Mercurial > repos > bgruening > text_processing
changeset 26:f22a309187a3 draft default tip
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/text_processing/text_processing commit c2b1677d1c94433f777c2dc28ac8eec0a99cc6a7
| author | bgruening |
|---|---|
| date | Fri, 16 Aug 2024 10:41:17 +0000 |
| parents | cd83b5644eab |
| children | |
| files | awk.xml cat.xml cut.xml easyjoin.xml find_and_replace.xml grep.xml head.xml macros.xml multijoin.xml nl.xml recurring_lines.xml replace_text_in_column.xml replace_text_in_line.xml sed.xml sort.xml sort_rows.xml sorted_uniq.xml tac.xml tail.xml test-data/grep_results2.html test-data/nl-out-number-format.txt test-data/nl-out.txt test-data/nl-start-incr.txt unfold_column.xml unsorted_uniq.xml |
| diffstat | 25 files changed, 262 insertions(+), 130 deletions(-) [+] |
line wrap: on
line diff
--- a/awk.xml Sat Oct 08 20:59:15 2022 +0000 +++ b/awk.xml Fri Aug 16 10:41:17 2024 +0000 @@ -1,10 +1,11 @@ -<tool id="tp_awk_tool" name="Text reformatting" version="@BASE_VERSION@.2"> +<tool id="tp_awk_tool" name="Text reformatting" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@"> <description>with awk</description> <macros> <import>macros.xml</import> </macros> + <expand macro="creator"/> <requirements> - <requirement type="package" version="4.2.0">gawk</requirement> + <requirement type="package" version="5.3.0">gawk</requirement> </requirements> <version_command>awk --version | head -n 1</version_command> <command> @@ -15,9 +16,9 @@ -v FS=' ' -v OFS=' ' --re-interval - -f "$awk_script" - "$infile" - > "$outfile" + -f '$awk_script' + '$infile' + > '$outfile' ]]> </command> <configfiles> @@ -119,7 +120,6 @@ - **$** matches the end of a line or string. - **\|** Separates alternate possibilities. -@REFERENCES@ ]]> </help> <expand macro="citations" />
--- a/cat.xml Sat Oct 08 20:59:15 2022 +0000 +++ b/cat.xml Fri Aug 16 10:41:17 2024 +0000 @@ -1,8 +1,9 @@ -<tool id="tp_cat" name="Concatenate datasets" version="0.1.1"> +<tool id="tp_cat" name="Concatenate datasets" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@"> <description>tail-to-head (cat)</description> <macros> <import>macros.xml</import> </macros> + <expand macro="creator"/> <expand macro="requirements" /> <version_command> <![CDATA[ @@ -89,7 +90,6 @@ chr2 100000030 200000955 P 0 + chr2 100000015 200000999 Q 0 + -@REFERENCES@ ]]> </help> <expand macro="citations" />
--- a/cut.xml Sat Oct 08 20:59:15 2022 +0000 +++ b/cut.xml Fri Aug 16 10:41:17 2024 +0000 @@ -1,4 +1,4 @@ -<tool id="tp_cut_tool" name="Advanced Cut" version="@BASE_VERSION@.0"> +<tool id="tp_cut_tool" name="Advanced Cut" version="@TOOL_VERSION@+galaxy2" profile="@PROFILE@"> <description>columns from a table (cut)</description> <macros> <import>macros.xml</import> @@ -8,14 +8,18 @@ <command> <![CDATA[ cut - #if str($delimiter) != '': - -d"${delimiter}" + $complement + $cut_type_options.cut_element + #if $cut_type_options.cut_element != '-f' + '$cut_type_options.list' + #else + '$cut_type_options.colnames_option.list' + #if str($cut_type_options.delimiter) != '': + -d"$cut_type_options.delimiter" + #end if #end if - ${complement} - ${cut_type_options.cut_element} - '${cut_type_options.list}' - '${input}' - > '${output}' + '$input' + > '$output' ]]> </command> <inputs> @@ -24,23 +28,33 @@ <option value="">Keep</option> <option value="--complement">Discard</option> </param> - <param name="delimiter" type="select" label="Delimited by"> - <option value="">Tab</option> - <option value=" ">Whitespace</option> - <option value=".">Dot</option> - <option value=",">Comma</option> - <option value="-">Dash</option> - <option value="_">Underscore</option> - <option value="|">Pipe</option> - </param> <conditional name="cut_type_options"> <param name="cut_element" type="select" label="Cut by"> <option value="-f">fields</option> <option