changeset 2:a6f581469476 draft

planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/cufflinks/cufflinks commit eb18f691975ef9539b5ebd4f118343c8ad967a1f
author devteam
date Tue, 07 Feb 2017 18:38:16 -0500
parents b9d29fdd1190
children 3afd198a1cf0
files cuff_macros.xml cufflinks_wrapper.py cufflinks_wrapper.xml tool_dependencies.xml
diffstat 4 files changed, 225 insertions(+), 247 deletions(-) [+]
line wrap: on
line diff
--- a/cuff_macros.xml	Tue Oct 13 12:37:52 2015 -0400
+++ b/cuff_macros.xml	Tue Feb 07 18:38:16 2017 -0500
@@ -1,11 +1,13 @@
 <macros>
   <token name="@VERSION@">2.2.1</token>
+
   <xml name="requirements">
     <requirements>
       <requirement type="package" version="2.2.1">cufflinks</requirement>
       <yield />
     </requirements>
   </xml>
+
   <xml name="stdio">
     <stdio>
         <exit_code range="1:" />
@@ -26,21 +28,21 @@
         </param>
         <when value="BAM">
             <repeat name="conditions" title="Condition" min="2">
-                <param name="name" title="Condition name" type="text" label="Name"/>
+                <param name="name" label="Condition name" type="text"/>
                 <param name="samples" label="Replicates" type="data" format="sam,bam" multiple="true"/>
             </repeat>
         </when>
         <when value="CXB">
             <repeat name="conditions" title="Condition" min="2">
-                <param name="name" title="Condition name" type="text" label="Name"/>
+                <param name="name" label="Condition name" type="text"/>
                 <param name="samples" label="Replicates" type="data" format="cxb" multiple="true"/>
             </repeat>
         </when>
         <when value="CONDITION_LIST">
-            <param name="conditions" title="List of Conditions" type="data_collection" collection_type="list" />
+            <param name="conditions" label="List of Conditions" type="data_collection" collection_type="list" />
         </when>
         <when value="CONDITION_REPLICATE_LIST">
-            <param name="conditions" title="List of Conditions" type="data_collection" collection_type="list:list" />
+            <param name="conditions" label="List of Conditions" type="data_collection" collection_type="list:list" />
         </when>
     </conditional>
   </xml>
@@ -48,16 +50,16 @@
             #if $in_type.set_in_type in ['BAM', 'CXB']
                 #for $condition in $in_type.conditions:
                     #set samples = ','.join( [ str( $sample ) for $sample in $condition.samples ] )
-                    $samples
+                    '$samples'
                 #end for
             #elif $in_type.set_in_type == 'CONDITION_LIST'
                 #for $sample in $in_type.conditions:
-                    $sample
+                    '$sample'
                 #end for
             #elif $in_type.set_in_type == 'CONDITION_REPLICATE_LIST'
                 #for $condition_list in $in_type.conditions:
                     #set samples = ','.join( [ str( $sample ) for $sample in $condition_list ] )
-                    $samples
+                    '$samples'
                 #end for
             #end if
   </token>
@@ -79,11 +81,11 @@
   <token name="@CUFFLINKS_GTF_INPUTS@">
             ## Inputs.
             #for $input_file in $inputs:
-                "${input_file}"
+                '${input_file}'
             #end for
             #for $additional_input in $additional_inputs:
                 #for $input_file in $additional_input.additional_inputs:
-                  "${input_file}"
+                    '${input_file}'
                 #end for
             #end for
   </token>
--- a/cufflinks_wrapper.py	Tue Oct 13 12:37:52 2015 -0400
+++ b/cufflinks_wrapper.py	Tue Feb 07 18:38:16 2017 -0500
@@ -6,88 +6,86 @@
 import subprocess
 import sys
 import tempfile
-from galaxy.datatypes.util.gff_util import parse_gff_attributes, gff_attributes_to_str
+
+from galaxy.datatypes.util.gff_util import gff_attributes_to_str, parse_gff_attributes
 
 
-def stop_err( msg ):
-    sys.exit( "%s\n" % msg )
+def stop_err(msg):
+    sys.exit("%s\n" % msg)
 
