# HG changeset patch # User bgruening # Date 1643404676 0 # Node ID 28aa54c800c046b2472b136c532d15653135d6e5 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/pharmcat commit c6a098eb0cbfa87b0feaebf10ef6b24da659fa54" diff -r 000000000000 -r 28aa54c800c0 pharmcat.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pharmcat.xml Fri Jan 28 21:17:56 2022 +0000 @@ -0,0 +1,218 @@ + + + Pharmacogenomics Clinical Annotation Tool + + + 1.3.1 + galaxy0 + + + pgkb/pharmcat:1.3.1 + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + function_select['function'] == "all" + + + function_select['function'] == "all" and function_select["phenojson"] + + + function_select['function'] == "all" and function_select["json"] + + + function_select['function'] == "name" + + + function_select['function'] == "name" + + + function_select['function'] == "pheno" + + + function_select['function'] == "report" + + + function_select['function'] == "report" + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + 10.1002/cpt.928 + + \ No newline at end of file diff -r 000000000000 -r 28aa54c800c0 test-data/test.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test.tsv Fri Jan 28 21:17:56 2022 +0000 @@ -0,0 +1,3 @@ +CYP2D6 *1/*3 +G6PD B (wildtype)/B (wildtype) +MT-RNR1 1555A>G diff -r 000000000000 -r 28aa54c800c0 test-data/test.vcf --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test.vcf Fri Jan 28 21:17:56 2022 +0000 @@ -0,0 +1,426 @@ +##fileformat=VCFv4.2 +##source=PharmCAT allele definitions +##fileDate=2021-10-06T01:19:28.8631026-07:00 +##contig= +##contig= +##contig= +##contig= +##contig= +##contig= +##contig= +##contig= +##contig= +##FILTER= +##INFO= +##INFO= +##FORMAT= +#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT PharmCAT +chr1 97078987 rs114096998 G T . PASS PX=DPYD GT 0/0 +chr1 97078993 rs148799944 C G . PASS PX=DPYD GT 0/0 +chr1 97079005 rs140114515 C T . PASS PX=DPYD GT 0/0 +chr1 97079071 rs1801268 C A . PASS PX=DPYD GT 0/0 +chr1 97079076 rs139459586 A C . PASS PX=DPYD GT 0/0 +chr1 97079077 rs202144771 G A . PASS PX=DPYD GT 0/0 +chr1 97079121 rs72547601 T C . PASS PX=DPYD GT 0/0 +chr1 97079133 rs72547602 T A . PASS PX=DPYD GT 0/0 +chr1 97079139 rs145529148 T C . PASS PX=DPYD GT 0/0 +chr1 97082365 rs141044036 T C . PASS PX=DPYD GT 0/0 +chr1 97082391 rs67376798 T A . PASS PX=DPYD GT 0/0 +chr1 97098598 rs1801267 C T . PASS PX=DPYD GT 0/0 +chr1 97098599 rs147545709 G A . PASS PX=DPYD GT 0/0 +chr1 97098616 rs55674432 C A . PASS PX=DPYD GT 0/0 +chr1 97098632 rs201035051 T G . PASS PX=DPYD GT 0/0 +chr1 97193109 rs60139309 T C . PASS PX=DPYD GT 0/0 +chr1 97193209 rs200687447 C T . PASS PX=DPYD GT 0/0 +chr1 97234958 rs199634007 G T . PASS PX=DPYD GT 0/0 +chr1 97234991 rs56005131 G T . PASS PX=DPYD GT 0/0 +chr1 97305279 rs112766203 G A . PASS PX=DPYD GT 0/0 +chr1 97305363 rs60511679 A C . PASS PX=DPYD GT 0/0 +chr1 97305364 rs1801160 C T . PASS PX=DPYD GT 0/0 +chr1 97305372 rs146529561 G A . PASS PX=DPYD GT 0/0 +chr1 97306195 rs145548112 C T . PASS PX=DPYD GT 0/0 +chr1 97373598 rs137999090 C T . PASS PX=DPYD GT 0/0 +chr1 97373629 rs138545885 C A . PASS PX=DPYD GT 0/0 +chr1 97382461 rs55971861 T G . PASS PX=DPYD GT 0/0 +chr1 97450058 rs3918290 C T . PASS PX=DPYD GT 0/0 +chr1 97450059 rs3918289 G C . PASS PX=DPYD GT 0/0 +chr1 97450065 rs72549303 TG T . PASS PX=DPYD GT 0/0 +chr1 97450068 rs17376848 A G . PASS PX=DPYD GT 0/0 +chr1 97450168 rs147601618 A G . PASS PX=DPYD GT 0/0 +chr1 97450187 rs145773863 C T . PASS PX=DPYD GT 0/0 +chr1 97450189 rs138616379 C T . PASS PX=DPYD GT 0/0 +chr1 97450190 rs59086055 G A . PASS PX=DPYD GT 0/0 +chr1 97515784 rs201615754 C A . PASS PX=DPYD GT 0/0 +chr1 97515787 rs55886062 A C . PASS PX=DPYD GT 0/0 +chr1 97515839 rs1801159 T C . PASS PX=DPYD GT 0/0 +chr1 97515851 rs142619737 C T . PASS PX=DPYD GT 0/0 +chr1 97515865 rs1801158 C T . PASS PX=DPYD GT 0/0 +chr1 97515889 rs190951787 G C . PASS PX=DPYD GT 0/0 +chr1 97515923 rs148994843 C T . PASS PX=DPYD GT 0/0 +chr1 97549565 rs138391898 C T . PASS PX=DPYD GT 0/0 +chr1 97549600 rs111858276 T C . PASS PX=DPYD GT 0/0 +chr1 97549609 rs72549304 G A . PASS PX=DPYD GT 0/0 +chr1 97549681 rs199549923 G T . PASS PX=DPYD GT 0/0 +chr1 97549713 rs57918000 G A . PASS PX=DPYD GT 0/0 +chr1 97549726 rs144395748 G C . PASS PX=DPYD GT 0/0 +chr1 97549735 rs72975710 G A . PASS PX=DPYD GT 0/0 +chr1 97573785 rs186169810 A C . PASS PX=DPYD GT 0/0 +chr1 97573805 rs142512579 C T . PASS PX=DPYD GT 0/0 +chr1 97573821 rs764666241 C A . PASS PX=DPYD GT 0/0 +chr1 97573839 rs200064537 A T . PASS PX=DPYD GT 0/0 +chr1 97573863 rs56038477 C T . PASS PX=DPYD GT 0/0 +chr1 97573881 rs61622928 C T . PASS PX=DPYD GT 0/0 +chr1 97573918 rs143815742 C A . PASS PX=DPYD GT 0/0 +chr1 97573919 rs140602333 G A . PASS PX=DPYD GT 0/0 +chr1 97573943 rs78060119 C A . PASS PX=DPYD GT 0/0 +chr1 97579893 rs75017182 G C . PASS PX=DPYD GT 0/0 +chr1 97593238 rs72549305 T C . PASS PX=DPYD GT 0/0 +chr1 97593289 rs143154602 G A . PASS PX=DPYD GT 0/0 +chr1 97593322 