value="-c">characters</option> - <option value="-b">bytes</option> </param> <when value="-f"> - <param name="list" type="data_column" data_ref="input" multiple="true" label="List of Fields" help="(-f)" /> + <param name="delimiter" type="select" label="Delimited by"> + <option value="">Tab</option> + <option value=" ">Whitespace</option> + <option value=".">Dot</option> + <option value=",">Comma</option> + <option value="-">Dash</option> + <option value="_">Underscore</option> + <option value="|">Pipe</option> + </param> + <conditional name="colnames_option"> + <param name="header" type="select" label="Is there a header for the data's columns ?"> + <option value="Y">Yes</option> + <option value="N" selected="true">No</option> + </param> + <when value="Y"> + <param name="list" type="data_column" data_ref="input" use_header_names="true" multiple="true" label="List of Fields" help="(-f)" /> + </when> + <when value="N"> + <param name="list" type="data_column" data_ref="input" multiple="true" label="List of Fields" help="(-f)" /> + </when> + </conditional> </when> <when value="-c"> <param name="list" type="text" value="" label="List of characters" help="These will be kept/discarded (depending on 'operation'). <BR /> Examples: 1,3,4 or 2-5"> @@ -51,15 +65,6 @@ </sanitizer> </param> </when> - <when value="-b"> - <param name="list" type="text" value="" label="List of Bytes" help="These will be kept/discarded (depending on 'operation'). <BR /> Examples: 1,3,4 or 2-5"> - <sanitizer> - <valid initial="string.printable"> - <remove value="'"/> - </valid> - </sanitizer> - </param> - </when> </conditional> </inputs> <outputs> @@ -70,7 +75,7 @@ <conditional name="cut_type_options.cut_element"> <!-- fields --> <when value="-f"> - <conditional name="delimiter"> + <conditional name="cut_type_options.delimiter"> <when value="T"> <conditional name="input"> <when datatype_isinstance="interval"> @@ -184,20 +189,33 @@ </data> </outputs> <tests> - <test> + <test expect_num_outputs="1"> <param name="input" value="cut1.txt"/> <param name="list" value="1,3,4"/> <param name="delimiter" value=""/> <output name="output" file="cut_results1.txt"/> + <assert_command> + <has_text text="-f '1,3,4'"/> + </assert_command> </test> - <test> + + <test expect_num_outputs="1"> <param name="input" value="cut1.txt"/> - <param name="list" value="2" /> - <param name="delimiter" value="" /> + <conditional name="cut_type_options"> + <param name="delimiter" value="" /> + <conditional name="colnames_option"> + <param name="header" value="Y"/> + <!-- in the test we can (apparently) not select by header name --> + <param name="list" value="2" /> + </conditional> + </conditional> <param name="complement" value="--complement" /> <output name="output" file="cut_results2.txt"/> + <assert_command> + <has_text text="-f '2'"/> + </assert_command> </test> - <test> + <test expect_num_outputs="1"> <param name="input" value="cut1.txt"/> <param name="list" value="-3" /> <param name="delimiter" value="" />
--- a/easyjoin.xml Sat Oct 08 20:59:15 2022 +0000 +++ b/easyjoin.xml Fri Aug 16 10:41:17 2024 +0000 @@ -1,17 +1,18 @@ -<tool id="tp_easyjoin_tool" name="Join" version="@BASE_VERSION@.2"> +<tool id="tp_easyjoin_tool" name="Join" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@"> <description>two files</description> <macros> <import>macros.xml</import> </macros> + <expand macro="creator"/> <expand macro="requirements"> - <requirement type="package" version="5.22.0.1">perl</requirement> + <requirement type="package" version="5.32">perl</requirement> </expand> <version_command>join --version | head -n 1</version_command> <command> <![CDATA[ - cp $__tool_directory__/sort-header ./ && + cp '$__tool_directory__/sort-header' ./ && chmod +x sort-header && - perl $__tool_directory__/easyjoin + perl '$__tool_directory__/easyjoin' $jointype -t $'\t' $header @@ -20,8 +21,8 @@ $ignore_case -1 '$column1' -2 '$column2' - "$infile1" - "$infile2" + '$infile1' + '$infile2' > '$output' ]]> </command> @@ -109,7 +110,6 @@ * The header line (**Fruit Color Price**) was joined and kept as first line. * Missing values ( Avocado's color, missing from the first file ) are replaced with a period character. -@REFERENCES@ ]]> </help> <expand macro="citations" />
