# HG changeset patch
# User bgruening
# Date 1442523015 14400
# Node ID f0465b3f1e43ef2f4ad6ab39aef5115546576901
# Parent  f486cceb3a80f4d17d75522529fba885751664fb
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rnaz commit 1973f3035c10db80883d80847ea254289f5cce2a-dirty

diff -r f486cceb3a80 -r f0465b3f1e43 rnaz.tar.bz2
Binary file rnaz.tar.bz2 has changed
diff -r f486cceb3a80 -r f0465b3f1e43 rnaz.xml
--- a/rnaz.xml	Tue Jan 14 08:50:23 2014 -0500
+++ b/rnaz.xml	Thu Sep 17 16:50:15 2015 -0400
@@ -4,26 +4,28 @@
     <requirements>
         <requirement type="package" version="2.1">rnaz</requirement>
     </requirements>
-    <command>
-RNAz $input
-$forward
-$reverse
-$both_strands
-$dinucleotide
-$mononucleotide
-$locarnate
-$no_shuffle
-#if $cutoff_p != -1:
---cutoff=$cutoff_p
-#end if
-&gt; temp.txt;
-grep -v -E "^ |^#|^$" temp.txt &gt; $outfile;
-grep -E "^ |^#|^$" temp.txt;
-    </command>
     <stdio>
         <exit_code range="1:" level="fatal" description="Error occurred. Please check Tool Standard Error" />
         <exit_code range=":-1" level="fatal" description="Error occurred. Please check Tool Standard Error" />
     </stdio>
+    <command>
+<![CDATA[
+    RNAz $input
+        $forward
+        $reverse
+        $both_strands
+        $dinucleotide
+        $mononucleotide
+        $locarnate
+        $no_shuffle
+        #if $cutoff_p != -1:
+        --cutoff=$cutoff_p
+        #end if
+        > temp.txt;
+        grep -v -E "^ |^#|^$" temp.txt > $outfile;
+        grep -E "^ |^#|^$" temp.txt;
+]]>
+    </command>
     <inputs>
         <param format="txt" name="input" type="data" label="Input Alignment File" />
         <param name="forward" type="boolean" checked="false" truevalue="--forward" falsevalue="" label="Score forward strand" help="--forward" />
@@ -38,12 +40,83 @@
     <outputs>
         <data name="outfile" format="fasta" />
     </outputs>
-    <help>**What it does**
-     RNAz is a program for predicting structurally conserved and thermodynamically stable RNA secondary structures in multiple sequence alignments. It can be used in genome wide screens to detect functional RNA structures, as found in noncoding RNAs and cis-acting regulatory elements of mRNAs.
+    <help>
+<![CDATA[
+
+**What it does**
+
+RNAz is a program for predicting structurally conserved and thermodynamically stable RNA secondary structures in multiple sequence alignments. It can be used in genome wide screens to detect functional RNA structures, as found in noncoding RNAs and cis-acting regulatory elements of mRNAs.
+
+**Input**
+
+Input is a multiple sequence alignment file. Currently the the following alignment formats can be read: CLUSTALW, FASTA, PHYLIP,NEXUS, MAF, and XMFA. Alignments can be generated by any sequence based alignment program. Sequence alignment tools can be found in Galaxy too (e.g. ClustalW).
+
+Example: 
+
+CLUSTAL 2.1 multiple sequence alignment
+
+
+sacCer1         GCCTTGTTGGCGCAATCGGTAGCGCGTATGACTCTTAATCATAAGGTTAGGGGTTCGAGC
+sacKlu          GCCTTGTTGGCGCAATCGGTAGCGCGTATGACTCTTAATCATAAGGCTAGGGGTTCGAGC
+sacBay          GCCTTGTTGGCGCAATCGGTAGCGCGTATGACTCTTAATCATAAGGTTAGGGGTTCGAGC
+sacCas          GCTTCAGTAGCTCAGTCGGAAGAGCGTCAGTCTCATAATCTGAAGGTCGAGAGTTCGAAC
+                ** *   * ** ** **** ** ****  * *** *****  ****    * ****** *
 
 
-Gruber AR, Findeiss, Washietl S, Hofacker IL, and Stadler PF. 
-RNAz 2.0: Improved noncoding rna detection. 
-Pac Symp Biocomput, 2010. 15:69–79.
+**Output**
+
+In Galaxy RNAz gives you 2 output files: a summary file and a result file. For the example input they look like this:
+
+Summary:
+
+ Sequences: 4
+ Columns: 60
+ Reading direction: forward
+ Mean pairwise identity:  82.50
+ Shannon entropy: 0.28395
+ G+C content: 0.51667
+ Mean single sequence MFE: -16.67
+ Consensus MFE: -15.59
+ Energy contribution: -15.53
+ Covariance contribution:  -0.06
+ Combinations/Pair:   1.26
+ Mean z-score:  -0.66
+ Structure conservation index:   0.93
+ Background model: mononucleotide
+ Decision model: sequence based alignment quality
+ SVM decision value:  -0.64
+ SVM RNA-class probability: 0.238023
+ Prediction: OTHER
+ 
+ 
+ Result file:
+ 
+ >sacCer1
+GCCUUGUUGGCGCAAUCGGUAGCGCGUAUGACUCUUAAUCAUAAGGUUAGGGGUUCGAGC
+..((((...((((........))))....(((((((((((....))))))))))))))). ( -19.00, z-score =  -1.44, R)
+>sacKlu
+GCCUUGUUGGCGCAAUCGGUAGCGCGUAUGACUCUUAAUCAUAAGGCUAGGGGUUCGAGC
+..((((...((((........))))....((((((((..(....)..)))))))))))). ( -16.00, z-score =  -0.11, R)
+>sacBay
+GCCUUGUUGGCGCAAUCGGUAGCGCGUAUGACUCUUAAUCAUAAGGUUAGGGGUUCGAGC
+..((((...((((........))))....(((((((((((....))))))))))))))). ( -19.00, z-score =  -1.44, R)
+>sacCas
+GCUUCAGUAGCUCAGUCGGAAGAGCGUCAGUCUCAUAAUCUGAAGGUCGAGAGUUCGAAC
+.((((((..((((........))))..............)))))).(((......))).. ( -12.69, z-score =   0.35, R)
+>consensus
+GCCUUGUUGGCGCAAUCGGUAGCGCGUAUGACUCUUAAUCAUAAGGUUAGGGGUUCGAGC
+..((((...((((........))))....(((((((((((....))))))))))))))). (-15.59 = -15.53 +  -0.06) 
+
+
+
+
+
+]]>
+
     </help>
+
+    <citations>
+        <citation type="doi">10.1142/9789814295291_0009</citation>
+    </citations>    
+    
 </tool>