 
 def __main__():
-    #Parse Command Line
     parser = optparse.OptionParser()
-    parser.add_option( '-1', '--input', dest='input', help=' file of RNA-Seq read alignments in the SAM format. SAM is a standard short read alignment, that allows aligners to attach custom tags to individual alignments, and Cufflinks requires that the alignments you supply have some of these tags. Please see Input formats for more details.' )
-    parser.add_option( '-I', '--max-intron-length', dest='max_intron_len', help='The minimum intron length. Cufflinks will not report transcripts with introns longer than this, and will ignore SAM alignments with REF_SKIP CIGAR operations longer than this. The default is 300,000.' )
-    parser.add_option( '-F', '--min-isoform-fraction', dest='min_isoform_fraction', help='After calculating isoform abundance for a gene, Cufflinks filters out transcripts that it believes are very low abundance, because isoforms expressed at extremely low levels often cannot reliably be assembled, and may even be artifacts of incompletely spliced precursors of processed transcripts. This parameter is also used to filter out introns that have far fewer spliced alignments supporting them. The default is 0.05, or 5% of the most abundant isoform (the major isoform) of the gene.' )
-    parser.add_option( '-j', '--pre-mrna-fraction', dest='pre_mrna_fraction', help='Some RNA-Seq protocols produce a significant amount of reads that originate from incompletely spliced transcripts, and these reads can confound the assembly of fully spliced mRNAs. Cufflinks uses this parameter to filter out alignments that lie within the intronic intervals implied by the spliced alignments. The minimum depth of coverage in the intronic region covered by the alignment is divided by the number of spliced reads, and if the result is lower than this parameter value, the intronic alignments are ignored. The default is 5%.' )
-    parser.add_option( '-p', '--num-threads', dest='num_threads', help='Use this many threads to align reads. The default is 1.' )
-    parser.add_option( '-G', '--GTF', dest='GTF', help='Tells Cufflinks to use the supplied reference annotation to estimate isoform expression. It will not assemble novel transcripts, and the program will ignore alignments not structurally compatible with any reference transcript.' )
+    parser.add_option('-1', '--input', dest='input', help=' file of RNA-Seq read alignments in the SAM format. SAM is a standard short read alignment, that allows aligners to attach custom tags to individual alignments, and Cufflinks requires that the alignments you supply have some of these tags. Please see Input formats for more details.')
+    parser.add_option('-I', '--max-intron-length', dest='max_intron_len', help='The minimum intron length. Cufflinks will not report transcripts with introns longer than this, and will ignore SAM alignments with REF_SKIP CIGAR operations longer than this. The default is 300,000.')
+    parser.add_option('-F', '--min-isoform-fraction', dest='min_isoform_fraction', help='After calculating isoform abundance for a gene, Cufflinks filters out transcripts that it believes are very low abundance, because isoforms expressed at extremely low levels often cannot reliably be assembled, and may even be artifacts of incompletely spliced precursors of processed transcripts. This parameter is also used to filter out introns that have far fewer spliced alignments supporting them. The default is 0.05, or 5% of the most abundant isoform (the major isoform) of the gene.')
+    parser.add_option('-j', '--pre-mrna-fraction', dest='pre_mrna_fraction', help='Some RNA-Seq protocols produce a significant amount of reads that originate from incompletely spliced transcripts, and these reads can confound the assembly of fully spliced mRNAs. Cufflinks uses this parameter to filter out alignments that lie within the intronic intervals implied by the spliced alignments. The minimum depth of coverage in the intronic region covered by the alignment is divided by the number of spliced reads, and if the result is lower than this parameter value, the intronic alignments are ignored. The default is 5%.')
+    parser.add_option('-p', '--num-threads', dest='num_threads', help='Use this many threads to align reads. The default is 1.')
+    parser.add_option('-G', '--GTF', dest='GTF', help='Tells Cufflinks to use the supplied reference annotation to estimate isoform expression. It will not assemble novel transcripts, and the program will ignore alignments not structurally compatible with any reference transcript.')
     parser.add_option("--compatible-hits-norm", dest='compatible_hits_norm', action="store_true", help='Count hits compatible with reference RNAs only')
-    parser.add_option( '-g', '--GTF-guide', dest='GTFguide', help='use reference transcript annotation to guide assembly' )
+    parser.add_option('-g', '--GTF-guide', dest='GTFguide', help='use reference transcript annotation to guide assembly')
     parser.add_option("--3-overhang-tolerance", dest='three_overhang_tolerance', help='The number of bp allowed to overhang the 3prime end of a reference transcript when determining if an assembled transcript should be merged with it (ie, the assembled transcript is not novel). The default is 600 bp.')
     parser.add_option("--intron-overhang-tolerance", dest='intron_overhang_tolerance', help='The number of bp allowed to enter the intron of a reference transcript when determining if an assembled transcript should be merged with it (ie, the assembled transcript is not novel). The default is 50 bp.')
     parser.add_option("--no-faux-reads", dest='no_faux_reads', help='This option disables tiling of the reference transcripts with faux reads. Use this if you only want to use sequencing reads in assembly but do not want to output assembled transcripts that lay within reference transcripts. All reference transcripts in the input annotation will also be included in the output.')
-    parser.add_option( '-u', '--multi-read-correct', dest='multi_read_correct', action="store_true", help='Tells Cufflinks to do an initial estimation procedure to more accurately weight reads mapping to multiple locations in the genome')
+    parser.add_option('-u', '--multi-read-correct', dest='multi_read_correct', action="store_true", help='Tells Cufflinks to do an initial estimation procedure to more accurately weight reads mapping to multiple locations in the genome')
 
     # Normalization options.
-    parser.add_option( "--no-effective-length-correction", dest="no_effective_length_correction", action="store_true" )
-    parser.add_option( "--no-length-correction", dest="no_length_correction", action="store_true" )
+    parser.add_option("--no-effective-length-correction", dest="no_effective_length_correction", action="store_true")
+    parser.add_option("--no-length-correction", dest="no_length_correction", action="store_true")
 
     # Wrapper / Galaxy options.
-    parser.add_option( '-A', '--assembled-isoforms-output', dest='assembled_isoforms_output_file', help='Assembled isoforms output file; formate is GTF.' )
+    parser.add_option('-A', '--assembled-isoforms-output', dest='assembled_isoforms_output_file', help='Assembled isoforms output file; formate is GTF.')
 
     # Advanced Options:
-    parser.add_option( "--library-type", dest="library_type", help=' library prep used for input reads, default fr-unstranded')
-    parser.add_option( '-M', '--mask-file', dest='mask_file', help='Tells Cufflinks to ignore all reads that could have come from transcripts in this GTF file. \
+    parser.add_option("--library-type", dest="library_type", help=' library prep used for input reads, default fr-unstranded')
+    parser.add_option('-M', '--mask-file', dest='mask_file', help='Tells Cufflinks to ignore all reads that could have come from transcripts in this GTF file. \
                                                                    We recommend including any annotated rRNA, mitochondrial transcripts other abundant transcripts \
                                                                    you wish to ignore in your analysis in this file. Due to variable efficiency of mRNA enrichment \
                                                                    methods and rRNA depletion kits, masking these transcripts often improves the overall robustness \
                                                                    of transcript abundance estimates.')
-    parser.add_option( '-m', '--inner-mean-dist', dest='inner_mean_dist', help='This is the expected (mean) inner distance between mate pairs. \
+    parser.add_option('-m', '--inner-mean-dist', dest='inner_mean_dist', help='This is the expected (mean) inner distance between mate pairs. \
                                                                                 For, example, for paired end runs with fragments selected at 300bp, \
                                                                                 where each end is 50bp, you should set -r to be 200. The default is 45bp.')  # cufflinks: --frag-len-mean
 