--- a/find_and_replace.xml Sat Oct 08 20:59:15 2022 +0000 +++ b/find_and_replace.xml Fri Aug 16 10:41:17 2024 +0000 @@ -1,10 +1,11 @@ -<tool id="tp_find_and_replace" name="Replace" version="@BASE_VERSION@.4"> +<tool id="tp_find_and_replace" name="Replace" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@"> <description>parts of text</description> <macros> <import>macros.xml</import> </macros> + <expand macro="creator"/> <requirements> - <requirement type="package" version="5.22.0.1">perl</requirement> + <requirement type="package" version="5.32">perl</requirement> </requirements> <command> <![CDATA[ @@ -240,7 +241,6 @@ - **\\w** matches a single letter or digit or an underscore. - **\\s** matches a single white-space (space or tabs). -@REFERENCES@ ]]> </help> <expand macro="citations" />
--- a/grep.xml Sat Oct 08 20:59:15 2022 +0000 +++ b/grep.xml Fri Aug 16 10:41:17 2024 +0000 @@ -1,12 +1,16 @@ -<tool id="tp_grep_tool" name="Search in textfiles" version="@BASE_VERSION@.1"> +<tool id="tp_grep_tool" name="Search in textfiles" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@"> <description>(grep)</description> <macros> <import>macros.xml</import> </macros> + <expand macro="creator"/> <requirements> - <requirement type="package" version="2.14">grep</requirement> - <requirement type="package" version="4.4">sed</requirement><!-- for ansi2html.sh --> + <requirement type="package" version="3.11">grep</requirement> + <requirement type="package" version="4.8">sed</requirement><!-- for ansi2html.sh --> </requirements> + <stdio> + <exit_code range="2:" level="fatal" description="grep failed" /> + </stdio> <version_command>grep --version | head -n 1</version_command> <command> <![CDATA[ @@ -19,17 +23,18 @@ -B $lines_before $invert $case_sensitive - -- "${url_paste}" - '${infile}' | $__tool_directory__/ansi2html.sh > "${output}" + -- '${url_paste}' + '${infile}' | '$__tool_directory__/ansi2html.sh' > '${output}' #else: grep $regex_type -A $lines_after -B $lines_before + --no-group-separator $invert $case_sensitive - -- "${url_paste}" - '${infile}' | grep -v "^--$" > "${output}" + -- '${url_paste}' + '${infile}' > '${output}' #end if ]]> </command> @@ -42,9 +47,9 @@ </param> <param name="regex_type" type="select" label="Type of regex"> - <option value="-G">Basic</option> - <option value="-P" selected="true">Perl</option> - <option value="-E">Extended (egrep)</option> + <option value="-G">Basic (-G)</option> + <option value="-P" selected="true">Perl (-P)</option> + <option value="-E">Extended (egrep -E)</option> </param> <param name="url_paste" type="text" label="Regular Expression" help="See below for more details"> @@ -77,8 +82,8 @@ </data> </outputs> <tests> + <!-- grep a FASTA file for sequences with specific motif --> <test> - <!-- grep a FASTA file for sequences with specific motif --> <param name="infile" value="grep1.txt" /> <param name="case_sensitive" value="case sensitive" /> <param name="regex_type" value="-P" /> @@ -89,9 +94,9 @@ <param name="color" value="NOCOLOR" /> <output name="output" file="grep_results1.txt" /> </test> + <!-- grep a FASTA file for sequences with specific motif - + show highlighed output --> <test> - <!-- grep a FASTA file for sequences with specific motif - - show highlighed output --> <param name="infile" value="grep1.txt" /> <param name="case_sensitive" value="case sensitive" /> <param name="regex_type" value="-P" /> @@ -102,7 +107,8 @@ <param name="color" value="COLOR" /> <output name="output" file="grep_results2.html" /> </test> - <test><!