Mercurial > repos > devteam > fastq_manipulation
diff test-data/misc_dna_as_sanger_rev_comp_1.fastqsanger @ 0:de14b969d713 draft
Imported from capsule None
| author | devteam |
|---|---|
| date | Thu, 23 Jan 2014 12:31:03 -0500 |
| parents | |
| children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/misc_dna_as_sanger_rev_comp_1.fastqsanger Thu Jan 23 12:31:03 2014 -0500 @@ -0,0 +1,16 @@ +@FAKE0007 Original version has lower case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order) +TACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT ++ +IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! +@FAKE0008 Original version has mixed case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order) +cgCTatgAcgCTatgAcgCTatgAcgCTatgAcgCTatgAc ++ +IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! +@FAKE0009 Original version has lower case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order) +actgactgactgactgactgactgactgactgactgactga ++ +IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! +@FAKE0010 Original version has mixed case ambiguous DNA and PHRED scores of 40, 30, 20, 10 (cycled) +NHBVDMKSWRYGATCnhbvdmkswrygatc ++ +?I+5?I+5?I+5?I+5?I+5?I+5?I+5?I