-    parser.add_option( '-s', '--inner-dist-std-dev', dest='inner_dist_std_dev', help='The standard deviation for the distribution on inner distances between mate pairs. The default is 20bp.' )  # cufflinks: --frag-len-std-dev
-    parser.add_option( '--max-mle-iterations', dest='max_mle_iterations', help='Sets the number of iterations allowed during maximum likelihood estimation of abundances. Default: 5000' )
-    parser.add_option( '--junc-alpha', dest='junc_alpha', help='Alpha value for the binomial test used during false positive spliced alignment filtration. Default: 0.001' )
-    parser.add_option( '--small-anchor-fraction', dest='small_anchor_fraction', help='Spliced reads with less than this percent of their length on each side of\
-                                                                                      the junction are considered suspicious and are candidates for filtering prior to assembly. Default: 0.09.' )
-    parser.add_option( '--overhang-tolerance', dest='overhang_tolerance', help='The number of bp allowed to enter the intron of a transcript when determining if a \
-                                                                                read or another transcript is mappable to/compatible with it. The default is 8 bp based on the default bowtie/TopHat parameters.' )
-    parser.add_option( '--max-bundle-length', dest='max_bundle_length', help='Maximum genomic length of a given bundle" help="Default: 3,500,000bp' )
-    parser.add_option( '--max-bundle-frags', dest='max_bundle_frags', help='Sets the maximum number of fragments a locus may have before being skipped. Skipped loci are listed in skipped.gtf. Default: 1,000,000' )
-    parser.add_option( '--min-intron-length', dest='min_intron_length', help='Minimal allowed intron size. Default: 50' )
-    parser.add_option( '--trim-3-avgcov-thresh', dest='trim_three_avgcov_thresh', help='Minimum average coverage required to attempt 3prime trimming. Default: 10' )
-    parser.add_option( '--trim-3-dropoff-frac', dest='trim_three_dropoff_frac', help='The fraction of average coverage below which to trim the 3prime end of an assembled transcript. Default: 0.1' )
+    parser.add_option('-s', '--inner-dist-std-dev', dest='inner_dist_std_dev', help='The standard deviation for the distribution on inner distances between mate pairs. The default is 20bp.')  # cufflinks: --frag-len-std-dev
+    parser.add_option('--max-mle-iterations', dest='max_mle_iterations', help='Sets the number of iterations allowed during maximum likelihood estimation of abundances. Default: 5000')
+    parser.add_option('--junc-alpha', dest='junc_alpha', help='Alpha value for the binomial test used during false positive spliced alignment filtration. Default: 0.001')
+    parser.add_option('--small-anchor-fraction', dest='small_anchor_fraction', help='Spliced reads with less than this percent of their length on each side of\
+                                                                                      the junction are considered suspicious and are candidates for filtering prior to assembly. Default: 0.09.')
+    parser.add_option('--overhang-tolerance', dest='overhang_tolerance', help='The number of bp allowed to enter the intron of a transcript when determining if a \
+                                                                                read or another transcript is mappable to/compatible with it. The default is 8 bp based on the default bowtie/TopHat parameters.')
+    parser.add_option('--max-bundle-length', dest='max_bundle_length', help='Maximum genomic length of a given bundle" help="Default: 3,500,000bp')
+    parser.add_option('--max-bundle-frags', dest='max_bundle_frags', help='Sets the maximum number of fragments a locus may have before being skipped. Skipped loci are listed in skipped.gtf. Default: 1,000,000')
+    parser.add_option('--min-intron-length', dest='min_intron_length', help='Minimal allowed intron size. Default: 50')
+    parser.add_option('--trim-3-avgcov-thresh', dest='trim_three_avgcov_thresh', help='Minimum average coverage required to attempt 3prime trimming. Default: 10')
+    parser.add_option('--trim-3-dropoff-frac', dest='trim_three_dropoff_frac', help='The fraction of average coverage below which to trim the 3prime end of an assembled transcript. Default: 0.1')
 
     # Bias correction options.
-    parser.add_option( '-b', dest='do_bias_correction', action="store_true", help='Providing Cufflinks with a multifasta file via this option instructs it to run our new bias detection and correction algorithm which can significantly improve accuracy of transcript abundance estimates.')
-    parser.add_option( '', '--index', dest='index', help='The path of the reference genome' )
-    parser.add_option( '', '--ref_file', dest='ref_file', help='The reference dataset from the history' )
+    parser.add_option('-b', dest='do_bias_correction', action="store_true", help='Providing Cufflinks with a multifasta file via this option instructs it to run our new bias detection and correction algorithm which can significantly improve accuracy of transcript abundance estimates.')
+    parser.add_option('', '--index', dest='index', help='The path of the reference genome')
+    parser.add_option('', '--ref_file', dest='ref_file', help='The reference dataset from the history')
 
     # Global model (for trackster).
-    parser.add_option( '', '--global_model', dest='global_model_file', help='Global model used for computing on local data' )
+    parser.add_option('', '--global_model', dest='global_model_file', help='Global model used for computing on local data')
 
     (options, args) = parser.parse_args()
 
     # output version # of tool
     try:
-        tmp = tempfile.NamedTemporaryFile().name
-        tmp_stdout = open( tmp, 'wb' )
-        proc = subprocess.Popen( args='cufflinks --no-update-check 2>&1', shell=True, stdout=tmp_stdout )
-        tmp_stdout.close()
-        returncode = proc.wait()
-        stdout = None
-        for line in open( tmp_stdout.name, 'rb' ):
-            if line.lower().find( 'cufflinks v' ) >= 0:
-                stdout = line.strip()
-                break
+        with tempfile.NamedTemporaryFile() as tmp_stdout:
+            returncode = subprocess.call(args='cufflinks --no-update-check 2>&1', stdout=tmp_stdout, shell=True)
+            stdout = None
+            with open(tmp_stdout.name) as tmp_stdout2:
+                for line in tmp_stdout2:
+                    if line.lower().find('cufflinks v') >= 0:
+                        stdout = line.strip()
+                        break
         if stdout:
-            sys.stdout.write( '%s\n' % stdout )
+            sys.stdout.write('%s\n' % stdout)
         else:
             raise Exception
     except:
-        sys.stdout.write( 'Could not determine Cufflinks version\n' )
+        sys.stdout.write('Could not determine Cufflinks version\n')
 
     # If doing bias correction, set/link to sequence file.
     if options.do_bias_correction:
@@ -95,10 +93,10 @@
             # Sequence data from history.
             # Create symbolic link to ref_file so that index will be created in working directory.
             seq_path = "ref.fa"
-            os.symlink( options.ref_file, seq_path )
+            os.symlink(options.ref_file, seq_path)
         else:
-            if not os.path.exists( options.index ):
-                stop_err( 'Reference genome %s not present, request it by reporting this error.' % options.index )
+            if not os.path.exists(options.index):
+                stop_err('Reference genome %s not present, request it by reporting this error.' % options.index)
             seq_path = options.index
 
     # Build command.
@@ -108,148 +106,126 @@
 
     # Add options.
     if options.max_intron_len:
-        cmd += ( " -I %i" % int( options.max_intron_len ) )
+        cmd += (" -I %i" % int(options.max_intron_len))
     if options.min_isoform_fraction:
-        cmd += ( " -F %f" % float( options.min_isoform_fraction ) )
+        cmd += (" -F %f" % float(options.min_isoform_fraction))
     if options.pre_mrna_fraction:
-        cmd += ( " -j %f" % float( options.pre_mrna_fraction ) )
+        cmd += (" -j %f" % float(options.pre_mrna_fraction))
     if options.num_threads:
-        cmd += ( " -p %i" % int( options.num_threads ) )
+        cmd += (" -p %i" % int(options.num_threads))
     if options.GTF:
-        cmd += ( " -G %s" % options.GTF )
+        cmd += (" -G %s" % options.GTF)
     if options.compatible_hits_norm:
-        cmd += ( " --compatible-hits-norm" )
+        cmd += (" --compatible-hits-norm")
     if options.GTFguide:
-        cmd += ( " -g %s" % options.GTFguide )
-        cmd += ( " --3-overhang-tolerance %i" % int( options.three_overhang_tolerance ) )
-        cmd += ( " --intron-overhang-tolerance %i" % int( options.intron_overhang_tolerance ) )
+        cmd += (" -g %s" % options.GTFguide)
+        cmd += (" --3-overhang-tolerance %i" % int(options.three_overhang_tolerance))
+        cmd += (" --intron-overhang-tolerance %i" % int(options.intron_overhang_tolerance))
     if options.no_faux_reads:
-        cmd += ( " --no-faux-reads" )
+        cmd += (" --no-faux-reads")
     if options.multi_read_correct:
-        cmd += ( " -u" )
+        cmd += (" -u")
 