-- tests egrep --> + <!-- tests egrep --> + <test> <param name="infile" value="egrep1.txt" /> <param name="case_sensitive" value="case sensitive" /> <param name="regex_type" value="-E" /> @@ -113,16 +119,44 @@ <param name="color" value="NOCOLOR" /> <output name="output" file="egrep_results1.txt" /> </test> - <test><!-- same regex as egrep test, but different outcome with basic regex --> + <!-- tests basic regex; + must be backslashed to match --> + <test> + <param name="infile" value="egrep1.txt" /> + <param name="case_sensitive" value="case sensitive" /> + <param name="regex_type" value="-G" /> + <param name="invert" value="" /> + <param name="url_paste" value="[^ ]\+" /> + <param name="lines_before" value="0" /> + <param name="lines_after" value="0" /> + <param name="color" value="NOCOLOR" /> + <output name="output" file="egrep_results1.txt" /> + </test> + <!-- tests regex;matching nothing --> + <test> <param name="infile" value="egrep1.txt" /> <param name="case_sensitive" value="case sensitive" /> <param name="regex_type" value="-G" /> <param name="invert" value="" /> - <param name="url_paste" value="[^ ]+" /> + <param name="url_paste" value="not existent pattern" /> <param name="lines_before" value="0" /> <param name="lines_after" value="0" /> <param name="color" value="NOCOLOR" /> - <output name="output" file="egrep_results2.txt" /> + <output name="output"> + <assert_contents> + <has_size value="0"/> + </assert_contents> + </output> + </test> + <!-- tests invalid regex; i.e. that we still get exit code 2 --> + <test expect_failure="true" expect_exit_code="2"> + <param name="infile" value="egrep1.txt" /> + <param name="case_sensitive" value="case sensitive" /> + <param name="regex_type" value="-G" /> + <param name="invert" value="" /> + <param name="url_paste" value="\(" /> + <param name="lines_before" value="0" /> + <param name="lines_after" value="0" /> + <param name="color" value="NOCOLOR" /> </test> </tests> <help> @@ -187,7 +221,6 @@ - **$** matches the end of a line or string. - **\|** Separates alternate possibilities. -@REFERENCES@ ]]> </help> <expand macro="citations" />
--- a/head.xml Sat Oct 08 20:59:15 2022 +0000 +++ b/head.xml Fri Aug 16 10:41:17 2024 +0000 @@ -1,8 +1,9 @@ -<tool id="tp_head_tool" name="Select first" version="@BASE_VERSION@.0"> +<tool id="tp_head_tool" name="Select first" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@"> <description>lines from a dataset (head)</description> <macros> <import>macros.xml</import> </macros> + <expand macro="creator"/> <expand macro="requirements" /> <version_command>head --version | head -n 1</version_command> <command> @@ -56,7 +57,6 @@ chr7 56632 56652 D17003_CTCF_R6 310 + chr7 56736 56756 D17003_CTCF_R7 354 + -@REFERENCES@ ]]> </help> <expand macro="citations" />
--- a/macros.xml Sat Oct 08 20:59:15 2022 +0000 +++ b/macros.xml Fri Aug 16 10:41:17 2024 +0000 @@ -1,11 +1,13 @@ <macros> <xml name="requirements"> <requirements> - <requirement type="package" version="8.25">coreutils</requirement> + <requirement type="package" version="9.3">coreutils</requirement> <yield/> </requirements> </xml> - <token name="@BASE_VERSION@">1.1</token> + <token name="@TOOL_VERSION@">9.3</token> + <token name="@VERSION_SUFFIX@">1</token> + <token name="@PROFILE@">23.1</token> <xml name="stdio"> <stdio> <!-- Anything other than zero is an error --> @@ -16,22 +18,18 @@ <regex match="Exception:" /> </stdio> </xml> - <token name="@REFERENCES@"> -<![CDATA[ ------- - -**Citation** - -If you use this tool in Galaxy, please cite: - -Bjoern A. Gruening (2014), `Galaxy wrapper <https://github.com/bgruening/galaxytools>`_ - -Assaf Gordon (gordon <at> cshl dot edu) -]]> - </token> <xml name="citations"> <citations> + <citation type="doi">10.5281/zenodo.1419255</citation> <yield /> </citations> </xml> + <xml name="creator"> + <creator> + <organization name="European Galaxy Team" url="https://galaxyproject.org/eu/" /> + <person givenName="Björn" familyName="Grüning" url="https://github.com/bgruening"/> + <person givenName="Assaf" familyName="Gordon" url="https://github.com/agordon" /> + <person givenName="Matthias" familyName="Bernt" url="https://github.com/bernt-matthias/" /> + </creator> + </xml> </macros>
