Mercurial > repos > crusoe > khmer

comparison do-partition.xml @ 60:fe697e0cb24a draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/blob/master/tools/khmer/ commit d8e0950d53e504e02ee5db43c0804142b14d7fd2-dirty
author crusoe
date Tue, 07 Jul 2015 11:59:39 -0400
parents 08a599cf71d0
children
comparison
equal deleted inserted replaced
59:08a599cf71d0 60:fe697e0cb24a
1 <tool id="gedlab-khmer-do-partition" 1 <tool id="gedlab-khmer-do-partition"
2 name="Sequence partition all-in-one" 2 name="Sequence partition all-in-one"
3 version="1.1-1" 3 version="2.0rc1-1">
4 force_history_refresh="true"> 4
5
6 <description> 5 <description>
7 Load, partition, and annotate FAST[AQ] sequences 6 Load, partition, and annotate FAST[AQ] sequences
8 </description> 7 </description>
9 <macros> 8 <macros>
10 <token name="@BINARY@">do-parition.py</token> 9 <token name="@BINARY@">do-parition.py</token>
11 <import>macros.xml</import> 10 <import>macros.xml</import>
12 </macros> 11 </macros>
13 <expand macro="requirements" /> 12 <expand macro="requirements" />
14 <command> 13 <expand macro="stdio" />
14 <expand macro="version" />
15 <command><![CDATA[
15 mkdir -p output; 16 mkdir -p output;
16 @BINARY@ 17 @BINARY@
17 @TABLEPARAMS@ 18 @TABLEPARAMS@
18 @THREADS@ 19 @THREADS@
19 output 20 output
20 #for input in $inputs 21 #for input in $inputs
21 $input 22 $input
22 #end for ; 23 #end for ;
23 mv output.info $infomation ; 24 mv output.info $infomation ;
24 mv *.part output/ 25 mv *.part output/
26 ]]>
25 </command> 27 </command>
26 28
27 <inputs> 29 <inputs>
28 <expand macro="input_sequences_filenames" /> 30 <expand macro="input_sequences_filenames" />
29 <param name="ksize" 31 <param name="ksize"
46 <data name="information" 48 <data name="information"
47 format="text" 49 format="text"
48 label="${tool.name} summary for #echo ','.join(map(str, $inputs ))#" /> 50 label="${tool.name} summary for #echo ','.join(map(str, $inputs ))#" />
49 <expand macro="output_sequences" /> 51 <expand macro="output_sequences" />
50 </outputs> 52 </outputs>
51 <expand macro="stdio" /> 53 <tests>
52 <!-- <tests> 54 <test>
53 <test interactor="api"> 55 <param name="inputs" value="random-20-a.fa"/>
54 <conditional name="parameters">
55 <param name="type" value="specific" />
56 <param name="inputs" value="test-abund-read-2.fa"/>
57 <param name="cutoff" value="1" />
58 <param name="ksize" value="17" />
59 </conditional>
60 <output name="output"> 56 <output name="output">
61 <discover_dataset name="test-abund-read-2.fa.keep"> 57 <discovered_dataset designation="random-20-a.fa.part">
62 <assert_contents> 58 <assert_contents>
63 <has_line_matching expression="GGTTGACGGGGCTCAGGGGG" /> 59 <has_text text='>35 2' />
64 </assert_contents> 60 </assert_contents>
65 </discover_dataset> 61 </discovered_dataset>
66 </output> 62 </output>
67 </test> 63 </test>
68 <test interactor="api"> 64 </tests>
69 <param name="inputs" value="test-abund-read-2.fa" /> 65 <help><![CDATA[
70 <param name="cutoff" value="2" /> 66 Load in a set of sequences, partition them, merge the partitions, and
71 <param name="ksize" value="17" /> 67 annotate the original sequences files with the partition information.
72 <output name="output">
73 <discover_dataset name="test-abund-read-2.fa.keep">
74 <assert_contents>
75 <has_line_matching expression="GGTTGACGGGGCTCAGGGGG" />
76 <has_line_matching expression="GGTTGACGGGGCTCAGGG" />
77 </assert_contents>
78 </discover_dataset>
79 </output>
80 </test>
81 <test interactor="api">
82 <param name="inputs" value="test-abund-read-paired.fa" />
83 <param name="cutoff" value="1" />
84 <param name="ksize" value="17" />
85 <param name="paired" value="true" />
86 <output name="output">
87 <discover_dataset name="test-abund-read-paired.fa.keep">
88 <assert_contents>
89 <has_line_matching expression="GGTTGACGGGGCTCAGGGGG" />
90 <has_line_matching expression="GGTTGACGGGGCTCAGGG" />
91 </assert_contents>
92 </discover_dataset>
93 </output>
94 </test>
95 68
96 </tests> 69 This script combines the functionality of :program:`load-graph.py`,
97 --> 70 :program:`partition-graph.py`, :program:`merge-partitions.py`, and
71 :program:`annotate-partitions.py` into one script. This is convenient
72 but should probably not be used for large data sets, because
73 :program:`do-partition.py` doesn't provide save/resume functionality.
74 ]]>
75 </help>
98 <citations> 76 <citations>
99 <expand macro="software-citation" /> 77 <expand macro="software-citation" />
100 <expand macro="graph-citation" /> 78 <expand macro="graph-citation" />
101 </citations> 79 </citations>
102 <!-- [OPTIONAL] Help displayed in Galaxy -->
103 <!--
104 <help>
105 </help>
106 -->
107 </tool> 80 </tool>