Mercurial > repos > devteam > fastq_manipulation
view test-data/misc_rna_as_sanger_rev_comp_1.fastqsanger @ 1:b50aeae8bcaa draft
planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734
author | devteam |
---|---|
date | Tue, 13 Oct 2015 12:43:07 -0400 |
parents | de14b969d713 |
children |
line wrap: on
line source
@FAKE0011 Original version has lower case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order) UACGUACGUACGUACGUACGUACGUACGUACGUACGUACGU + IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! @FAKE0012 Original version has mixed case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order) cgCUaugAcgCUaugAcgCUaugAcgCUaugAcgCUaugAc + IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! @FAKE0013 Original version has lower case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order) acugacugacugacugacugacugacugacugacugacuga + IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! @FAKE0014 Original version has mixed case ambiguous RNA with PHRED scores from 35 to 40 inclusive (cycled) NHBVDMKSWRYGAUCnhbvdmkswrygauc + IHGFEDIHGFEDIHGFEDIHGFEDIHGFED