     if options.library_type and options.library_type != 'auto':
-        cmd += ( " --library-type %s" % options.library_type)
+        cmd += (" --library-type %s" % options.library_type)
     if options.mask_file:
-        cmd += ( " --mask-file %s" % options.mask_file )
+        cmd += (" --mask-file %s" % options.mask_file)
     if options.inner_mean_dist:
-        cmd += ( " -m %i" % int( options.inner_mean_dist ) )
+        cmd += (" -m %i" % int(options.inner_mean_dist))
     if options.inner_dist_std_dev:
-        cmd += ( " -s %i" % int( options.inner_dist_std_dev ) )
+        cmd += (" -s %i" % int(options.inner_dist_std_dev))
     if options.max_mle_iterations:
-        cmd += ( " --max-mle-iterations %i" % int( options.max_mle_iterations ) )
+        cmd += (" --max-mle-iterations %i" % int(options.max_mle_iterations))
     if options.junc_alpha:
-        cmd += ( " --junc-alpha %f" % float( options.junc_alpha) )
+        cmd += (" --junc-alpha %f" % float(options.junc_alpha))
     if options.small_anchor_fraction:
-        cmd += ( " --small-anchor-fraction %f" % float(options.small_anchor_fraction ) )
+        cmd += (" --small-anchor-fraction %f" % float(options.small_anchor_fraction))
     if options.overhang_tolerance:
-        cmd += ( " --overhang-tolerance %i" % int( options.overhang_tolerance ) )
+        cmd += (" --overhang-tolerance %i" % int(options.overhang_tolerance))
     if options.max_bundle_length:
-        cmd += ( " --max-bundle-length %i" % int( options.max_bundle_length ) )
+        cmd += (" --max-bundle-length %i" % int(options.max_bundle_length))
     if options.max_bundle_frags:
-        cmd += ( " --max-bundle-frags %i" % int( options.max_bundle_frags ) )
+        cmd += (" --max-bundle-frags %i" % int(options.max_bundle_frags))
     if options.min_intron_length:
-        cmd += ( " --min-intron-length %i" % int( options.min_intron_length ) )
+        cmd += (" --min-intron-length %i" % int(options.min_intron_length))
     if options.trim_three_avgcov_thresh:
-        cmd += ( " --trim-3-avgcov-thresh %i" % int( options.trim_three_avgcov_thresh ) )
+        cmd += (" --trim-3-avgcov-thresh %i" % int(options.trim_three_avgcov_thresh))
     if options.trim_three_dropoff_frac:
-        cmd += ( " --trim-3-dropoff-frac %f" % float( options.trim_three_dropoff_frac ) )
+        cmd += (" --trim-3-dropoff-frac %f" % float(options.trim_three_dropoff_frac))
 
     if options.do_bias_correction:
-        cmd += ( " -b %s" % seq_path )
+        cmd += (" -b %s" % seq_path)
     if options.no_effective_length_correction:
-        cmd += ( " --no-effective-length-correction" )
+        cmd += (" --no-effective-length-correction")
     if options.no_length_correction:
-        cmd += ( " --no-length-correction" )
+        cmd += (" --no-length-correction")
 
     # Add input files.
     cmd += " " + options.input
 
-    # Debugging.
-    print cmd
-
-    #
     # Run command and handle output.
-    #
     try:
-        #
         # Run command.
-        #
-        tmp_name = tempfile.NamedTemporaryFile( dir="." ).name
-        tmp_stderr = open( tmp_name, 'wb' )
-        proc = subprocess.Popen( args=cmd, shell=True, stderr=tmp_stderr.fileno() )
-        returncode = proc.wait()
-        tmp_stderr.close()
+        with tempfile.NamedTemporaryFile(dir=".") as tmp_stderr:
+            returncode = subprocess.call(args=cmd, stderr=tmp_stderr, shell=True)
 
-        # Error checking.
-        if returncode != 0:
-            raise Exception("return code = %i" % returncode)
-
-        #
-        # Handle output.
-        #
+            # Error checking.
+            if returncode != 0:
+                # Get stderr, allowing for case where it's very large.
+                buffsize = 1048576
+                stderr = ''
+                with open(tmp_stderr.name) as tmp_stderr2:
+                    try:
+                        while True:
+                            stderr += tmp_stderr2.read(buffsize)
+                            if not stderr or len(stderr) % buffsize != 0:
+                                break
+                    except OverflowError:
+                        pass
+                raise Exception(stderr)
 
-        # Read standard error to get total map/upper quartile mass.
-        total_map_mass = -1
-        tmp_stderr = open( tmp_name, 'r' )
-        for line in tmp_stderr:
-            if line.lower().find( "map mass" ) >= 0 or line.lower().find( "upper quartile" ) >= 0:
-                total_map_mass = float( line.split(":")[1].strip() )
-                break
-        tmp_stderr.close()
+            # Read standard error to get total map/upper quartile mass.
+            total_map_mass = -1
+            with open(tmp_stderr.name, 'r') as tmp_stderr2:
+                for line in tmp_stderr2:
+                    if line.lower().find("map mass") >= 0 or line.lower().find("upper quartile") >= 0:
+                        total_map_mass = float(line.split(":")[1].strip())
+                        break
 
-        #
         # If there's a global model provided, use model's total map mass
         # to adjust FPKM + confidence intervals.
-        #
         if options.global_model_file:
             # Global model is simply total map mass from original run.
-            global_model_file = open( options.global_model_file, 'r' )
-            global_model_total_map_mass = float( global_model_file.readline() )
-            global_model_file.close()
+            with open(options.global_model_file, 'r') as global_model_file:
+                global_model_total_map_mass = float(global_model_file.readline())
 
             # Ratio of global model's total map mass to original run's map mass is
             # factor used to adjust FPKM.
             fpkm_map_mass_ratio = total_map_mass / global_model_total_map_mass
 
