Mercurial > repos > devteam > bowtie2
comparison bowtie2_wrapper.xml @ 17:69f044db2445 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/bowtie2 commit 0f9578a65e86cc159aadf1a9b37aaf3621f19456
| author | iuc |
|---|---|
| date | Tue, 14 Nov 2017 15:02:02 -0500 |
| parents | def46fdb3909 |
| children | e0ca9500999b |
comparison
equal
deleted
inserted
replaced
| 16:def46fdb3909 | 17:69f044db2445 |
|---|---|
| 666 | 666 |
| 667 </outputs> | 667 </outputs> |
| 668 | 668 |
| 669 <tests> | 669 <tests> |
| 670 <test> | 670 <test> |
| 671 <!-- basic test on single paired default run --> | 671 <!-- test on paired-end datasets --> |
| 672 <param name="type" value="paired"/> | 672 <param name="type" value="paired"/> |
| 673 <param name="paired_options_selector" value="no"/> | 673 <param name="paired_options_selector" value="no"/> |
| 674 <param name="unaligned_file" value="false"/> | 674 <param name="unaligned_file" value="false"/> |
| 675 <param name="analysis_type_selector" value="simple"/> | 675 <param name="analysis_type_selector" value="simple"/> |
| 676 <param name="source" value="history" /> | 676 <param name="source" value="history" /> |
| 678 <param name="input_2" value="bowtie2-fq2.fq" ftype="fastqsanger"/> | 678 <param name="input_2" value="bowtie2-fq2.fq" ftype="fastqsanger"/> |
| 679 <param name="own_file" value="bowtie2-ref.fasta" /> | 679 <param name="own_file" value="bowtie2-ref.fasta" /> |
| 680 <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/> | 680 <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/> |
| 681 </test> | 681 </test> |
| 682 <test> | 682 <test> |
| 683 <!-- basic test on single paired default run --> | 683 <!-- test on paired collection --> |
| 684 <param name="type" value="paired_collection"/> | |
| 685 <param name="paired_options_selector" value="no"/> | |
| 686 <param name="unaligned_file" value="false"/> | |
| 687 <param name="analysis_type_selector" value="simple"/> | |
| 688 <param name="source" value="history" /> | |
| 689 <param name="input_1"> | |
| 690 <collection type="paired"> | |
| 691 <element name="forward" value="bowtie2-fq1.fq" ftype="fastqsanger" /> | |
| 692 <element name="reverse" value="bowtie2-fq2.fq" ftype="fastqsanger" /> | |
| 693 </collection> | |
| 694 </param> | |
| 695 <param name="own_file" value="bowtie2-ref.fasta" /> | |
| 696 <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/> | |
| 697 </test> | |
| 698 <test> | |
| 699 <!-- test on paired-end datasets with read group info --> | |
| 684 <param name="type" value="paired"/> | 700 <param name="type" value="paired"/> |
| 685 <param name="paired_options_selector" value="no"/> | 701 <param name="paired_options_selector" value="no"/> |
| 686 <param name="unaligned_file" value="false"/> | 702 <param name="unaligned_file" value="false"/> |
| 687 <param name="analysis_type_selector" value="simple"/> | 703 <param name="analysis_type_selector" value="simple"/> |
| 688 <param name="rg_selector" value="set"/> | 704 <param name="rg_selector" value="set"/> |
| 693 <param name="input_2" value="bowtie2-fq2.fq" ftype="fastqsanger"/> | 709 <param name="input_2" value="bowtie2-fq2.fq" ftype="fastqsanger"/> |
| 694 <param name="own_file" value="bowtie2-ref.fasta" /> | 710 <param name="own_file" value="bowtie2-ref.fasta" /> |
| 695 <output name="output" file="bowtie2-test2.bam" ftype="bam" lines_diff="2"/> | 711 <output name="output" file="bowtie2-test2.bam" ftype="bam" lines_diff="2"/> |
| 696 </test> | 712 </test> |
| 697 <test> | 713 <test> |