--- a/multijoin.xml Sat Oct 08 20:59:15 2022 +0000 +++ b/multijoin.xml Fri Aug 16 10:41:17 2024 +0000 @@ -1,10 +1,11 @@ -<tool id="tp_multijoin_tool" name="Multi-Join" version="@BASE_VERSION@.1"> +<tool id="tp_multijoin_tool" name="Multi-Join" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@"> <description>(combine multiple files)</description> <macros> <import>macros.xml</import> </macros> + <expand macro="creator"/> <requirements> - <requirement type="package" version="5.22.0.1">perl</requirement> + <requirement type="package" version="5.32">perl</requirement> </requirements> <command> <![CDATA[ @@ -15,7 +16,7 @@ $ignore_dups $output_header $input_header - $first_file + '$first_file' #for $file in $files: '$file' #end for @@ -126,7 +127,6 @@ Input files need not be sorted. -@REFERENCES@ ]]> </help> <expand macro="citations" />
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/nl.xml Fri Aug 16 10:41:17 2024 +0000 @@ -0,0 +1,63 @@ +<tool id="nl" name="Number lines" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@"> + <description></description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="creator"/> + <expand macro="requirements" /> + <version_command>nl --version | head -n 1</version_command> + <command><![CDATA[ + nl + --line-increment=$line_increment + --starting-line-number=$starting_line_number + --number-format=$number_format + --number-width=$number_width + '$input' + > '$output' + ]]></command> + <inputs> + <param name="input" format="txt" type="data" label="File to number" /> + <param argument="--line-increment" type="integer" value="1" label="Line number increment at each line"/> + <param argument="--starting-line-number" type="integer" value="1" label="First line number"/> + <param argument="--number-format" type="select" label="Line number format"> + <option value="ln">left justified, no leading zeros</option> + <option value="rn" selected="true">right justified, no leading zeros</option> + <option value="rz">right justified, leading zeros</option> + </param> + <param argument="--number-width" type="integer" min="1" value="6" label="Number of characters for line numbers"/> + </inputs> + <outputs> + <data format_source="input" name="output"/> + </outputs> + <tests> + <test> + <param name="input" value="cut1.txt" ftype="tabular"/> + <output name="output" file="nl-out.txt" ftype="tabular"/> + </test> + <test> + <param name="input" value="cut1.txt" ftype="tabular"/> + <param name="number_format" value="ln"/> + <param name="number_width" value="1"/> + <output name="output" file="nl-out-number-format.txt" ftype="tabular"> + <assert_contents> + <!-- no filling spaces --> + <has_text text=" " negate="true"/> + </assert_contents> + </output> + </test> + <test> + <param name="input" value="cut1.txt" ftype="tabular"/> + <param name="line_increment" value="2"/> + <param name="starting_line_number" value="10"/> + <output name="output" file="nl-start-incr.txt" ftype="tabular"/> + </test> + </tests> + <help> +<![CDATA[ +**What it does** + +Add line numbers to the data set. +]]> + </help> + <expand macro="citations" /> +</tool>