             # Update FPKM values in transcripts.gtf file.
-            transcripts_file = open( "transcripts.gtf", 'r' )
-            tmp_transcripts = tempfile.NamedTemporaryFile( dir="." ).name
-            new_transcripts_file = open( tmp_transcripts, 'w' )
-            for line in transcripts_file:
-                fields = line.split( '\t' )
-                attrs = parse_gff_attributes( fields[8] )
-                attrs[ "FPKM" ] = str( float( attrs[ "FPKM" ] ) * fpkm_map_mass_ratio )
-                attrs[ "conf_lo" ] = str( float( attrs[ "conf_lo" ] ) * fpkm_map_mass_ratio )
-                attrs[ "conf_hi" ] = str( float( attrs[ "conf_hi" ] ) * fpkm_map_mass_ratio )
-                fields[8] = gff_attributes_to_str( attrs, "GTF" )
-                new_transcripts_file.write( "%s\n" % '\t'.join( fields ) )
-            transcripts_file.close()
-            new_transcripts_file.close()
-            shutil.copyfile( tmp_transcripts, "transcripts.gtf" )
+            with open("transcripts.gtf", 'r') as transcripts_file:
+                with tempfile.NamedTemporaryFile(dir=".", delete=False) as new_transcripts_file:
+                    for line in transcripts_file:
+                        fields = line.split('\t')
+                        attrs = parse_gff_attributes(fields[8])
+                        attrs["FPKM"] = str(float(attrs["FPKM"]) * fpkm_map_mass_ratio)
+                        attrs["conf_lo"] = str(float(attrs["conf_lo"]) * fpkm_map_mass_ratio)
+                        attrs["conf_hi"] = str(float(attrs["conf_hi"]) * fpkm_map_mass_ratio)
+                        fields[8] = gff_attributes_to_str(attrs, "GTF")
+                        new_transcripts_file.write("%s\n" % '\t'.join(fields))
+            shutil.move(new_transcripts_file.name, "transcripts.gtf")
 
         # TODO: update expression files as well.
 
         # Set outputs. Transcript and gene expression handled by wrapper directives.
-        shutil.copyfile( "transcripts.gtf", options.assembled_isoforms_output_file )
+        shutil.move("transcripts.gtf", options.assembled_isoforms_output_file)
         if total_map_mass > -1:
-            f = open( "global_model.txt", 'w' )
-            f.write( "%f\n" % total_map_mass )
-            f.close()
-    except Exception, e:
-        # Read stderr so that it can be reported:
-        tmp_stderr = open( tmp_name, 'rb' )
-        stderr = ''
-        buffsize = 1048576
-        try:
-            while True:
-                stderr += tmp_stderr.read( buffsize )
-                if not stderr or len( stderr ) % buffsize != 0:
-                    break
-        except OverflowError:
-            pass
-        tmp_stderr.close()
-        stop_err( 'Error running cufflinks.\n%s\n%s' % ( str( e ), stderr ) )
+            with open("global_model.txt", 'w') as f:
+                f.write("%f\n" % total_map_mass)
+    except Exception as e:
+        stop_err('Error running cufflinks: %s' % e)
+
 
 if __name__ == "__main__":
     __main__()
--- a/cufflinks_wrapper.xml	Tue Oct 13 12:37:52 2015 -0400
+++ b/cufflinks_wrapper.xml	Tue Feb 07 18:38:16 2017 -0500
@@ -1,76 +1,79 @@
-<tool id="cufflinks" name="Cufflinks" version="@VERSION@.0">
+<tool id="cufflinks" name="Cufflinks" version="@VERSION@.1">
     <description>transcript assembly and FPKM (RPKM) estimates for RNA-Seq data</description>
-    <expand macro="requirements" />
-    <expand macro="stdio" />
     <macros>
       <import>cuff_macros.xml</import>
     </macros>
+    <requirements>
+      <requirement type="package" version="0.7.3">bx-python</requirement>
+      <requirement type="package" version="1.9.0">six</requirement>
+      <requirement type="package" version="2.2.1">cufflinks</requirement>
+    </requirements>
+    <expand macro="stdio" />
     <version_command>cufflinks 2>&amp;1 | head -n 1</version_command>
-    <command interpreter="python">
-        cufflinks_wrapper.py 
-            --input=$input
-            --assembled-isoforms-output=$assembled_isoforms
-            --num-threads="\${GALAXY_SLOTS:-4}"
+    <command>
+        python '$__tool_directory__/cufflinks_wrapper.py'
+            --input '$input'
+            --assembled-isoforms-output '$assembled_isoforms'
+            --num-threads "\${GALAXY_SLOTS:-4}"
             -I $max_intron_len
             -F $min_isoform_fraction
             -j $pre_mrna_fraction
             $length_correction
-            
+
             ## Include reference annotation?
             #if $reference_annotation.use_ref == "Use reference annotation":
-                -G $reference_annotation.reference_annotation_file
+                -G '$reference_annotation.reference_annotation_file'
                 $reference_annotation.compatible_hits_norm
             #end if
             #if $reference_annotation.use_ref == "Use reference annotation guide":
-                -g $reference_annotation.reference_annotation_guide_file
-                --3-overhang-tolerance=$reference_annotation.three_overhang_tolerance
-                --intron-overhang-tolerance=$reference_annotation.intron_overhang_tolerance
+                -g '$reference_annotation.reference_annotation_guide_file'
+                --3-overhang-tolerance $reference_annotation.three_overhang_tolerance
+                --intron-overhang-tolerance $reference_annotation.intron_overhang_tolerance
                 $reference_annotation.no_faux_reads
             #end if
-            
+
             ## Bias correction?
             #if $bias_correction.do_bias_correction == "Yes":
                 -b
                 #if $bias_correction.seq_source.index_source == "history":
-                    --ref_file=$bias_correction.seq_source.ref_file
+                    --ref_file '$bias_correction.seq_source.ref_file'
                 #else:
-                    --index=${bias_correction.seq_source.index.fields.path}
+                    --index '${bias_correction.seq_source.index.fields.path}'
                 #end if
             #end if
 
             ## Multi-read correct?
             #if str($multiread_correct) == "Yes":
-            -u
+                -u
             #end if
 
             ## Include global model if available.
             #if $global_model:
-                --global_model=$global_model
+                --global_model '$global_model'
             #end if
 
