Mercurial > repos > davidvanzessen > mutation_analysis
diff gene_identification.py @ 0:74d2bc479bee draft
Uploaded
| author | davidvanzessen |
|---|---|
| date | Mon, 18 Aug 2014 04:04:37 -0400 |
| parents | |
| children | 2f4298673519 |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/gene_identification.py Mon Aug 18 04:04:37 2014 -0400 @@ -0,0 +1,265 @@ +import re +import argparse + + +parser = argparse.ArgumentParser() +parser.add_argument("--input", help="The 1_Summary file from an IMGT zip file") +parser.add_argument("--outdir", help="Output directory, 7 output files will be written here") + +args = parser.parse_args() + +infile = args.input +#infile = "test_VH-Ca_Cg_25nt/1_Summary_test_VH-Ca_Cg_25nt_241013.txt" +outdir = args.outdir +#outfile = "identified.txt" + +dic = dict() +total = 0 + +first = True +with open(infile, 'r') as f: #read all sequences into a dictionary as key = ID, value = sequence + for line in f: + total += 1 + if first: + first = False + continue + linesplt = line.split("\t") + if linesplt[2] == "No results": + continue + ID = linesplt[1] + seq = linesplt[28] + dic[ID] = seq + +#lambda/kappa reference sequence +searchstrings = {"ca": "catccccgaccagccccaaggtcttcccgctgagcctctgcagcacccagccagatgggaacgtggtcatcgcctgcctggtccagggcttcttcccccaggagccactcagtgtgacctggagcgaaag", + "cg": "ctccaccaagggcccatcggtcttccccctggcaccctcctccaagagcacctctgggggcacagcggccctgggctgcctggtcaaggactacttccccgaaccggtgacggtgtcgtggaactcaggcgccctgaccagcggcgtgcacaccttcc", + "cm": "gggagtgcatccgccccaacccttttccccctcgtctcctgtgagaattccc"} + +compiledregex = {"ca": [], + "cg": [], + "cm": []} + +#lambda/kappa reference sequence variable nucleotides +ca1 = {38: 't', 39: 'g', 48: 'a', 49: 'g', 51: 'c', 68: 'a', 73: 'c'} +ca2 = {38: 'g', 39: 'a', 48: 'c', 49: 'c', 51: 'a', 68: 'g', 73: 'a'} +cg1 = {0: 'c', 33: 'a', 38: 'c', 44: 'a', 54: 't', 56: 'g', 58: 'g', 66: 'g', 132: 'c'} +cg2 = {0: 'c', 33: 'g', 38: 'g', 44: 'g', 54: 'c', 56: 'a', 58: 'a', 66: 'g', 132: 't'} +cg3 = {0: 't', 33: 'g', 38: 'g', 44: 'g', 54: 't', 56: 'g', 58: 'g', 66: 'g', 132: 'c'} +cg4 = {0: 't', 33: 'g', 38: 'g', 44: 'g', 54: 'c', 56: 'a', 58: 'a', 66: 'c', 132: 'c'} + +#reference sequences are cut into smaller parts of 'chunklength' length, and with 'chunklength' / 2 overlap +chunklength = 8 + +#create the chunks of the reference sequence with regular expressions for the variable nucleotides +for i in range(0, len(searchstrings["ca"]) - chunklength, chunklength / 2): + pos = i + chunk = searchstrings["ca"][i:i+chunklength] + result = "" + varsInResult = 0 + for c in chunk: + if pos in ca1.keys(): + varsInResult += 1 + result += "[" + ca1[pos] + ca2[pos] + "]" + else: + result += c + pos += 1 + compiledregex["ca"].append((re.compile(result), varsInResult)) + +for i in range(0, len(searchstrings["cg"]) - chunklength, chunklength / 2): + pos = i + chunk = searchstrings["cg"][i:i+chunklength] + result = "" + varsInResult = 0 + for c in chunk: + if pos in cg1.keys(): + varsInResult += 1 + result += "[" + "".join(set([cg1[pos], cg2[pos], cg3[pos], cg4[pos]])) + "]" + else: + result += c + pos += 1 + compiledregex["cg"].append((re.compile(result), varsInResult)) + +for i in range(0, len(searchstrings["cm"]) - chunklength, chunklength / 2): + compiledregex["cm"].append((re.compile(searchstrings["cm"][i:i+chunklength]), False)) + + + +def removeAndReturnMaxIndex(x): #simplifies a list comprehension + m = max(x) + index = x.index(m) + x[index] = 0 + return index + + +start_location = dict() +hits = dict() +alltotal = 0 +for key in compiledregex.keys(): #for ca/cg/cm + regularexpressions = compiledregex[key] #get the compiled regular expressions + for ID in dic.keys()[0:]: #for every ID + if ID not in hits.keys(): #ensure that the dictionairy that keeps track of the hits for every gene exists + hits[ID] = {"ca_hits": 0, "cg_hits": 0, "cm_hits": 0, "ca1": 0, "ca2": 0, "cg1": 0, "cg2": 0, "cg3": 0, "cg4": 0} + currentIDHits = hits[ID] + seq = dic[ID] + lastindex = 0 + start = [0] * len(seq) + for i, regexp in enumerate(regularexpressions): #for every regular expression + regex, hasVar = regexp + matches = regex.finditer(seq[lastindex:]) + for match in matches: #for every match with the current regex, only uses the first hit + lastindex += match.start() + start[lastindex - chunklength / 2 * i] += 1 + if hasVar: #if the regex has a variable nt in it + chunkstart = chunklength / 2 * i #where in the reference does this chunk start + chunkend = chunklength / 2 * i + chunklength #where in the reference does this chunk end + if key == "ca": #just calculate the variable nt score for 'ca', cheaper + currentIDHits["ca1"] += len([1 for x in ca1 if chunkstart <= x < chunkend and ca1[x] == seq[lastindex + x - chunkstart]]) + currentIDHits["ca2"] += len([1 for x in ca2 if chunkstart <= x < chunkend and ca2[x] == seq[lastindex + x - chunkstart]]) + elif key == "cg": #just calculate the variable nt score for 'cg', cheaper + currentIDHits["cg1"] += len([1 for x in cg1 if chunkstart <= x < chunkend and cg1[x] == seq[lastindex + x - chunkstart]]) + currentIDHits["cg2"] += len([1 for x in cg2 if chunkstart <= x < chunkend and cg2[x] == seq[lastindex + x - chunkstart]]) + currentIDHits["cg3"] += len([1 for x in cg3 if chunkstart <= x < chunkend and cg3[x] == seq[lastindex + x - chunkstart]]) + currentIDHits["cg4"] += len([1 for x in cg4 if chunkstart <= x < chunkend and cg4[x] == seq[lastindex + x - chunkstart]]) + else: #key == "cm" #no variable regions in 'cm' + pass + break #this only breaks when there was a match with the regex, breaking means the 'else:' clause is skipped + else: #only runs if there were no hits + continue + #print "found ", regex.pattern , "at", lastindex, "adding one to", (lastindex - chunklength / 2 * i), "to the start array of", ID, "gene", key, "it's now:", start[lastindex - chunklength / 2 * i] + currentIDHits[key + "_hits"] += 1 + start_location[ID + "_" + key] = str([(removeAndReturnMaxIndex(start) + 1) for x in range(5) if max(start) > 1]) + #start_location[ID + "_" + key] = str(start.index(max(start))) + + +chunksInCA = len(compiledregex["ca"]) +chunksInCG = len(compiledregex["cg"]) +chunksInCM = len(compiledregex["cm"]) +requiredChunkPercentage = 0.7 +varsInCA = float(len(ca1.keys()) * 2) +varsInCG = float(len(cg1.keys()) * 2) + 1 +varsInCM = 0 +requiredVarPercentage = 0.7 + +ca = 0 +ca1 = 0 +ca2 = 0 +cg = 0 +cg1 = 0 +cg2 = 0 +cg3 = 0 +cg4 = 0 +cm = 0 +try: + cafile = open(outdir + "/ca.txt", 'w') + ca1file = open(outdir + "/ca1.txt", 'w') + ca2file = open(outdir + "/ca2.txt", 'w') + cgfile = open(outdir + "/cg.txt", 'w') + cg1file = open(outdir + "/cg1.txt", 'w') + cg2file = open(outdir + "/cg2.txt", 'w') + cg3file = open(outdir + "/cg3.txt", 'w') + cg4file = open(outdir + "/cg4.txt", 'w') + cmfile = open(outdir + "/cm.txt", 'w') + unmatchedfile = open(outdir + "/unmatched.txt", 'w') + cafile.write("ID\tnt_hit_percentage\tchunk_hit_percentage\tstart_locations\n") + ca1file.write("ID\tnt_hit_percentage\tchunk_hit_percentage\tstart_locations\n") + ca2file.write("ID\tnt_hit_percentage\tchunk_hit_percentage\tstart_locations\n") + cgfile.write("ID\tnt_hit_percentage\tchunk_hit_percentage\tstart_locations\n") + cg1file.write("ID\tnt_hit_percentage\tchunk_hit_percentage\tstart_locations\n") + cg2file.write("ID\tnt_hit_percentage\tchunk_hit_percentage\tstart_locations\n") + cg3file.write("ID\tnt_hit_percentage\tchunk_hit_percentage\tstart_locations\n") + cg4file.write("ID\tnt_hit_percentage\tchunk_hit_percentage\tstart_locations\n") + cmfile.write("ID\tnt_hit_percentage\tchunk_hit_percentage\tstart_locations\n") + unmatchedfile.write("ID\tnt_hit_percentage\tchunk_hit_percentage\tstart_locations\tbest_match\n") + for ID in hits.keys(): + currentIDHits = hits[ID] + possibleca = float(len(compiledregex["ca"])) + possiblecg = float(len(compiledregex["cg"])) + possiblecm = float(len(compiledregex["cm"])) + cahits = currentIDHits["ca_hits"] + cghits = currentIDHits["cg_hits"] + cmhits = currentIDHits["cm_hits"] + if cahits > cghits and cahits > cmhits: #its a ca gene + if cahits <= int(chunksInCA * requiredChunkPercentage): + unmatchedfile.write(ID + "\tNA\t" + str(int(cahits / possibleca * 100)) + "\t" + start_location[ID + "_ca"] + "\tca\n") + continue + ca += 1 + ca1hits = currentIDHits["ca1"] + ca2hits = currentIDHits["ca2"] + cafile.write(ID + "\tNA\t" + str(int(cahits / possibleca * 100)) + "\t" + start_location[ID + "_ca"] + "\n") + if ca1hits > ca2hits: + #print ID, "is ca1 with", (ca1hits / 2), "hits for ca1 and", (ca2hits / 2), "hits for ca2", (int((ca1hits / varsInCA) * 100)), "percent hit" + if ca1hits <= int(varsInCA * requiredVarPercentage): + unmatchedfile.write(ID + "\t" + str(int(ca1hits / varsInCA * 100)) + "\t" + str(int(cahits / possibleca * 100)) + "\t" + start_location[ID + "_ca"] + "\tca1\n") + continue + ca1 += 1 + ca1file.write(ID + "\t" + str(int(ca1hits / varsInCA * 100)) + "\t" + str(int(cahits / possibleca * 100)) + "\t" + start_location[ID + "_ca"] + "\n") + else: + #print ID, "is ca2 with", (ca1hits / 2), "hits for ca1 and", (ca2hits / 2), "hits for ca2", (int((ca2hits / varsInCA) * 100)), "percent hit" + if ca2hits <= int(varsInCA * requiredVarPercentage): + unmatchedfile.write(ID + "\t" + str(int(ca2hits / varsInCA * 100)) + "\t" + str(int(cahits / possibleca * 100)) + "\t" + start_location[ID + "_ca"] + "\tca1\n") + continue + ca2 += 1 + ca2file.write(ID + "\t" + str(int(ca2hits / varsInCA * 100)) + "\t" + str(int(cahits / possibleca * 100)) + "\t" + start_location[ID + "_ca"] + "\n") + elif cghits > cahits and cghits > cmhits: #its a cg gene + if cghits <= int(chunksInCG * requiredChunkPercentage): + unmatchedfile.write(ID + "\tNA\t" + str(int(cghits / possiblecg * 100)) + "\t" + start_location[ID + "_ca"] + "\tcg\n") + continue + cg += 1 + cg1hits = currentIDHits["cg1"] + cg2hits = currentIDHits["cg2"] + cg3hits = currentIDHits["cg3"] + cg4hits = currentIDHits["cg4"] + cgfile.write(ID + "\tNA\t" + str(int(cghits / possibleca * 100)) + "\t" + start_location[ID + "_cg"] + "\n") + if cg1hits > cg2hits and cg1hits > cg3hits and cg1hits > cg4hits: #cg1 gene + if cg1hits <= int(varsInCG * requiredVarPercentage): + unmatchedfile.write(ID + "\t" + str(int(cg1hits / varsInCG * 100)) + "\t" + str(int(cghits / possiblecg * 100)) + "\t" + start_location[ID + "_cg"] + "\tcg1\n") + continue + cg1 += 1 + cg1file.write(ID + "\t" + str(int(cg1hits / varsInCG * 100)) + "\t" + str(int(cghits / possiblecg * 100)) + "\t" + start_location[ID + "_cg"] + "\n") + elif cg2hits > cg1hits and cg2hits > cg3hits and cg2hits > cg4hits: #cg2 gene + if cg2hits <= int(varsInCG * requiredVarPercentage): + unmatchedfile.write(ID + "\t" + str(int(cg2hits / varsInCG * 100)) + "\t" + str(int(cghits / possiblecg * 100)) + "\t" + start_location[ID + "_cg"] + "\tcg2\n") + continue + cg2 += 1 + cg2file.write(ID + "\t" + str(int(cg2hits / varsInCG * 100)) + "\t" + str(int(cghits / possiblecg * 100)) + "\t" + start_location[ID + "_cg"] + "\n") + elif cg3hits > cg1hits and cg3hits > cg2hits and cg3hits > cg4hits: #cg3 gene + if cg3hits <= int(varsInCG * requiredVarPercentage): + unmatchedfile.write(ID + "\t" + str(int(cg3hits / varsInCG * 100)) + "\t" + str(int(cghits / possiblecg * 100)) + "\t" + start_location[ID + "_cg"] + "\tcg3\n") + continue + cg3 += 1 + cg3file.write(ID + "\t" + str(int(cg3hits / varsInCG * 100)) + "\t" + str(int(cghits / possiblecg * 100)) + "\t" + start_location[ID + "_cg"] + "\n") + else: #cg4 gene + if cg4hits <= int(varsInCG * requiredVarPercentage): + unmatchedfile.write(ID + "\t" + str(int(cg4hits / varsInCG * 100)) + "\t" + str(int(cghits / possiblecg * 100)) + "\t" + start_location[ID + "_cg"] + "\tcg4\n") + continue + cg4 += 1 + cg4file.write(ID + "\t" + str(int(cg4hits / varsInCG * 100)) + "\t" + str(int(cghits / possiblecg * 100)) + "\t" + start_location[ID + "_cg"] + "\n") + else: #its a cm gene + if cmhits <= int(chunksInCM * requiredChunkPercentage): + unmatchedfile.write(ID + "\tNA\t" + str(int(cghits / possiblecg * 100)) + "\t" + start_location[ID + "_ca"] + "\tcm\n") + continue + cm += 1 + cmfile.write(ID + "\tNA\t" + str(int(cmhits / possiblecm * 100)) + "\t" + start_location[ID + "_cm"] + "\n") +finally: + cafile.close() + ca1file.close() + ca2file.close() + cgfile.close() + cg1file.close() + cg2file.close() + cg3file.close() + cg4file.close() + cmfile.close() + unmatchedfile.close() + + +#print ca,cg,cm,(ca+cg+cm) + + + + + + + + +