--- a/recurring_lines.xml Sat Oct 08 20:59:15 2022 +0000 +++ b/recurring_lines.xml Fri Aug 16 10:41:17 2024 +0000 @@ -1,8 +1,9 @@ -<tool id="tp_text_file_with_recurring_lines" name="Create text file" version="@BASE_VERSION@.0"> +<tool id="tp_text_file_with_recurring_lines" name="Create text file" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@"> <description>with recurring lines</description> <macros> <import>macros.xml</import> </macros> + <expand macro="creator"/> <expand macro="requirements" /> <version_command>yes --version | head -n 1</version_command> <command> @@ -13,7 +14,7 @@ #else: times=`wc -l $token.repeat_select.infile | awk '{print $1}'`; #end if - yes -- "${token.line}" 2>/dev/null | head -n \$times >> $outfile; + yes -- '${token.line}' 2>/dev/null | head -n \$times >> '$outfile'; #end for ]]> </command> @@ -72,7 +73,6 @@ The entire string will be printed X times separated by a line break. X can be either given by the use as a number or calculated by a given file. In case the user provides a file, the line number will be used as X. -@REFERENCES@ ]]> </help> <expand macro="citations" />
--- a/replace_text_in_column.xml Sat Oct 08 20:59:15 2022 +0000 +++ b/replace_text_in_column.xml Fri Aug 16 10:41:17 2024 +0000 @@ -1,10 +1,11 @@ -<tool id="tp_replace_in_column" name="Replace Text" version="@BASE_VERSION@.3"> +<tool id="tp_replace_in_column" name="Replace Text" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@"> <description>in a specific column</description> <macros> <import>macros.xml</import> </macros> + <expand macro="creator"/> <requirements> - <requirement type="package" version="4.2.0">gawk</requirement> + <requirement type="package" version="5.3.0">gawk</requirement> </requirements> <version_command>awk --version | head -n 1</version_command> <command> @@ -19,8 +20,8 @@ \$$replacement.column = gensub( /$replacement.find_pattern/, "$replacement.replace_pattern", "g", \$$replacement.column ) ; #end for print \$0 ; }' - "$infile" - > "$outfile" + '$infile' + > '$outfile' ]]> </command> <inputs> @@ -151,7 +152,6 @@ **Note**: AWK uses extended regular expression syntax, not Perl syntax. **\\d**, **\\w**, **\\s** etc. are **not** supported. -@REFERENCES@ ]]> </help> <expand macro="citations" />
--- a/replace_text_in_line.xml Sat Oct 08 20:59:15 2022 +0000 +++ b/replace_text_in_line.xml Fri Aug 16 10:41:17 2024 +0000 @@ -1,10 +1,11 @@ -<tool id="tp_replace_in_line" name="Replace Text" version="@BASE_VERSION@.2"> +<tool id="tp_replace_in_line" name="Replace Text" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@"> <description>in entire line</description> <macros> <import>macros.xml</import> </macros> + <expand macro="creator"/> <requirements> - <requirement type="package" version="4.4">sed</requirement> + <requirement type="package" version="4.8">sed</requirement> </requirements> <version_command>sed --version | head -n 1</version_command> <command> @@ -156,7 +157,6 @@ **Note**: SED uses extended regular expression syntax, not Perl syntax. **\\d**, **\\w**, **\\s** etc. are **not** supported. -@REFERENCES@ ]]> </help> <expand macro="citations" />
--- a/sed.xml Sat Oct 08 20:59:15 2022 +0000 +++ b/sed.xml Fri Aug 16 10:41:17 2024 +0000 @@ -1,10 +1,11 @@ -<tool id="tp_sed_tool" name="Text transformation" version="@BASE_VERSION@.1"> +<tool id="tp_sed_tool" name="Text transformation" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@"> <description>with sed</description> <macros> <import>macros.xml</import> </macros> + <expand macro="creator"/> <requirements> - <requirement type="package" version="4.4">sed</requirement> + <requirement type="package" version="4.8">sed</requirement> </requirements> <version_command>sed --version | head -n 1</version_command> <command> @@ -126,7 +127,6 @@ **Note**: SED uses extended regular expression syntax, not Perl syntax. **\\d**, **\\w**, **\\s** etc. are **not** supported. -@REFERENCES@ ]]> </help> <expand macro="citations" />