             ## advanced settings
             #if $advanced_settings.use_advanced_settings == "Yes":
-            --library-type=$advanced_settings.library_type
-            #if $advanced_settings.mask_file:
-                --mask-file=$advanced_settings.mask_file
+                --library-type $advanced_settings.library_type
+                #if $advanced_settings.mask_file:
+                    --mask-file '$advanced_settings.mask_file'
                 #end if
-            --inner-mean-dist=$advanced_settings.inner_mean_dist
-            --inner-dist-std-dev=$advanced_settings.inner_dist_std_dev
-            --max-mle-iterations=$advanced_settings.max_mle_iterations
-            --junc-alpha=$advanced_settings.junc_alpha
-            --small-anchor-fraction=$advanced_settings.small_anchor_fraction
-            --overhang-tolerance=$advanced_settings.overhang_tolerance
-            --max-bundle-length=$advanced_settings.max_bundle_length
-            --max-bundle-frags=$advanced_settings.max_bundle_frags
-            --min-intron-length=$advanced_settings.min_intron_length
-            --trim-3-avgcov-thresh=$advanced_settings.trim_three_avgcov_thresh
-            --trim-3-dropoff-frac=$advanced_settings.trim_three_dropoff_frac
+                --inner-mean-dist $advanced_settings.inner_mean_dist
+                --inner-dist-std-dev $advanced_settings.inner_dist_std_dev
+                --max-mle-iterations $advanced_settings.max_mle_iterations
+                --junc-alpha $advanced_settings.junc_alpha
+                --small-anchor-fraction $advanced_settings.small_anchor_fraction
+                --overhang-tolerance $advanced_settings.overhang_tolerance
+                --max-bundle-length $advanced_settings.max_bundle_length
+                --max-bundle-frags $advanced_settings.max_bundle_frags
+                --min-intron-length $advanced_settings.min_intron_length
+                --trim-3-avgcov-thresh $advanced_settings.trim_three_avgcov_thresh
+                --trim-3-dropoff-frac $advanced_settings.trim_three_dropoff_frac
             #end if
-
     </command>
     <inputs>
         <param format="sam,bam" name="input" type="data" label="SAM or BAM file of aligned RNA-Seq reads" help=""/>
-    <param name="max_intron_len" type="integer" value="300000" min="1" max="600000" label="Max Intron Length" help="ignore alignments with gaps longer than this"/>
+        <param name="max_intron_len" type="integer" value="300000" min="1" max="600000" label="Max Intron Length" help="ignore alignments with gaps longer than this"/>
         <param name="min_isoform_fraction" type="float" value="0.10" min="0" max="1" label="Min Isoform Fraction" help="suppress transcripts below this abundance level"/>
         <param name="pre_mrna_fraction" type="float" value="0.15" min="0" max="1" label="Pre MRNA Fraction" help="suppress intra-intronic transcripts below this level"/>
         <conditional name="reference_annotation">
@@ -79,18 +82,18 @@
                 <option value="Use reference annotation">Use reference annotation</option>
                 <option value="Use reference annotation guide">Use reference annotation as guide</option>
             </param>
-            <when value="No"></when>
+            <when value="No" />
             <when value="Use reference annotation">
                 <param format="gff3,gtf" name="reference_annotation_file" type="data" label="Reference Annotation" help="Gene annotation dataset in GTF or GFF3 format."/>
-        <param name="compatible_hits_norm" type="select" label="Count hits compatible with reference RNAs only" 
-            help="With this option, Cufflinks counts only those fragments compatible with some reference transcript towards the number of mapped hits used in the FPKM denominator. This option can only be used in combination with --GTF.">
-            <option value="" selected="True">No</option>
-            <option value="--compatible-hits-norm">Yes</option>
-        </param>
+                <param name="compatible_hits_norm" type="select" label="Count hits compatible with reference RNAs only"
+                    help="With this option, Cufflinks counts only those fragments compatible with some reference transcript towards the number of mapped hits used in the FPKM denominator. This option can only be used in combination with --GTF.">
+                    <option value="" selected="True">No</option>
+                    <option value="--compatible-hits-norm">Yes</option>
+                </param>
             </when>
             <when value="Use reference annotation guide">
                 <param format="gff3,gtf" name="reference_annotation_guide_file" type="data" label="Reference Annotation" help="Gene annotation dataset in GTF or GFF3 format."/>
-                <param name="three_overhang_tolerance" type="integer" value="600" label="3prime overhang tolerance" 
+                <param name="three_overhang_tolerance" type="integer" value="600" label="3prime overhang tolerance"
                     help="The number of bp allowed to overhang the 3prime end of a reference transcript when determining if an assembled transcript should be merged with it (ie, the assembled transcript is not novel). The default is 600 bp." />
                 <param name="intron_overhang_tolerance" type="integer" value="50" label="Intronic overhang tolerance" help="The number of bp allowed to enter the intron of a reference transcript when determining if an assembled transcript should be merged with it (ie, the assembled transcript is not novel). The default is 50 bp." />
                 <param name="no_faux_reads" type="select" label="Disable tiling of reference transcripts" help="This option disables tiling of the reference transcripts with faux reads. Use this if you only want to use sequencing reads in assembly but do not want to output assembled transcripts that lay within reference transcripts. All reference transcripts in the input annotation will also be included in the output.">
@@ -107,27 +110,27 @@
             </param>
             <when value="Yes">
                 <conditional name="seq_source">
-                  <param name="index_source" type="select" label="Reference sequence data">
-                    <option value="cached"  selected="true">Locally cached</option>
-                    <option value="history">History</option>
-                  </param>
-                  <when value="cached">
-                    <param name="index" type="select" label="Using reference genome">
-                      <options from_data_table="fasta_indexes">
-                        <filter type="data_meta" ref="input" key="dbkey" column="1" />
-                        <validator type="no_options" message="No reference genome is available for the build associated with the selected input dataset" />
-                      </options>
+                    <param name="index_source" type="select" label="Reference sequence data">
+                        <option value="cached" selected="true">Locally cached</option>
+                        <option value="history">History</option>
                     </param>
-                  </when>
-                  <when value="history">
-                      <param name="ref_file" type="data" format="fasta" label="Using reference file" />
-                  </when>
+                    <when value="cached">
+                        <param name="index" type="select" label="Using reference genome">
+                            <options from_data_table="fasta_indexes">
+                                <filter type="data_meta" ref="input" key="dbkey" column="1" />
+                                <validator type="no_options" message="No reference genome is available for the build associated with the selected input dataset" />
+                            </options>
+                        </param>
+                    </when>
+                    <when value="history">
+                        <param name="ref_file" type="data" format="fasta" label="Using reference file" />
+                    </when>
                 </conditional>
             </when>
-            <when value="No"></when>
+            <when value="No" />
         </conditional>
-        
-        <param name="multiread_correct" type="select" label="Use multi-read correct" 
+
+        <param name="multiread_correct" type="select" label="Use multi-read correct"
             help="Tells Cufflinks to do an initial estimation procedure to more accurately weight reads mapping to multiple locations in the genome.">
             <option value="No" selected="true">No</option>
             <option value="Yes">Yes</option>
@@ -136,7 +139,7 @@
         <param name="length_correction" type="select" label="Apply length correction" help="Mode of length normalization to transcript FPKM.">
             <option value="" selected="true">Cufflinks Effective Length Correction</option>
             <option value="--no-effective-length-correction">Standard Length Correction</option>
-        <option value="--no-length-correction">No Length Correction at all (use raw counts)</option>
+            <option value="--no-length-correction">No Length Correction at all (use raw counts)</option>
         </param>
 
