Mercurial > repos > devteam > fastq_manipulation
diff test-data/misc_rna_original_sanger.fastqsanger @ 0:de14b969d713 draft
Imported from capsule None
| author | devteam |
|---|---|
| date | Thu, 23 Jan 2014 12:31:03 -0500 |
| parents | |
| children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/misc_rna_original_sanger.fastqsanger Thu Jan 23 12:31:03 2014 -0500 @@ -0,0 +1,16 @@ +@FAKE0011 Original version has lower case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order) +ACGUACGUACGUACGUACGUACGUACGUACGUACGUACGUA ++ +!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHI +@FAKE0012 Original version has mixed case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order) +gUcauAGcgUcauAGcgUcauAGcgUcauAGcgUcauAGcg ++ +!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHI +@FAKE0013 Original version has lower case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order) +ucagucagucagucagucagucagucagucagucagucagu ++ +!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHI +@FAKE0014 Original version has mixed case ambiguous RNA with PHRED scores from 35 to 40 inclusive (cycled) +gaucrywsmkhbvdnGAUCRYWSMKHBVDN ++ +DEFGHIDEFGHIDEFGHIDEFGHIDEFGHI