rs183385770 C T . PASS PX=DPYD GT 0/0 +chr1 97593343 rs72549306 C A . PASS PX=DPYD GT 0/0 +chr1 97593379 rs201018345 C T . PASS PX=DPYD GT 0/0 +chr1 97595083 rs145112791 G A . PASS PX=DPYD GT 0/0 +chr1 97595088 rs150437414 A G . PASS PX=DPYD GT 0/0 +chr1 97595149 rs146356975 T C . PASS PX=DPYD GT 0/0 +chr1 97679170 rs45589337 T C . PASS PX=DPYD GT 0/0 +chr1 97691776 rs1801266 G A . PASS PX=DPYD GT 0/0 +chr1 97699399 rs72549307 T C . PASS PX=DPYD GT 0/0 +chr1 97699430 rs72549308 T G . PASS PX=DPYD GT 0/0 +chr1 97699474 rs115232898 T C . PASS PX=DPYD GT 0/0 +chr1 97699506 rs6670886 C T . PASS PX=DPYD GT 0/0 +chr1 97699533 rs139834141 C T . PASS PX=DPYD GT 0/0 +chr1 97699535 rs2297595 T C . PASS PX=DPYD GT 0/0 +chr1 97721542 rs200562975 T C . PASS PX=DPYD GT 0/0 +chr1 97721650 rs141462178 T C . PASS PX=DPYD GT 0/0 +chr1 97740400 rs150385342 C T . PASS PX=DPYD GT 0/0 +chr1 97740410 rs72549309 GATGA G . PASS PX=DPYD GT 0/0 +chr1 97883329 rs1801265 A G . PASS PX=DPYD GT 0/0 +chr1 97883352 rs80081766 C T . PASS PX=DPYD GT 0/0 +chr1 97883353 rs72549310 G A . PASS PX=DPYD GT 0/0 +chr1 97883368 rs150036960 G C . PASS PX=DPYD GT 0/0 +chr1 201060815 rs1800559 C T . PASS PX=CACNA1S GT 0/0 +chr1 201091993 rs772226819 G A . PASS PX=CACNA1S GT 0/0 +chr2 233759924 rs887829 C T . PASS PX=UGT1A1 GT 0/0 +chr2 233760233 rs3064744 CAT C,CATAT,CATATAT . PASS PX=UGT1A1 GT 0/0 +chr2 233760498 rs4148323 G A . PASS PX=UGT1A1 GT 0/0 +chr2 233760973 rs35350960 C A . PASS PX=UGT1A1 GT 0/0 +chr6 18130687 rs1142345 T C,G . PASS PX=TPMT GT 0/0 +chr6 18130694 rs150900439 T C . PASS PX=TPMT GT 0/0 +chr6 18130725 rs72552736 A C . PASS PX=TPMT GT 0/0 +chr6 18130729 rs139392616 C T . PASS PX=TPMT GT 0/0 +chr6 18130758 rs398122996 A T . PASS PX=TPMT GT 0/0 +chr6 18130762 rs56161402 C T . PASS PX=TPMT GT 0/0 +chr6 18130772 rs377085266 A G . PASS PX=TPMT GT 0/0 +chr6 18130781 rs1800584 C T . PASS PX=TPMT GT 0/0 +chr6 18132136 rs72556347 A G . PASS PX=TPMT GT 0/0 +chr6 18132147 rs79901429 A G . PASS PX=TPMT GT 0/0 +chr6 18132163 . C T . PASS PX=TPMT GT 0/0 +chr6 18133845 rs75543815 T A . PASS PX=TPMT GT 0/0 +chr6 18133847 rs6921269 C A . PASS PX=TPMT GT 0/0 +chr6 18133870 rs772832951 A G . PASS PX=TPMT GT 0/0 +chr6 18133884 rs74423290 G C . PASS PX=TPMT GT 0/0 +chr6 18133887 rs201695576 T C . PASS PX=TPMT GT 0/0 +chr6 18133890 rs9333570 C T . PASS PX=TPMT GT 0/0 +chr6 18138969 rs144041067 C G,T . PASS PX=TPMT GT 0/0 +chr6 18138970 rs112339338 G A . PASS PX=TPMT GT 0/0 +chr6 18138997 