         <param name="global_model" type="hidden_data" label="Global model (for use in Trackster)" optional="True"/>
@@ -144,35 +147,33 @@
         <!-- advanced settings -->
         <conditional name="advanced_settings">
             <param name="use_advanced_settings" type="select" label="Set advanced Cufflinks options" help="">
-            <option value="No" selected="true">No</option>
-            <option value="Yes" >Yes</option>
+                <option value="No" selected="true">No</option>
+                <option value="Yes" >Yes</option>
             </param>
-            <when value="No"></when>
+            <when value="No" />
             <when value="Yes">
-
-            <param type="select" name="library_type" label="Library prep used for input reads" help="">
-                <option value="auto" selected="True">Auto Detect</option>
-                <option value="ff-firststrand">ff-firststrand</option>
-                <option value="ff-secondstrand">ff-secondstrand</option>
-                <option value="ff-unstranded">ff-unstranded</option>
-                <option value="fr-firststrand">fr-firststrand</option>
-                <option value="fr-secondstrand">fr-secondstrand</option>
-                <option value="fr-unstranded" >fr-unstranded</option>
-                <option value="transfrags">transfrags</option>
-            </param>
-
-            <param name="mask_file" type="data" format="gff3,gtf" label="Mask File" help="Ignore all alignment within transcripts in this file " optional="True" />
-            <param name="inner_mean_dist" type="integer" value="45" label="Inner mean distance" help="This is the expected (mean) inner distance between mate pairs. For, example, for paired end runs with fragments selected at 300bp,where each end is 50bp, you should set it as 200. The default is 45bp." />
-            <param name="inner_dist_std_dev" type="integer" value="20" label="Inner distance standard deviation" help="The standard deviation for the distribution on inner distances between mate pairs. The default is 20bp." />
-            <param name="max_mle_iterations" type="integer" value="5000" label="Max MLE iterations" help="Sets the number of iterations allowed during maximum likelihood estimation of abundances. Default: 5000" />
-            <param name="junc_alpha" type="float" value="0.001" min="0" max="1" label="Alpha value for the binomial test used during false positive spliced alignment filtration" help="Default: 0.001" />
-            <param name="small_anchor_fraction" type="float" value="0.09" min="0" max="1" label="percent read overhang taken as suspiciously small" help="Spliced reads with less than this percent of their length on each side of the junction are considered suspicious and are candidates for filtering prior to assembly. Default: 0.09." />    
-            <param name="overhang_tolerance" type="integer" value="8" label="Intronic overhang tolerance" help="The number of bp allowed to enter the intron of a transcript when determining if a read or another transcript is mappable to/compatible with it. The default is 8 bp based on the default bowtie/TopHat parameters." />
-            <param name="max_bundle_length" type="integer" value="3500000" label="Maximum genomic length of a given bundle" help="Default: 3,500,000bp" />
-            <param name="max_bundle_frags" type="integer" value="1000000" label="Maximum number of fragments per locus" help="Sets the maximum number of fragments a locus may have before being skipped. Skipped loci are listed in skipped.gtf. Default: 1,000,000" />
-            <param name="min_intron_length" type="integer" value="50" label="Minimal allowed intron size" help="Default: 50bp" />
-            <param name="trim_three_avgcov_thresh" type="integer" value="10" label="Minimum average coverage required to attempt 3prime trimming." help="Default: 10" />
-            <param name="trim_three_dropoff_frac" type="float" value="0.1" min="0" max="1" label="The fraction of average coverage below which to trim the 3prime end of an assembled transcript." help="Default: 0.1"/>
+                <param type="select" name="library_type" label="Library prep used for input reads" help="">
+                    <option value="auto" selected="True">Auto Detect</option>
+                    <option value="ff-firststrand">ff-firststrand</option>
+                    <option value="ff-secondstrand">ff-secondstrand</option>
+                    <option value="ff-unstranded">ff-unstranded</option>
+                    <option value="fr-firststrand">fr-firststrand</option>
+                    <option value="fr-secondstrand">fr-secondstrand</option>
+                    <option value="fr-unstranded" >fr-unstranded</option>
+                    <option value="transfrags">transfrags</option>
+                </param>
+                <param name="mask_file" type="data" format="gff3,gtf" label="Mask File" help="Ignore all alignment within transcripts in this file " optional="True" />
+                <param name="inner_mean_dist" type="integer" value="45" label="Inner mean distance" help="This is the expected (mean) inner distance between mate pairs. For, example, for paired end runs with fragments selected at 300bp,where each end is 50bp, you should set it as 200. The default is 45bp." />
+                <param name="inner_dist_std_dev" type="integer" value="20" label="Inner distance standard deviation" help="The standard deviation for the distribution on inner distances between mate pairs. The default is 20bp." />
+                <param name="max_mle_iterations" type="integer" value="5000" label="Max MLE iterations" help="Sets the number of iterations allowed during maximum likelihood estimation of abundances. Default: 5000" />
+                <param name="junc_alpha" type="float" value="0.001" min="0" max="1" label="Alpha value for the binomial test used during false positive spliced alignment filtration" help="Default: 0.001" />
+                <param name="small_anchor_fraction" type="float" value="0.09" min="0" max="1" label="percent read overhang taken as suspiciously small" help="Spliced reads with less than this percent of their length on each side of the junction are considered suspicious and are candidates for filtering prior to assembly. Default: 0.09." />
+                <param name="overhang_tolerance" type="integer" value="8" label="Intronic overhang tolerance" help="The number of bp allowed to enter the intron of a transcript when determining if a read or another transcript is mappable to/compatible with it. The default is 8 bp based on the default bowtie/TopHat parameters." />
+                <param name="max_bundle_length" type="integer" value="3500000" label="Maximum genomic length of a given bundle" help="Default: 3,500,000bp" />
+                <param name="max_bundle_frags" type="integer" value="1000000" label="Maximum number of fragments per locus" help="Sets the maximum number of fragments a locus may have before being skipped. Skipped loci are listed in skipped.gtf. Default: 1,000,000" />
+                <param name="min_intron_length" type="integer" value="50" label="Minimal allowed intron size" help="Default: 50bp" />
+                <param name="trim_three_avgcov_thresh" type="integer" value="10" label="Minimum average coverage required to attempt 3prime trimming." help="Default: 10" />
+                <param name="trim_three_dropoff_frac" type="float" value="0.1" min="0" max="1" label="The fraction of average coverage below which to trim the 3prime end of an assembled transcript." help="Default: 0.1"/>
             </when>
         </conditional>
     </inputs>
@@ -181,11 +182,11 @@
         <data format="tabular" name="transcripts_expression" label="${tool.name} on ${on_string}: transcript expression" from_work_dir="isoforms.fpkm_tracking"/>
         <data format="gtf" name="assembled_isoforms" label="${tool.name} on ${on_string}: assembled transcripts"/>
         <data format="txt" name="total_map_mass" label="${tool.name} on ${on_string}: total map mass" hidden="true" from_work_dir="global_model.txt"/>
-        <data format="gtf" name="skipped" label="${tool.name} on ${on_string}: Skipped Transcripts" from_working_dir="skipped.gtf"/>
+        <data format="gtf" name="skipped" label="${tool.name} on ${on_string}: Skipped Transcripts" from_work_dir="skipped.gtf"/>
     </outputs>
 