--- a/sort.xml Sat Oct 08 20:59:15 2022 +0000 +++ b/sort.xml Fri Aug 16 10:41:17 2024 +0000 @@ -1,10 +1,11 @@ -<tool id="tp_sort_header_tool" name="Sort" version="@BASE_VERSION@.1"> +<tool id="tp_sort_header_tool" name="Sort" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@"> <description>data in ascending or descending order</description> <macros> <import>macros.xml</import> </macros> + <expand macro="creator"/> <expand macro="requirements"> - <requirement type="package" version="4.4">sed</requirement> + <requirement type="package" version="4.8">sed</requirement> </expand> <version_command>sort --version | head -n 1</version_command> <command> @@ -170,7 +171,6 @@ If you're planning to use the file with another tool that expected sorted files (such as *join*), you should use the **Alphabetical sort**, not the **Natural Sort**. Natural sort order is easier for humans, but is unnatural for computer programs. -@REFERENCES@ ]]> </help> <expand macro="citations" />
--- a/sort_rows.xml Sat Oct 08 20:59:15 2022 +0000 +++ b/sort_rows.xml Fri Aug 16 10:41:17 2024 +0000 @@ -1,11 +1,15 @@ -<tool id="tp_sort_rows" name="Sort a row" version="@BASE_VERSION@.0+galaxy0"> +<tool id="tp_sort_rows" name="Sort a row" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@"> <description>according to their columns</description> <macros> <import>macros.xml</import> </macros> + <expand macro="creator"/> + <requirements> + <requirement type="package" version="3.12">python</requirement> + </requirements> <command> <![CDATA[ - python -c 'for line in ( "\t".join(sorted(line.strip().split("\t"))) for line in open("$infile") ): print(line)' > $outfile + python -c 'for line in ( "\t".join(sorted(line.strip().split("\t"))) for line in open("$infile") ): print(line)' > '$outfile' ]]> </command> <inputs> @@ -14,7 +18,6 @@ <outputs> <data name="outfile" format_source="infile" metadata_source="infile"/> </outputs> - <options sanitize="False"/> <tests> <test> <param name="infile" value="sort_rows1.tabular" ftype="tabular" /> @@ -31,7 +34,6 @@ That tool sorts each row in a TAB separated file, according to their columns. In other words: It is a sorted reordering of all columns. -@REFERENCES@ ]]> </help> <expand macro="citations" />
--- a/sorted_uniq.xml Sat Oct 08 20:59:15 2022 +0000 +++ b/sorted_uniq.xml Fri Aug 16 10:41:17 2024 +0000 @@ -1,10 +1,11 @@ -<tool id="tp_uniq_tool" name="Unique lines" version="@BASE_VERSION@.1"> +<tool id="tp_uniq_tool" name="Unique lines" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@"> <description>assuming sorted input file</description> <macros> <import>macros.xml</import> </macros> + <expand macro="creator"/> <expand macro="requirements"> - <requirement type="package" version="4.4">sed</requirement> + <requirement type="package" version="4.8">sed</requirement> </expand> <version_command>uniq --version | head -n 1</version_command> <command> @@ -23,14 +24,14 @@ $grouping.uniqueonly #end if - "$infile" + '$infile' #if $grouping.grouping_select == 'no' and $grouping.count: ## count will print the count with spaces in front of the line and ## with a space (not a tab) after the number, we need to cahnge that | sed -e 's/ *//' -e 's/ /\t/' #end if - > "$outfile" + > '$outfile' ]]> </command> <inputs> @@ -99,7 +100,6 @@ You can sort your file using either the "Sort" tool in "Filter and Sort", or the "Sort" tool in "Unix Tools". -@REFERENCES@ ]]> </help> <expand macro="citations" />
--- a/tac.xml Sat Oct 08 20:59:15 2022 +0000 +++ b/tac.xml Fri Aug 16 10:41:17 2024 +0000 @@ -1,8 +1,9 @@ -<tool id="tp_tac" name="tac" version="@BASE_VERSION@.0"> +<tool id="tp_tac" name="tac" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@"> <description>reverse a file (reverse cat)</description> <macros> <import>macros.xml</import> </macros> + <expand macro="creator"/> <expand macro="requirements" /> <version_command>tac --version | head -n 1</version_command> <command> @@ -15,8 +16,8 @@ "$separator.separator_string" #end if #end if - "$infile" - > "$outfile" + '$infile' + > '$outfile' ]]> </command> <inputs> @@ -85,7 +86,6 @@ 5 # 6 7 8 9 0 1 2 3 4 -@REFERENCES@ ]]> </help> <expand macro="citations" />