rs1800460 C T . PASS PX=TPMT GT 0/0 +chr6 18139027 rs72552737 C G . PASS PX=TPMT GT 0/0 +chr6 18139689 rs72552738 C T . PASS PX=TPMT GT 0/0 +chr6 18139710 rs200220210 G A . PASS PX=TPMT GT 0/0 +chr6 18143597 . T G . PASS PX=TPMT GT 0/0 +chr6 18143606 rs151149760 T G . PASS PX=TPMT GT 0/0 +chr6 18143613 . C G . PASS PX=TPMT GT 0/0 +chr6 18143622 rs115106679 C T . PASS PX=TPMT GT 0/0 +chr6 18143643 . A C . PASS PX=TPMT GT 0/0 +chr6 18143700 rs753545734 C T . PASS PX=TPMT GT 0/0 +chr6 18143718 rs111901354 G A . PASS PX=TPMT GT 0/0 +chr6 18143724 rs1800462 C G . PASS PX=TPMT GT 0/0 +chr6 18143728 rs1256618794 C A . PASS PX=TPMT GT 0/0 +chr6 18147838 rs281874771 G A . PASS PX=TPMT GT 0/0 +chr6 18147845 rs777686348 C T . PASS PX=TPMT GT 0/0 +chr6 18147851 rs200591577 G C . PASS PX=TPMT GT 0/0 +chr6 18147856 . A G . PASS PX=TPMT GT 0/0 +chr6 18147910 rs72552740 A G . PASS PX=TPMT GT 0/0 +chr6 18149004 . G C . PASS PX=TPMT GT 0/0 +chr6 18149022 rs750424422 C T . PASS PX=TPMT GT 0/0 +chr6 18149032 rs759836180 C CT . PASS PX=TPMT GT 0/0 +chr6 18149045 rs72552742 T A . PASS PX=TPMT GT 0/0 +chr6 18149126 rs267607275 A G . PASS PX=TPMT GT 0/0 +chr6 18149127 rs9333569 T C . PASS PX=TPMT GT 0/0 +chr7 99652613 rs28365083 G T . PASS PX=CYP3A5 GT 0/0 +chr7 99652770 rs41303343 T TA . PASS PX=CYP3A5 GT 0/0 +chr7 99660516 rs28383479 C T . PASS PX=CYP3A5 GT 0/0 +chr7 99665212 rs10264272 C T . PASS PX=CYP3A5 GT 0/0 +chr7 99665237 rs56411402 T C . PASS PX=CYP3A5 GT 0/0 +chr7 99666950 rs55965422 A G . PASS PX=CYP3A5 GT 0/0 +chr7 99672916 rs776746 T C . PASS PX=CYP3A5 GT 0/0 +chr7 99676198 rs55817950 G A . PASS PX=CYP3A5 GT 0/0 +chr7 117509035 rs397508256 G A . PASS PX=CFTR GT 0/0 +chr7 117509069 rs368505753 C T . PASS PX=CFTR GT 0/0 +chr7 117509089 rs115545701 C T . PASS PX=CFTR GT 0/0 +chr7 117530953 rs113993958 G C . PASS PX=CFTR GT 0/0 +chr7 117530955 rs397508537 C A . PASS PX=CFTR GT 0/0 +chr7 117530974 rs77834169 C T . PASS PX=CFTR GT 0/0 +chr7 117530975 rs78655421 G A . PASS PX=CFTR GT 0/0 +chr7 117534318 rs80282562 G A . PASS PX=CFTR GT 0/0 +chr7 117534363 rs397508759 G A . PASS PX=CFTR GT 0/0 +chr7 117534368 rs397508761 A G . PASS PX=CFTR GT 0/0 +chr7 117535285 rs121908752 T G . PASS PX=CFTR GT 0/0 +chr7 117540270 rs77932196 G A . PASS PX=CFTR GT 0/0 +chr7 117540285 rs121908753 G A . PASS PX=CFTR GT 0/0 +chr7 117548795 rs74551128 C A . PASS PX=CFTR GT 0/0 +chr7 117587799 rs121908757 A C . PASS PX=CFTR GT 0/0 +chr7 117587800 rs121908755 G A . PASS PX=CFTR GT 