diff fasta_remove_id.xml @ 0:d5c3354c166d draft default tip

Uploaded

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/fasta_remove_id.xml	Fri Apr 29 10:33:36 2022 +0000
@@ -0,0 +1,53 @@
+<?xml version="1.0"?>
+<tool id="edu.tamu.cpt.fasta.remove_desc" name="Remove Description" version="19.1.0.0">
+	<description>from fasta file</description>
+	<macros>
+		<import>macros.xml</import>
+		<import>cpt-macros.xml</import>
+	</macros>
+	<expand macro="requirements"/>
+	<command detect_errors="aggressive">
+$__tool_directory__/fasta_remove_id.py
+@SEQUENCE@
+> $out
+</command>
+	<inputs>
+		<expand macro="input/fasta" />
+	</inputs>
+	<outputs>
+		<data format="fasta" name="out" />
+	</outputs>
+	<tests>
+                <test>
+                        <param name="sequences" value="T7_RemIDIn.fasta"/>
+			<output name="out" file="T7_RemIDOut.fasta" />
+		</test>
+	</tests>
+	<help>
+**What it does**
+
+From an input FASTA file, removes the "description" field (all characters after
+the first space in the top line until a return) after the FASTA ID (from the > 
+to the first space).
+		
+This is a permanent removal of the description. It is useful for tools that 
+behave in unexpected ways if it is present, e.g. Glimmer/GeneMarkS.
+
+**Example Input/Output**
+
+For an input FASTA file::
+
+	>1|random sequence|A: 0.25|C: 0.25|G: 0.25|T: 0.25|length: 288 bp
+	acttacgcggagagatgagaccaacgctcgcctaggggcacgcttgtaattgacttatct
+	>2|random sequence|A: 0.25|C: 0.25|G: 0.25|T: 0.25|length: 232 bp
+	gttggggacccacctatcagggagtgtagtagtataagactgtccaataccccccaacat
+
+The resulting FASTA will contain only IDs without a description::
+
+	>1|random
+	acttacgcggagagatgagaccaacgctcgcctaggggcacgcttgtaattgacttatct
+	>2|random
+	gttggggacccacctatcagggagtgtagtagtataagactgtccaataccccccaacat
+	</help>
+		<expand macro="citations" />
+</tool>