     <trackster_conf>
-        <action type="set_param" name="global_model" output_name="total_map_mass"/>
+        <action name="global_model" output_name="total_map_mass"/>
     </trackster_conf>
     <tests>
         <!--
@@ -201,11 +202,11 @@
             <param name="multiread_correct" value="No"/>
             <param name="length_correction" value=""/>
             <param name="use_advanced_settings" value="No" />
-            <output name="genes_expression" format="tabular" lines_diff="2" file="cufflinks_out3.fpkm_tracking"/>
-            <output name="transcripts_expression" format="tabular" lines_diff="2" file="cufflinks_out2.fpkm_tracking"/>
+            <output name="genes_expression" ftype="tabular" lines_diff="2" file="cufflinks_out3.fpkm_tracking"/>
+            <output name="transcripts_expression" ftype="tabular" lines_diff="2" file="cufflinks_out2.fpkm_tracking"/>
             <output name="assembled_isoforms" file="cufflinks_out1.gtf"/>
             <output name="global_model" file="cufflinks_out4.txt"/>
-        <output name="skipped" file="cufflinks_out4.gtf"/> 
+            <output name="skipped" file="cufflinks_out4.gtf"/>
         </test>
     </tests>
 
@@ -234,7 +235,7 @@
 
   s6.25mer.txt-913508    16    chr1 4482736 255 14M431N11M * 0 0 \
      CAAGATGCTAGGCAAGTCTTGGAAG IIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 XS:A:-
-    
+
 Note the use of the custom tag XS. This attribute, which must have a value of "+" or "-", indicates which strand the RNA that produced this read came from. While this tag can be applied to any alignment, including unspliced ones, it must be present for all spliced alignment records (those with a 'N' operation in the CIGAR string).
 The SAM file supplied to Cufflinks must be sorted by reference position. If you aligned your reads with TopHat, your alignments will be properly sorted already. If you used another tool, you may want to make sure they are properly sorted as follows::
 
@@ -263,7 +264,7 @@
   7               strand        +           Cufflinks' guess for which strand the isoform came from. Always one of '+', '-' '.'
   7               frame         .           Cufflinks does not predict where the start and stop codons (if any) are located within each transcript, so this field is not used.
   8               attributes    See below
-  
+
 Each GTF record is decorated with the following attributes::
 
   Attribute       Example       Description
@@ -275,14 +276,13 @@
   conf_lo         0.07          Lower bound of the 95% confidence interval of the abundance of this isoform, as a fraction of the isoform abundance. That is, lower bound = FPKM * (1.0 - conf_lo)
   conf_hi         0.1102        Upper bound of the 95% confidence interval of the abundance of this isoform, as a fraction of the isoform abundance. That is, upper bound = FPKM * (1.0 + conf_lo)
   cov             100.765       Estimate for the absolute depth of read coverage across the whole transcript
-  
 
 Transcripts only:
   This file is simply a tab delimited file containing one row per transcript and with columns containing the attributes above. There are a few additional attributes not in the table above, but these are reserved for debugging, and may change or disappear in the future.
-    
+
 Genes only:
 This file contains gene-level coordinates and expression values.
-    
+
 -------
 
 **Cufflinks settings**
@@ -300,7 +300,7 @@
   -I INT    The minimum intron length. Cufflinks will not report transcripts with introns longer than this, and will ignore SAM alignments with REF_SKIP CIGAR operations longer than this. The default is 300,000.
   -F         After calculating isoform abundance for a gene, Cufflinks filters out transcripts that it believes are very low abundance, because isoforms expressed at extremely low levels often cannot reliably be assembled, and may even be artifacts of incompletely spliced precursors of processed transcripts. This parameter is also used to filter out introns that have far fewer spliced alignments supporting them. The default is 0.05, or 5% of the most abundant isoform (the major isoform) of the gene.
   -j        Some RNA-Seq protocols produce a significant amount of reads that originate from incompletely spliced transcripts, and these reads can confound the assembly of fully spliced mRNAs. Cufflinks uses this parameter to filter out alignments that lie within the intronic intervals implied by the spliced alignments. The minimum depth of coverage in the intronic region covered by the alignment is divided by the number of spliced reads, and if the result is lower than this parameter value, the intronic alignments are ignored. The default is 5%.
-  -G        Tells Cufflinks to use the supplied reference annotation to estimate isoform expression. It will not assemble novel transcripts, and the program will ignore alignments not structurally compatible with any reference transcript.  
+  -G        Tells Cufflinks to use the supplied reference annotation to estimate isoform expression. It will not assemble novel transcripts, and the program will ignore alignments not structurally compatible with any reference transcript.
   -N        With this option, Cufflinks excludes the contribution of the top 25 percent most highly expressed genes from the number of mapped fragments used in the FPKM denominator. This can improve robustness of differential expression calls for less abundant genes and transcripts.
     </help>
     <citations>
--- a/tool_dependencies.xml	Tue Oct 13 12:37:52 2015 -0400
+++ b/tool_dependencies.xml	Tue Feb 07 18:38:16 2017 -0500
@@ -1,6 +1,6 @@
 <?xml version="1.0"?>
 <tool_dependency>
     <package name="cufflinks" version="2.2.1">
-        <repository changeset_revision="8f755957b6a1" name="package_cufflinks_2_2_1" owner="devteam" toolshed="https://testtoolshed.g2.bx.psu.edu" />
+        <repository changeset_revision="87f239da61af" name="package_cufflinks_2_2_1" owner="devteam" toolshed="https://testtoolshed.g2.bx.psu.edu" />
     </package>
 </tool_dependency>