0/0 +chr7 117587801 rs121909005 T G . PASS PX=CFTR GT 0/0 +chr7 117587805 rs121909013 G A . PASS PX=CFTR GT 0/0 +chr7 117587806 rs75527207 G A . PASS PX=CFTR GT 0/0 +chr7 117590409 rs397508288 A G . PASS PX=CFTR GT 0/0 +chr7 117594930 rs397508387 G T . PASS PX=CFTR GT 0/0 +chr7 117602868 rs80224560 G A . PASS PX=CFTR GT 0/0 +chr7 117603708 rs397508442 C T . PASS PX=CFTR GT 0/0 +chr7 117606695 rs141033578 C T . PASS PX=CFTR GT 0/0 +chr7 117611555 rs76151804 A G . PASS PX=CFTR GT 0/0 +chr7 117611595 rs150212784 T G . PASS PX=CFTR GT 0/0 +chr7 117611620 rs397508513 A C . PASS PX=CFTR GT 0/0 +chr7 117611640 rs121909020 G A . PASS PX=CFTR GT 0/0 +chr7 117611646 rs200321110 G A . PASS PX=CFTR GT 0/0 +chr7 117611649 rs202179988 C T . PASS PX=CFTR GT 0/0 +chr7 117611650 rs78769542 G A . PASS PX=CFTR GT 0/0 +chr7 117611663 rs186045772 T A . PASS PX=CFTR GT 0/0 +chr7 117614699 rs75541969 G C . PASS PX=CFTR GT 0/0 +chr7 117639961 rs75039782 C T . PASS PX=CFTR GT 0/0 +chr7 117642451 rs267606723 G A . PASS PX=CFTR GT 0/0 +chr7 117642472 rs74503330 G A . PASS PX=CFTR GT 0/0 +chr7 117642483 rs121909041 T C . PASS PX=CFTR GT 0/0 +chr7 117642528 rs11971167 G A . PASS PX=CFTR GT 0/0 +chr7 117664770 rs193922525 G A . PASS PX=CFTR GT 0/0 +chr10 94645745 rs12777823 G A . PASS POI GT 0/0 +chr10 94761900 rs12248560 C T . PASS PX=CYP2C19 GT 0/0 +chr10 94762706 rs28399504 A G . PASS PX=CYP2C19 GT 0/0 +chr10 94762712 rs367543002 C T . PASS PX=CYP2C19 GT 0/0 +chr10 94762715 rs367543003 T C . PASS PX=CYP2C19 GT 0/0 +chr10 94762755 rs55752064 T C . PASS PX=CYP2C19 GT 0/0 +chr10 94762760 rs17882687 A C . PASS PX=CYP2C19 GT 0/0 +chr10 94762788 rs1564656981 A T . PASS PX=CYP2C19 GT 0/0 +chr10 94762856 rs1564657013 A G . PASS PX=CYP2C19 GT 0/0 +chr10 94775106 rs145328984 C T . PASS PX=CYP2C19 GT 0/0 +chr10 94775121 rs1564660997 C T . PASS PX=CYP2C19 GT 0/0 +chr10 94775160 rs118203756 G C . PASS PX=CYP2C19 GT 0/0 +chr10 94775185 rs1288601658 A G . PASS PX=CYP2C19 GT 0/0 +chr10 94775367 rs12769205 A G . PASS PX=CYP2C19 GT 0/0 +chr10 94775416 rs41291556 T C . PASS PX=CYP2C19 GT 0/0 +chr10 94775423 rs17885179 A C . PASS PX=CYP2C19 GT 0/0 +chr10 94775453 rs72552267 G A . PASS PX=CYP2C19 GT 0/0 +chr10 94775489 rs17884712 G A . PASS PX=CYP2C19 GT 0/0 +chr10 94775507 rs58973490 G A . PASS PX=CYP2C19 GT 0/0 +chr10 94780574 rs140278421 G C . PASS PX=CYP2C19 GT 0/0 +chr10 94780579 rs370803989 G A . PASS PX=CYP2C19 GT 0/0 +chr10 94780653 rs4986893 G A . PASS PX=CYP2C19 GT 0/0 +chr10 