the split left-hand and right-hand reads, respectively.
 
@@ -36,7 +38,6 @@
     +HWI-EAS91_1_30788AAXX:7:21:1542:1758
     hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR
 
-
 -----
 
 **Outputs**
@@ -54,14 +55,8 @@
     GCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA
     +HWI-EAS91_1_30788AAXX:7:21:1542:1758/2
     hhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR
-
-------
-
-
-  </help>
-  
-  <citations>
-    <citation type="doi">10.1093/bioinformatics/btq281</citation>
-  </citations>
-  
+    ]]></help>
+    <citations>
+        <citation type="doi">10.1093/bioinformatics/btq281</citation>
+    </citations>
 </tool>