# HG changeset patch
# User bgruening
# Date 1482232959 18000
# Node ID 72b8f52ad50bebf8af9bb498d53c85ab96371484

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/targetfinder/ commit 017cc50287a0190810f507cf799e02450e5c0ed5

diff -r 000000000000 -r 72b8f52ad50b TargetFinder.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/TargetFinder.xml	Tue Dec 20 06:22:39 2016 -0500
@@ -0,0 +1,73 @@
+<tool id="targetfinder" name="Plant small RNA target prediction tool" version="1.7.0">
+    <requirements>
+        <requirement type="package" version="1.7">targetfinder</requirement>
+    </requirements>
+    <stdio>
+        <exit_code range="1:" />
+    </stdio>
+    <command><![CDATA[
+        targetfinder_threads.pl
+            -f $f
+            -d $d
+            -c $c
+            -t "\${GALAXY_SLOTS:-12}"
+            $r
+            -o $output1
+    ]]></command>
+    <inputs>
+        <param label="Input small RNA sequences file" help="(-f) FASTA-format" name="f" type="data" format="fasta" />
+        <param label="Target sequence database file" help="(-d) FASTA-format" name="d" type="data" format="fasta" />
+        <param label="Prediction score cutoff value" help="(-c) DEFAULT = 4" name="c" type="float" value="4.0" />
+        <param label="Search reverse strand for targets?" help="(-r) Use this option if the database is genomic DNA." name="r" type="boolean" falsevalue="" truevalue="-r" checked="false" />
+    </inputs>
+    <outputs>
+        <data name="output1" format="data"/>
+    </outputs>
+    <tests>
+        <test>
+            <param name="f" value="ath_miRNAs_test.fa"/>
+            <param name="d" value="Antirrhinum_majus.mRNA.EST.fasta"/>
+            <param name="r" value=""/>
+            <param name="c" value="4.0"/>
+            <param name="t" value="1"/>
+            <output name="output1" file="ath_miRNAs_predicted_targets.txt" compare="contains"/>
+        </test>
+    </tests>
+    <help><![CDATA[
+**What it does**
+
+TargetFinder will computationally predict small RNA binding sites on target transcripts from a sequence database.
+
+This is done by aligning the input small RNA sequence against all transcripts,
+followed by site scoring using a position-weighted scoring matrix.
+
+**Input**
+
+-f Input small RNA sequences file (FASTA-format).
+
+-d Target sequence database file (FASTA-format)
+
+**Output**
+
+Each predicted target site is printed out separately.
+The output consists of two parts.
+
+The first is a description line and the second is a base-pairing diagram of the target and small RNA (query) sequence.
+
+The description line contains the query name, the description line from the target sequence database, and the target prediction score.
+
+The base-pairing diagram has the target site sequence on top in 5'-3' orientation and the query sequence on the bottom in 3'-5' orientation.
+
+Between the target site sequece and the query sequence are base pair symbols.
+
+A ":" (colon) symbol represents an ordinary Watson-Crick base pair, a "." (period) represents a G:U base pair, and a " " (space) represents a mismatch.
+
+If a small RNA is predicted to target a sequence more than once, each target site will be output as separate output.
+]]></help>
+    <citations>
+        <citation type="doi">10.1016/j.cell.2005.04.004</citation>
+        <citation type="doi">10.1371/journal.pone.0000219</citation>
+        <citation type="doi">10.1007/978-1-60327-005-2_4</citation>
+    </citations>
+</tool>
+
diff -r 000000000000 -r 72b8f52ad50b test-data/Antirrhinum_majus.mRNA.EST.fasta
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/Antirrhinum_majus.mRNA.EST.fasta	Tue Dec 20 06:22:39 2016 -0500
@@ -0,0 +1,23 @@
+>gi|51053470|gb|AJ787245.1|AJ787245 EST AJ787245 Antirrhinum majus whole plant Antirrhinum majus cDNA clone 018_1_01_o13, mRNA sequence.