94781858 rs6413438 C T . PASS PX=CYP2C19 GT 0/0 +chr10 94781859 rs4244285 G A . PASS PX=CYP2C19 GT 0/0 +chr10 94781944 rs375781227 G A . PASS PX=CYP2C19 GT 0/0 +chr10 94781999 rs72558186 T A . PASS PX=CYP2C19 GT 0/0 +chr10 94842861 rs138142612 G A . PASS PX=CYP2C19 GT 0/0 +chr10 94842866 rs3758581 A G . PASS PX=CYP2C19 GT 0/0 +chr10 94842879 rs118203757 G A . PASS PX=CYP2C19 GT 0/0 +chr10 94842995 rs113934938 G A . PASS PX=CYP2C19 GT 0/0 +chr10 94849995 rs17879685 C T . PASS PX=CYP2C19 GT 0/0 +chr10 94852738 rs56337013 C T . PASS PX=CYP2C19 GT 0/0 +chr10 94852765 rs192154563 C T . PASS PX=CYP2C19 GT 0/0 +chr10 94852785 rs118203759 C G . PASS PX=CYP2C19 GT 0/0 +chr10 94852914 rs55640102 A C . PASS PX=CYP2C19 GT 0/0 +chr10 94938683 rs114071557 A G . PASS PX=CYP2C9 GT 0/0 +chr10 94938737 rs67807361 C A . PASS PX=CYP2C9 GT 0/0 +chr10 94938771 rs142240658 C T . PASS PX=CYP2C9 GT 0/0 +chr10 94938803 rs2031308986 A G . PASS PX=CYP2C9 GT 0/0 +chr10 94938828 rs564813580 A G . PASS PX=CYP2C9 GT 0/0 +chr10 94941897 rs371055887 G C . PASS PX=CYP2C9 GT 0/0 +chr10 94941915 . G A . PASS PX=CYP2C9 GT 0/0 +chr10 94941958 rs72558187 T C . PASS PX=CYP2C9 GT 0/0 +chr10 94941976 . G C . PASS PX=CYP2C9 GT 0/0 +chr10 94941982 rs762239445 G T . PASS PX=CYP2C9 GT 0/0 +chr10 94942018 . T C . PASS PX=CYP2C9 GT 0/0 +chr10 94942205 rs1304490498 CAATGGAAAGA C . PASS PX=CYP2C9 GT 0/0 +chr10 94942216 rs774607211 A G . PASS PX=CYP2C9 GT 0/0 +chr10 94942230 rs767576260 C T . PASS PX=CYP2C9 GT 0/0 +chr10 94942231 rs12414460 G A . PASS PX=CYP2C9 GT 0/0 +chr10 94942233 rs375805362 C T . PASS PX=CYP2C9 GT 0/0 +chr10 94942234 rs72558189 G A,T . PASS PX=CYP2C9 GT 0/0 +chr10 94942249 rs200965026 C G,T . PASS PX=CYP2C9 GT 0/0 +chr10 94942254 rs199523631 C T . PASS PX=CYP2C9 GT 0/0 +chr10 94942255 rs200183364 G A . PASS PX=CYP2C9 GT 0/0 +chr10 94942290 rs1799853 C T . PASS PX=CYP2C9 GT 0/0 +chr10 94942291 rs141489852 G A . PASS PX=CYP2C9 GT 0/0 +chr10 94942305 rs754487195 G A . PASS PX=CYP2C9 GT 0/0 +chr10 94942309 rs7900194 G A,T . PASS PX=CYP2C9 GT 0/0 +chr10 94947782 rs72558190 C A . PASS PX=CYP2C9 GT 0/0 +chr10 94947785 rs774550549 C T . PASS PX=CYP2C9 GT 0/0 +chr10 94947869 . A G . PASS PX=CYP2C9 GT 0/0 +chr10 94947907 . A C . PASS PX=CYP2C9 GT 0/0 +chr10 94947917 rs1326630788 T C . PASS PX=CYP2C9 GT 0/0 +chr10 94947938 rs2031531005 A T . PASS PX=CYP2C9 GT 0/0 +chr10 94949129 . A G . PASS PX=CYP2C9 GT 0/0 +chr10 94949144 . C T . PASS PX=CYP2C9 GT 0/0 +chr10 94949217 rs2256871 A G . PASS PX=CYP2C9 GT 0/0 +chr10 94949280 rs9332130 A G . PASS PX=CYP2C9 GT 0/0 +chr10 94949281 rs9332131 GA G . PASS PX=CYP2C9 GT 0/0 +chr10 94972119 rs182132442 C A . PASS PX=CYP2C9 GT 0/0 +chr10 94972123 . C G . PASS PX=CYP2C9 GT 0/0 +chr10 94972134 . A G . PASS PX=CYP2C9 GT 0/0 +chr10 94972179 rs72558192 A G . PASS PX=CYP2C9 GT 0/0 +chr10 94972180 rs988617574 C G . PASS PX=CYP2C9 GT 0/0 +chr10 94972233 rs1237225311 C T . PASS PX=CYP2C9 GT 0/0 +chr10 94981199 . G T . PASS PX=CYP2C9 GT 0/0 +chr10 94981201 rs57505750 T C . PASS PX=CYP2C9 GT 0/0 +chr10 94981224 rs28371685 C T . PASS PX=CYP2C9 GT 0/0 +chr10 94981225 rs367826293 G A . PASS PX=CYP2C9 GT 0/0 +chr10 94981230 rs1274535931 C A . PASS PX=CYP2C9 GT 0/0 +chr10 94981250 rs750820937 C A . PASS PX=CYP2C9 GT 0/0 +chr10 94981281 rs749060448 G A . PASS PX=CYP2C9 GT 0/0 +chr10 94981296 rs1057910 A C . PASS PX=CYP2C9 GT 0/0 +chr10 94981297 rs56165452 T C . PASS PX=CYP2C9 GT 0/0 +chr10 94981301 rs28371686 C G . PASS PX=CYP2C9 GT 0/0 +chr10 94981302 rs1250577724 C A . PASS PX=CYP2C9 GT 0/0 +chr10 94981305 rs578144976 C G . PASS PX=CYP2C9 GT 0/0 +chr10 94981365 . C T . PASS PX=CYP2C9 GT 0/0 +chr10 94981371 rs542577750 G A . PASS PX=CYP2C9 GT 0/0 +chr10 94986042 rs764211126 A G . PASS PX=CYP2C9 GT 0/0 +chr10 94986073 rs72558193 A C . PASS PX=CYP2C9 GT 0/0 +chr10 94988852 rs776908257 C T . PASS PX=CYP2C9 GT 0/0 +chr10 94988855 . A T . PASS PX=CYP2C9 GT 0/0 +chr10 94988880 . G T . PASS PX=CYP2C9 GT 0/0 +chr10 94988917 rs769942899 G C . PASS PX=CYP2C9 GT 0/0 +chr10 94988925 rs202201137 A G . PASS PX=CYP2C9 GT 0/0 +chr10 94988955 rs767284820 T C . PASS PX=CYP2C9 GT 0/0 +chr10 94988984 rs781583846 G A . PASS PX=CYP2C9 GT 0/0 +chr10 94989020 rs9332239 C T . PASS PX=CYP2C9 GT 0/0 +chr10 94989023 rs868182778 G T . PASS PX=CYP2C9 GT 0/0 +chr12 21130388 rs4149015 G A . PASS PX=SLCO1B1 GT 0/0 +chr12 21172734 rs139257324 C T . PASS PX=SLCO1B1 GT 0/0 +chr12 21172776 rs373327528 G A . PASS PX=SLCO1B1 GT 0/0 +chr12 21172782 rs56101265 T C . PASS PX=SLCO1B1 GT 0/0 +chr12 21174595 rs56061388 T C . PASS PX=SLCO1B1 GT 0/0 +chr12 21176804 rs2306283 A G . PASS PX=SLCO1B1 GT 0/0 +chr12 21176827 rs11045818 G A . PASS PX=SLCO1B1 GT 0/0 +chr12 21176868 rs2306282 A G . PASS PX=SLCO1B1 GT 0/0 +chr12 21176879 rs11045819 C A . PASS PX=SLCO1B1 GT 0/0 +chr12 21176883 rs72559745 A G . PASS PX=SLCO1B1 GT 0/0 +chr12 21178615 rs4149056 T C . PASS PX=SLCO1B1 GT 0/0 +chr12 21178665 rs4149057 T C . PASS PX=SLCO1B1 GT 0/0 +chr12 21178672 