view emboss_isochore.xml @ 10:9b98d3d903c6 draft

planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/emboss_5 commit fc158bfe5f5927dc199321a2cf43310373cbc8ba

<tool id="EMBOSS: isochore47" name="isochore" version="5.0.0">
  <description>Plots isochores in large DNA sequences</description>
  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
  <command interpreter="perl">emboss_single_outputfile_wrapper.pl isochore -sequence $input1 -outfile $ofile2 -goutfile $ofile1 -graph png -window $window -shift $shift -auto</command>
  <!--  <command interpreter="perl">emboss_single_outputfile_wrapper.pl isochore -sequence $input1 -goutfile $ofile1 -graph png -window $window -shift $shift -auto</command>-->
  <inputs>
    <param format="fasta" name="input1" type="data">
      <label>Sequences</label>
    </param>
    <param name="window" type="text" value="1000">
      <label>Window size</label>
    </param>
    <param name="shift" type="text" value="100">
      <label>Shift increment</label>
    </param>
  </inputs>
  <outputs>
    <data format="png" name="ofile1" />
    <data format="isochore" name="ofile2" />
  </outputs>
  <!-- <tests>
    <test>
      <param name="input1" value="2.fasta"/>
      <param name="window" value="1000"/>
      <param name="shift" value="100"/>
      <output name="ofile1" file="emboss_isochore_out.isochore"/> 
      <output name="ofile2" file="emboss_isochore_out.isochore"/>
    </test>
         <test>
      <param name="input1" value="2.fasta"/>
      <param name="window" value="1000"/>
      <param name="shift" value="100"/>
      <output name="ofile2" file="emboss_isochore_out.isochore"/>
    </test> 
  </tests>-->
  <help>

.. class:: warningmark

The input dataset needs to be sequences.

-----

**Syntax**

This application plots GC content over a sequence. It is intended for large sequences such as complete chromosomes or large genomic contigs, although interesting results can also be obtained from shorter sequences. You can view the original documentation here_.    

    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/isochore.html

- Both **Window size** and **Shift increment** are intergers.

-----

**Example**

- Input sequences::

    >hg18_dna range=chrX:151073054-151073376 5'pad=0 3'pad=0 revComp=FALSE strand=? repeatMasking=none
    TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA
    GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTGTCTTTATGCCTCAGATT
    TGGAGTGCTCAGAGCCTCTGCAGCAAAGATTTGGCATGTGTCCTAGGCCT
    GCTCAGAGCAGCAAATCCCACCCTCTTGGAGAATGAGACTCATAGAGGGA
    CAGCTCCCTCCTCAGAGGCTTCTCTAATGGGACTCCAAAGAGCAAACACT
    CAGCCCCATGAGGACTGGCCAGGCCAAGTGGTGTGTGGGAACAGGGAGCA
    GCGGTTTCCAAGAGGATACAGTA

- Output data file::

    Position	Percent G+C 1 .. 323
    80	0.422
    112	0.460
    144	0.509
    176	0.534
    208	0.553
    240	0.553

- Output graphics file:

.. image:: ./static/emboss_icons/isochore.png

------

**Citation**

For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_

If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_

  </help>
</tool>