+CTCATACACCATGCTTTAAGCTTCATTGTACGGTCATCTTTCTCTTTTACCCTTGTTCTT
+CCTTTTCTCTCCAAAAAGAAAAAAATGGATCCCAACATGCAAAACATGATGTCCTCTTAC
+TTAAAAATCAAGAAACTTGTGGGAGATGAAGGGAGTGATTTTGAGGAGGAAGAAGAAGGT
+GAAGACGAAGAAGAAGAAGAACAAGAAAGGGTTGTTAAAGTGAACTTTGCAGAGTCACAA
+TTGAAGAAGAAAAAATTGAATCTTGGTGAAGGGTCTGGTGGAAAAAGTGGTGAGAAACAT
+ACTGCTAGTGGTGGTGGAGTTGTGGCTCAGCCTTGTTGTTTGGTTGAGAATTGTGGTGCT
+GATCTGAGGAATTGCAAGAAGTATTACCAAAGGCACAGGGTTTGTGAGGTTCATGCTAAG
+GCTCCTGTGGTTTCTGTTGAGGGGTTGATGCAAAGGTTCTGTCAGCAATGTAGCAGGTTC
+CATGATCTCTCGGAATTCGATCAGACAAAGAGGAGTTGTCGCCGACGTCTCGCTGGCCAC
+AATGAACGGCGCCGTAAGAGTTCGCTCGAGTCTCACAAGGAGGGCAGAAGCCCAAGATAA
+GGACAGCCTGATGAAACAAGTTTCCGTGTTATTGGAAAGTGTCTAGAATGCTTACTCTCT
+TCTGTCACCTCGTGCC
+>gi|51107699|gb|AJ792371.1|AJ792371 EST AJ792371 Antirrhinum majus whole plant Antirrhinum majus cDNA clone 018_2_11_f24, mRNA sequence.
+TCTCTAATTCAGCACTGCTCTCTCTCTTCTGTCAAATAGTCCTGGGGCTCTAGAAACTCG
+AACAATTTTCTTGGTACTAATGGAAACGGGCCAACCATAGTTCAGCCGTCTATTAACCCT
+GGTGCTACAATTGGACAGTTTACCTGTCCCTCTTGGGGTTTTGGAGGCAACCCAGCTGAT
+AACACCTCCCATGATATGCCTCCCAATCTGAATTTAGGACAATTTTCTCACTCCAGTAAC
+AGTCACTATACTGGAGAGCCTGGGGTAGTCCAACTGAGCCACGGACAATTCCAGGACCTC
+GATCACTCAAGAGGCTATGATTCTTCCGTTCAGGACATGCATTGGTCACTTTGAAGTATT
+CCGATTCTGGACTCCCTCAATCTAGTGTTTTCAGTAACTTAAGTAAATTCCAGTGAATTA
+TCAAACACCAGGGCTTTTGTGGTGTTGCCATGTGTTCTCTTAGGAATCTGAAACTTGTAT
+GTGTGGGGTTATTTATGCTATTGCTTGTGGGCCTA
diff -r 000000000000 -r 72b8f52ad50b test-data/ath_miRNAs_predicted_targets.txt
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/ath_miRNAs_predicted_targets.txt	Tue Dec 20 06:22:39 2016 -0500
@@ -0,0 +1,12 @@
+query=ath-miR156g, target=gb|AJ787245.1|AJ787245 EST AJ787245 Antirrhinum majus whole plant Antirrhinum maju, score=2.5, range=0-0, strand=1
+
+target  5' AUGCUUACUCUCUUCUGUCA 3'
+            ::::.::::::::::::: 
+query   3' CACGAGUGAGAGAAGACAGC 5'
+
+query=ath-miR156g, target=gb|AJ792371.1|AJ792371 EST AJ792371 Antirrhinum majus whole plant Antirrhinum maju, score=3, range=0-0, strand=1
+
+target  5' CUGCUCUCUCUCUUCUGUCA 3'
+            ::::: :::::::::::: 
+query   3' CACGAGUGAGAGAAGACAGC 5'
+
diff -r 000000000000 -r 72b8f52ad50b test-data/ath_miRNAs_test.fa
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/ath_miRNAs_test.fa	Tue Dec 20 06:22:39 2016 -0500
@@ -0,0 +1,2 @@
+>ath-miR156g
+CGACAGAAGAGAGUGAGCAC