| 698 <!-- basic test on single paired default run with stats--> | 714 <!-- test on paired-end datasets with stats output --> |
| 699 <param name="type" value="paired"/> | 715 <param name="type" value="paired"/> |
| 700 <param name="paired_options_selector" value="no"/> | 716 <param name="paired_options_selector" value="no"/> |
| 701 <param name="unaligned_file" value="false"/> | 717 <param name="unaligned_file" value="false"/> |
| 702 <param name="analysis_type_selector" value="simple"/> | 718 <param name="analysis_type_selector" value="simple"/> |
| 703 <param name="source" value="history" /> | 719 <param name="source" value="history" /> |
| 711 <has_text text="of these" /> | 727 <has_text text="of these" /> |
| 712 </assert_contents> | 728 </assert_contents> |
| 713 </output> | 729 </output> |
| 714 </test> | 730 </test> |
| 715 <test> | 731 <test> |
| 716 <!-- basic test on interleaved paired default run --> | 732 <!-- test on interleaved dataset --> |
| 717 <param name="type" value="paired_interleaved"/> | 733 <param name="type" value="paired_interleaved"/> |
| 718 <!-- <param name="paired_options_selector" value="no"/> --> | 734 <!-- <param name="paired_options_selector" value="no"/> --> |
| 719 <param name="unaligned_file" value="false"/> | 735 <param name="unaligned_file" value="false"/> |
| 720 <param name="analysis_type_selector" value="simple"/> | 736 <param name="analysis_type_selector" value="simple"/> |
| 721 <param name="rg_selector" value="set"/> | 737 <param name="rg_selector" value="set"/> |
| 725 <param name="input_1" value="bowtie2-fq_il.fq" ftype="fastqsanger"/> | 741 <param name="input_1" value="bowtie2-fq_il.fq" ftype="fastqsanger"/> |
| 726 <param name="own_file" value="bowtie2-ref.fasta" /> | 742 <param name="own_file" value="bowtie2-ref.fasta" /> |
| 727 <output name="output" file="bowtie2-test_il.bam" ftype="bam" lines_diff="2"/> | 743 <output name="output" file="bowtie2-test_il.bam" ftype="bam" lines_diff="2"/> |
| 728 </test> | 744 </test> |
| 729 <test> | 745 <test> |
| 730 <!-- test fastqsanger.gz input --> | 746 <!-- test on fastqsanger.gz paired-end datasets --> |
| 731 <param name="type" value="paired"/> | 747 <param name="type" value="paired"/> |
| 732 <param name="paired_options_selector" value="no"/> | 748 <param name="paired_options_selector" value="no"/> |
| 733 <param name="unaligned_file" value="false"/> | 749 <param name="unaligned_file" value="false"/> |
| 734 <param name="analysis_type_selector" value="simple"/> | 750 <param name="analysis_type_selector" value="simple"/> |
| 735 <param name="source" value="history" /> | 751 <param name="source" value="history" /> |
| 737 <param name="input_2" value="bowtie2-fq2.fq.gz" ftype="fastqsanger.gz"/> | 753 <param name="input_2" value="bowtie2-fq2.fq.gz" ftype="fastqsanger.gz"/> |
| 738 <param name="own_file" value="bowtie2-ref.fasta" /> | 754 <param name="own_file" value="bowtie2-ref.fasta" /> |
| 739 <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/> | 755 <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/> |
| 740 </test> | 756 </test> |
| 741 <test> | 757 <test> |
| 742 <!-- test fastqsanger.bz2 input --> | 758 <!-- test on fastqsanger.bz2 paired-end datasets --> |
| 743 <param name="type" value="paired"/> | 759 <param name="type" value="paired"/> |
| 744 <param name="paired_options_selector" value="no"/> | 760 <param name="paired_options_selector" value="no"/> |
| 745 <param name="unaligned_file" value="false"/> | 761 <param name="unaligned_file" value="false"/> |
| 746 <param name="analysis_type_selector" value="simple"/> | 762 <param name="analysis_type_selector" value="simple"/> |
