diff do-partition.xml @ 60:fe697e0cb24a draft default tip

planemo upload for repository https://github.com/galaxyproject/tools-iuc/blob/master/tools/khmer/ commit d8e0950d53e504e02ee5db43c0804142b14d7fd2-dirty

--- a/do-partition.xml	Mon Aug 18 07:02:05 2014 -0400
+++ b/do-partition.xml	Tue Jul 07 11:59:39 2015 -0400
@@ -1,8 +1,7 @@
 <tool	id="gedlab-khmer-do-partition"
 	name="Sequence partition all-in-one"
-	version="1.1-1"
-	force_history_refresh="true">
-	
+	version="2.0rc1-1">
+
 	<description>
 		Load, partition, and annotate FAST[AQ] sequences
 	</description>
@@ -10,8 +9,10 @@
                 <token name="@BINARY@">do-parition.py</token>
                 <import>macros.xml</import>
         </macros>
-        <expand macro="requirements" />
-	<command>
+	<expand macro="requirements" />
+	<expand macro="stdio" />
+	<expand macro="version" />
+	<command><![CDATA[
 mkdir -p output;
 @BINARY@
 @TABLEPARAMS@
@@ -22,6 +23,7 @@
 #end for ;
 mv output.info $infomation ;
 mv *.part output/
+]]>
 	</command>
 
 	<inputs>
@@ -48,60 +50,31 @@
 			label="${tool.name} summary for #echo ','.join(map(str, $inputs ))#" />
 		<expand macro="output_sequences" />
 	</outputs>
-	<expand macro="stdio" />
-<!--	<tests>
-		<test interactor="api">
-			<conditional name="parameters">
-				<param name="type" value="specific" />
-				<param name="inputs" value="test-abund-read-2.fa"/>
-				<param name="cutoff" value="1" />
-				<param name="ksize" value="17" />
-			</conditional>
+	<tests>
+		<test>
+                        <param name="inputs" value="random-20-a.fa"/>
 			<output name="output">
-				<discover_dataset name="test-abund-read-2.fa.keep">
-					<assert_contents>
-						<has_line_matching expression="GGTTGACGGGGCTCAGGGGG" />
-					</assert_contents>
-				</discover_dataset>
-			</output>
-		</test>
-		<test interactor="api">
-			<param name="inputs" value="test-abund-read-2.fa" />
-			<param name="cutoff" value="2" />
-			<param name="ksize" value="17" />
-			<output name="output">
-				<discover_dataset name="test-abund-read-2.fa.keep">
+				<discovered_dataset designation="random-20-a.fa.part">
 					<assert_contents>
-						<has_line_matching expression="GGTTGACGGGGCTCAGGGGG" />
-						<has_line_matching expression="GGTTGACGGGGCTCAGGG" />
+						<has_text text='>35     2' />
 					</assert_contents>
-				</discover_dataset>
-			</output>
-		</test>
-		<test interactor="api">
-			<param name="inputs" value="test-abund-read-paired.fa" />
-			<param name="cutoff" value="1" />
-			<param name="ksize" value="17" />
-			<param name="paired" value="true" />
-			<output name="output">
-				<discover_dataset name="test-abund-read-paired.fa.keep">
-					<assert_contents>
-						<has_line_matching expression="GGTTGACGGGGCTCAGGGGG" />
-						<has_line_matching expression="GGTTGACGGGGCTCAGGG" />
-					</assert_contents>
-				</discover_dataset>
-			</output>
-		</test>
+				</discovered_dataset>
+                        </output>
+                </test>
+	</tests>
+	<help><![CDATA[
+Load in a set of sequences, partition them, merge the partitions, and
+annotate the original sequences files with the partition information.
 
-	</tests>
-    -->
+This script combines the functionality of :program:`load-graph.py`,
+:program:`partition-graph.py`, :program:`merge-partitions.py`, and
+:program:`annotate-partitions.py` into one script. This is convenient
+but should probably not be used for large data sets, because
+:program:`do-partition.py` doesn't provide save/resume functionality.
+]]>
+	</help>
 	<citations>
 		<expand macro="software-citation" />
 		<expand macro="graph-citation" />
 	</citations>
-    <!-- [OPTIONAL] Help displayed in Galaxy -->
-    <!--
-	<help>
-	</help>
-    -->    
 </tool>