--- a/tail.xml Sat Oct 08 20:59:15 2022 +0000 +++ b/tail.xml Fri Aug 16 10:41:17 2024 +0000 @@ -1,8 +1,9 @@ -<tool id="tp_tail_tool" name="Select last" version="@BASE_VERSION@.0"> +<tool id="tp_tail_tool" name="Select last" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@"> <description>lines from a dataset (tail)</description> <macros> <import>macros.xml</import> </macros> + <expand macro="creator"/> <expand macro="requirements" /> <version_command>tail --version | head -n 1</version_command> <command> @@ -61,7 +62,6 @@ chr7 57341 57361 D17003_CTCF_R7 375 + chr7 57457 57477 D17003_CTCF_R3 188 + -@REFERENCES@ ]]> </help> <expand macro="citations" />
--- a/test-data/grep_results2.html Sat Oct 08 20:59:15 2022 +0000 +++ b/test-data/grep_results2.html Fri Aug 16 10:41:17 2024 +0000 @@ -290,11 +290,17 @@ <body class="f9 b9"> <pre> GCTATAG<span class="bold"><span class="f4">AAATGT</span></span>TAACATCGAATGTACATTATAAC +<span class="f6">--</span> CAGCTAACAATC<span class="bold"><span class="f4">AAGCGT</span></span>TACAGATTAGCCCCCCCC +<span class="f6">--</span> GAACTTGCGTAACGTACAAAAATGCAAGCA<span class="bold"><span class="f4">AAAAGT</span></span> +<span class="f6">--</span> GCTCTGTTAATCTAGA<span class="bold"><span class="f4">AAATGT</span></span>GTCTCCCCCCCCCC +<span class="f6">--</span> <span class="bold"><span class="f4">AATCGT</span></span>ATAGCTCGGGCCGGATACTAGTACACCCCC +<span class="f6">--</span> GATATAGTGGATAACTAATGCTCCCCCAG<span class="bold"><span class="f4">AACTGT</span></span>T +<span class="f6">--</span> GAACGGACTATAGCCGGTATCCAAACAT<span class="bold"><span class="f4">AAATGT</span></span>TC </pre> </body>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/nl-out-number-format.txt Fri Aug 16 10:41:17 2024 +0000 @@ -0,0 +1,4 @@ +1 fruit color weight price +2 apple red 1.4 0.4 +3 orange orange 1.1 0.2 +4 banana yellow 0.9 0.35
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/nl-out.txt Fri Aug 16 10:41:17 2024 +0000 @@ -0,0 +1,4 @@ + 1 fruit color weight price + 2 apple red 1.4 0.4 + 3 orange orange 1.1 0.2 + 4 banana yellow 0.9 0.35
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/nl-start-incr.txt Fri Aug 16 10:41:17 2024 +0000 @@ -0,0 +1,4 @@ + 10 fruit color weight price + 12 apple red 1.4 0.4 + 14 orange orange 1.1 0.2 + 16 banana yellow 0.9 0.35
--- a/unfold_column.xml Sat Oct 08 20:59:15 2022 +0000 +++ b/unfold_column.xml Fri Aug 16 10:41:17 2024 +0000 @@ -1,10 +1,11 @@ -<tool id="tp_unfold_column_tool" name="Unfold" version="@BASE_VERSION@.1"> +<tool id="tp_unfold_column_tool" name="Unfold" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@"> <description>columns from a table</description> <macros> <import>macros.xml</import> </macros> + <expand macro="creator"/> <requirements> - <requirement type="package" version="2.7.13">python</requirement> + <requirement type="package" version="3.12">python</requirement> </requirements> <command> <![CDATA[ @@ -60,7 +61,6 @@ a b 4 c a b 5 c -@REFERENCES@ ]]> </help> <expand macro="citations" />
--- a/unsorted_uniq.xml Sat Oct 08 20:59:15 2022 +0000 +++ b/unsorted_uniq.xml Fri Aug 16 10:41:17 2024 +0000 @@ -1,8 +1,9 @@ -<tool id="tp_sorted_uniq" name="Unique" version="@BASE_VERSION@.0"> +<tool id="tp_sorted_uniq" name="Unique" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@"> <description>occurrences of each record</description> <macros> <import>macros.xml</import> </macros> + <expand macro="creator"/> <expand macro="requirements" /> <version_command>sort --version | head -n 1</version_command> <command> @@ -14,8 +15,8 @@ #if $adv_opts.adv_opts_selector == "advanced": -k$adv_opts.column_start,$adv_opts.column_end #end if - -o "$outfile" - "$infile" + -o '$outfile' + '$infile' ]]> </command> <inputs> @@ -87,7 +88,6 @@ chr2 1000 1900 gene5 chr3 15 1656 gene6 -@REFERENCES@ ]]> </help> <expand macro="citations" />