Mercurial > repos > devteam > fasta_formatter
view fasta_formatter.xml @ 3:4f66158f20f2 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fasta_formatter commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
author | iuc |
---|---|
date | Tue, 08 May 2018 12:33:30 -0400 |
parents | 61469a8970cd |
children | 381e98a18f01 |
line wrap: on
line source
<tool id="cshl_fasta_formatter" version="1.0.1" name="FASTA Width"> <description>formatter</description> <macros> <import>macros.xml</import> </macros> <expand macro="requirements" /> <!-- Note: fasta_formatter also has a tabular output mode (-t), but Galaxy already contains such a tool, so no need to offer the user a duplicated tool. So this XML tool only changes the width (line-wrapping) of a FASTA file. --> <command detect_errors="exit_code"><![CDATA[ @CATS@ fasta_formatter -w $width -o '$output' ]]></command> <inputs> <expand macro="fasta_input" /> <param name="width" type="integer" value="0" label="New width for nucleotides strings" help="Use 0 for single line out." /> </inputs> <outputs> <data name="output" format="fasta" metadata_source="input" /> </outputs> <tests> <test> <!-- Re-format a FASTA file into a single line --> <param name="input" value="fasta_formatter1.fasta" /> <param name="width" value="0" /> <output name="output" file="fasta_formatter1.out" /> </test> <test> <!-- Re-format a FASTA file into multiple lines wrapping at 60 charactes --> <param name="input" value="fasta_formatter1.fasta" /> <param name="width" value="60" /> <output name="output" file="fasta_formatter2.out" /> </test> </tests> <help><![CDATA[ **What it does** This tool re-formats a FASTA file, changing the width of the nucleotides lines. **TIP:** Outputting a single line (with **width = 0**) can be useful for scripting (with **grep**, **awk**, and **perl**). Every odd line is a sequence identifier, and every even line is a nucleotides line. -------- **Example** Input FASTA file (each nucleotides line is 50 characters long):: >Scaffold3648 AGGAATGATGACTACAATGATCAACTTAACCTATCTATTTAATTTAGTTC CCTAATGTCAGGGACCTACCTGTTTTTGTTATGTTTGGGTTTTGTTGTTG TTGTTTTTTTAATCTGAAGGTATTGTGCATTATATGACCTGTAATACACA ATTAAAGTCAATTTTAATGAACATGTAGTAAAAACT >Scaffold9299 CAGCATCTACATAATATGATCGCTATTAAACTTAAATCTCCTTGACGGAG TCTTCGGTCATAACACAAACCCAGACCTACGTATATGACAAAGCTAATAG aactggtctttacctTTAAGTTG Output FASTA file (with width=80):: >Scaffold3648 AGGAATGATGACTACAATGATCAACTTAACCTATCTATTTAATTTAGTTCCCTAATGTCAGGGACCTACCTGTTTTTGTT ATGTTTGGGTTTTGTTGTTGTTGTTTTTTTAATCTGAAGGTATTGTGCATTATATGACCTGTAATACACAATTAAAGTCA ATTTTAATGAACATGTAGTAAAAACT >Scaffold9299 CAGCATCTACATAATATGATCGCTATTAAACTTAAATCTCCTTGACGGAGTCTTCGGTCATAACACAAACCCAGACCTAC GTATATGACAAAGCTAATAGaactggtctttacctTTAAGTTG Output FASTA file (with width=0 => single line):: >Scaffold3648 AGGAATGATGACTACAATGATCAACTTAACCTATCTATTTAATTTAGTTCCCTAATGTCAGGGACCTACCTGTTTTTGTTATGTTTGGGTTTTGTTGTTGTTGTTTTTTTAATCTGAAGGTATTGTGCATTATATGACCTGTAATACACAATTAAAGTCAATTTTAATGAACATGTAGTAAAAACT >Scaffold9299 CAGCATCTACATAATATGATCGCTATTAAACTTAAATCTCCTTGACGGAGTCTTCGGTCATAACACAAACCCAGACCTACGTATATGACAAAGCTAATAGaactggtctttacctTTAAGTTG ------ This tool is based on `FASTX-toolkit`__ by Assaf Gordon. .. __: http://hannonlab.cshl.edu/fastx_toolkit/ ]]></help> <expand macro="citations" /> </tool>