# HG changeset patch # User boris # Date 1334951229 14400 # Node ID 1f7aa3f8dee600697d256e682d1f0b670c175024 # Parent 39da1a66b14486451b26f8c4362ab0dcc131e798 Uploaded diff -r 39da1a66b144 -r 1f7aa3f8dee6 MDtag_filter.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/MDtag_filter.xml Fri Apr 20 15:47:09 2012 -0400 @@ -0,0 +1,123 @@ + + on MD tag string + MDtag_filter.py $in_sam $n $m $out_sam ${create.choice} $discarded_sam + + + + + + + + + + + + + + + + + + + + + (create['choice']=='yes') + + + + + + + + + + + + + + + + + + + + + +Mismatches at either end of a mapped read are most likely sequencing errors. +This tool aims to control the variation noise due to potential sequencing errors. + +----- + +.. class:: infomark + +**What it does** + +This tool reads the MD tag of mapped reads (see SAM format specification). The user defines the 5' and 3' windows **n** and **m** (in bp), respectively. +The mapped read is discarded if it contains any number of mismatches within **n** bases of the read 5' end and within **m** bases of the read 3' end. +The resulting SAM file is enriched for mapped reads that show internal variation (if any) over reads whose variation is found within the read ends. +The user might also want to keep the discarded reads in an additional file. + +----- + +.. class:: warningmark + +**Note** + +Mapped reads without an MD tag will be removed from the output SAM file(s). + +----- + +.. class:: infomark + +**About formats** + +**SAM format** -- SAM stands for Sequence Alignment/Map format. It is a TAB-delimited text format consisting of a header section, which is optional, and an alignment section. Each alignment line has 11 mandatory fields for essential alignment information such as mapping position, and variable number of optional fields for flexible or aligner specific information. + +Each alignment line has 11 **mandatory** fields:: + + 1. QNAME - Query template NAME + 2. FLAG - bitwise FLAG + 3. RNAME - Reference sequence NAME + 4. POS - 1-based leftmost mapping POSition + 5. MAPQ - MAPping Quality + 6. CIGAR - CIGAR string + 7. RNEXT - Ref. name of the mate/next segment + 8. PNEXT - Position of the mate/next segment observed + 9. TLEN - Template LENgth + 10. SEQ - segment SEQuence + 11. QUAL - ASCII of Phred-scaled base QUALity+33 + + +All **optional** fields follow the TAG\:TYPE\:VALUE format, where TAG is a two-character string that matches [A-Za-z][A-Za-z0-9]. TYPE is a single case sensitive letter which defines the format of VALUE:: + + MD TAG + + MD:Z:[0-9]+(([A-Z]|\^[A-Z]+)[0-9]+)* with Z = Printable string, including space. + + String for mismatching positions. The MD field aims to achieve SNP/indel calling without looking at the reference. + For example, a string ‘10A5^AC6’ means from the leftmost reference base in the alignment, there are 10 matches followed by an A on the reference which is different from the aligned read base; the next 5 reference bases are matches followed by a 2bp deletion from the reference; the deleted sequence is AC; the last 6 bases are matches. The MD field ought to match the CIGAR string. + +----- + +**Example** + +- For the following dataset:: + + SRR057527.13746413 16 1 1164232 35 1I35M * 0 0 CGAAAGTGAGGTCCTGGCTCCAATCCAATCCCCGGG 333333033333333333333333333333333333 X0:i:1 X1:i:0 OC:Z:36M RG:Z:rnaseq XG:i:0 NM:i:2 XM:i:2 XO:i:0 OP:i:1164231 OQ:Z:CCCCCCDCCCCBCCCCCCCCCCCCCCCCCCCCCCCC XT:A:U + SRR057527.8574994 16 1 565901 23 36M * 0 0 GAGCCTAATCTACTCCACCTCAATCACACTACTCCC 333333333333333303333333333333333333 X0:i:1 X1:i:1 XA:Z:MT,-5351,36M,2; MD:Z:1C34 RG:Z:rnaseq XG:i:0 NM:i:1 XM:i:1 XO:i:0 OQ:Z:CCCCCCCCCCCCCCCCDCCCCCCCCCCCCCCCCCCC XT:A:U + SRR057528.178504 0 1 566573 23 36M * 0 0 ACTGGGCCAGCCAGGCAACCTTCTAGGTAACGACCA 233333323222222232333222222222222222 X0:i:1 X1:i:1 XA:Z:MT,+6023,36M,1; MD:Z:36 RG:Z:rnaseq XG:i:0 NM:i:0 XM:i:0 XO:i:0 OQ:Z::?CCCCBAB@AA@@A@B@??BA@A;AA@======:@ XT:A:U + SRR057527.20391474 0 1 565512 23 36M * 0 0 GGCAGTTGAGGGGGATTAAACCAAACCCAACTACGC %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% X0:i:1 X1:i:1 XA:Z:MT,+4962,36M,2; MD:Z:11T24 RG:Z:rnaseq XG:i:0 NM:i:1 XM:i:1 XO:i:0 OQ:Z:%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% XT:A:U + SRR057513.2261668 16 1 16267 15 36M * 0 0 CACTTCTGGATGCTAGGGTTACACTGGGAGTCACAG 333333333333333333333333333333333333 X0:i:1 X1:i:6 MD:Z:30A5 RG:Z:rnaseq XG:i:0 NM:i:1 XM:i:1 XO:i:0 OQ:Z:IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII XT:A:U + + + +- running this tool with **n = 5** and **m =10**, will return:: + + SRR057528.178504 0 1 566573 23 36M * 0 0 ACTGGGCCAGCCAGGCAACCTTCTAGGTAACGACCA 233333323222222232333222222222222222 X0:i:1 X1:i:1 XA:Z:MT,+6023,36M,1; MD:Z:36 RG:Z:rnaseq XG:i:0 NM:i:0 XM:i:0 XO:i:0 OQ:Z::?CCCCBAB@AA@@A@B@??BA@A;AA@======:@ XT:A:U + SRR057527.20391474 0 1 565512 23 36M * 0 0 GGCAGTTGAGGGGGATTAAACCAAACCCAACTACGC %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% X0:i:1 X1:i:1 XA:Z:MT,+4962,36M,2; MD:Z:11T24 RG:Z:rnaseq XG:i:0 NM:i:1 XM:i:1 XO:i:0 OQ:Z:%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% XT:A:U + SRR057513.2261668 16 1 16267 15 36M * 0 0 CACTTCTGGATGCTAGGGTTACACTGGGAGTCACAG 333333333333333333333333333333333333 X0:i:1 X1:i:6 MD:Z:30A5 RG:Z:rnaseq XG:i:0 NM:i:1 XM:i:1 XO:i:0 OQ:Z:IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII XT:A:U + + + + + \ No newline at end of file