| 747 <param name="source" value="history" /> | 763 <param name="source" value="history" /> |
| 749 <param name="input_2" value="bowtie2-fq2.fq.bz2" ftype="fastqsanger.bz2"/> | 765 <param name="input_2" value="bowtie2-fq2.fq.bz2" ftype="fastqsanger.bz2"/> |
| 750 <param name="own_file" value="bowtie2-ref.fasta" /> | 766 <param name="own_file" value="bowtie2-ref.fasta" /> |
| 751 <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/> | 767 <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/> |
| 752 </test> | 768 </test> |
| 753 <test> | 769 <test> |
| 754 <!-- test fasta input --> | 770 <!-- test on fasta paired-end datasets --> |
| 755 <param name="type" value="paired"/> | 771 <param name="type" value="paired"/> |
| 756 <param name="paired_options_selector" value="no"/> | 772 <param name="paired_options_selector" value="no"/> |
| 757 <param name="unaligned_file" value="false"/> | 773 <param name="unaligned_file" value="false"/> |
| 758 <param name="analysis_type_selector" value="simple"/> | 774 <param name="analysis_type_selector" value="simple"/> |
| 759 <param name="source" value="history" /> | 775 <param name="source" value="history" /> |
| 763 <output name="output" file="bowtie2-test_fasta_in.bam" ftype="bam" lines_diff="2"/> | 779 <output name="output" file="bowtie2-test_fasta_in.bam" ftype="bam" lines_diff="2"/> |
| 764 </test> | 780 </test> |
| 765 </tests> | 781 </tests> |
| 766 | 782 |
| 767 <help><![CDATA[ | 783 <help><![CDATA[ |
| 768 | |
| 769 **Bowtie2 Overview** | 784 **Bowtie2 Overview** |
| 770 | 785 |
| 771 Bowtie2_ is an ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences. It is particularly good at aligning reads of about 50 up to 100s or 1,000s of characters to relatively long (e.g. mammalian) genomes. Bowtie 2 supports gapped, local, and paired-end alignment modes. Galaxy wrapper for Bowtie 2 outputs alignments in `BAM format`_, enabling interoperation with a large number of other tools available at this site. | 786 Bowtie2_ is an ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences. It is particularly good at aligning reads of about 50 up to 100s or 1,000s of characters to relatively long (e.g. mammalian) genomes. Bowtie 2 supports gapped, local, and paired-end alignment modes. Galaxy wrapper for Bowtie 2 outputs alignments in `BAM format`_, enabling interoperation with a large number of other tools available at this site. |
| 772 Majority of information in this page is derived from an excellent `Bowtie2 manual`_ written by Ben Langmead. | 787 Majority of information in this page is derived from an excellent `Bowtie2 manual`_ written by Ben Langmead. |
| 773 | 788 |
| 1232 HHHHHHEGFHEEFEEHEEHHGGEGGGGEFGFGGGGHHHHFBEEEEEFG | 1247 HHHHHHEGFHEEFEEHEEHHGGEGGGGEFGFGGGGHHHHFBEEEEEFG |
| 1233 @2/2 | 1248 @2/2 |
| 1234 CCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC | 1249 CCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC |
| 1235 + | 1250 + |
| 1236 HHHHHHHHHHHHHGHHHHHHGHHHHHHHHHHHFHHHFHHHHHHHHHHH | 1251 HHHHHHHHHHHHHGHHHHHHGHHHHHHHHHHHFHHHFHHHHHHHHHHH |
| 1237 | |
| 1238 | |
| 1239 | |
| 1240 | |
| 1241 ]]></help> | 1252 ]]></help> |
| 1242 <citations> | 1253 <citations> |
| 1243 <citation type="doi">10.1186/gb-2009-10-3-r25</citation> | 1254 <citation type="doi">10.1186/gb-2009-10-3-r25</citation> |
| 1244 <citation type="doi">10.1038/nmeth.1923</citation> | 1255 <citation type="doi">10.1038/nmeth.1923</citation> |
| 1245 </citations> | 1256 </citations> |
| 1246 </tool> | 1257 </tool> |