rs72559746 T G . PASS PX=SLCO1B1 GT 0/0 +chr12 21178691 rs2291075 C T . PASS PX=SLCO1B1 GT 0/0 +chr12 21178957 rs79135870 A G . PASS PX=SLCO1B1 GT 0/0 +chr12 21196951 rs11045852 A G . PASS PX=SLCO1B1 GT 0/0 +chr12 21196976 rs11045853 G A . PASS PX=SLCO1B1 GT 0/0 +chr12 21200595 rs55901008 T C . PASS PX=SLCO1B1 GT 0/0 +chr12 21202553 . T G . PASS PX=SLCO1B1 GT 0/0 +chr12 21202555 rs59113707 C G . PASS PX=SLCO1B1 GT 0/0 +chr12 21202649 rs56387224 A G . PASS PX=SLCO1B1 GT 0/0 +chr12 21202664 rs142965323 G A . PASS PX=SLCO1B1 GT 0/0 +chr12 21205921 rs72559748 A G . PASS PX=SLCO1B1 GT 0/0 +chr12 21205999 rs59502379 G C . PASS PX=SLCO1B1 GT 0/0 +chr12 21239042 rs34671512 A C . PASS PX=SLCO1B1 GT 0/0 +chr12 21239077 rs56199088 A G . PASS PX=SLCO1B1 GT 0/0 +chr12 21239113 rs55737008 A G . PASS PX=SLCO1B1 GT 0/0 +chr12 21239145 rs200995543 C T . PASS PX=SLCO1B1 GT 0/0 +chr12 21239158 rs140790673 C T . PASS PX=SLCO1B1 GT 0/0 +chr13 48037748 rs769369441 T C . PASS PX=NUDT15 GT 0/0 +chr13 48037749 . G C . PASS PX=NUDT15 GT 0/0 +chr13 48037782 rs746071566 AGGAGTC A,AGGAGTCGGAGTC . PASS PX=NUDT15 GT 0/0 +chr13 48037798 rs186364861 G A . PASS PX=NUDT15 GT 0/0 +chr13 48037825 rs777311140 C CGCGG . PASS PX=NUDT15 GT 0/0 +chr13 48037834 rs1202487323 C T . PASS PX=NUDT15 GT 0/0 +chr13 48037847 rs766023281 G C . PASS PX=NUDT15 GT 0/0 +chr13 48037849 . A G . PASS PX=NUDT15 GT 0/0 +chr13 48037885 rs1950545307 G A . PASS PX=NUDT15 GT 0/0 +chr13 48037902 rs149436418 C G . PASS PX=NUDT15 GT 0/0 +chr13 48040977 rs1457579126 GA G . PASS PX=NUDT15 GT 0/0 +chr13 48041103 rs761191455 T TG . PASS PX=NUDT15 GT 0/0 +chr13 48041113 rs1368252918 G T . PASS PX=NUDT15 GT 0/0 +chr13 48045690 rs768324690 C G . PASS PX=NUDT15 GT 0/0 +chr13 48045719 rs116855232 C T . PASS PX=NUDT15 GT 0/0 +chr13 48045720 rs147390019 G A . PASS PX=NUDT15 GT 0/0 +chr13 48045771 rs139551410 T A . PASS PX=NUDT15 GT 0/0 +chr16 31096368 rs9923231 C T . PASS PX=VKORC1 GT 0/0 +chr19 15879621 rs2108622 C T . PASS PX=CYP4F2 GT 0/0 +chr19 15897578 rs3093105 A C . PASS PX=CYP4F2 GT 0/0 +chr19 38440802 rs193922747 T C . PASS PX=RYR1 GT 0/0 +chr19 38440829 rs193922748 C T . PASS PX=RYR1 GT 0/0 +chr19 38444211 rs118192161 C T . PASS PX=RYR1 GT 0/0 +chr19 38444212 rs193922753 G T . PASS PX=RYR1 GT 0/0 +chr19 38446710 rs1801086 G A,C . PASS PX=RYR1 GT 0/0 +chr19 38448673 rs193922762 C T . PASS PX=RYR1 GT 0/0 +chr19 38448712 rs121918592 G A,C . PASS PX=RYR1 GT 0/0 +chr19 38451842 rs193922764 C T . PASS PX=RYR1 GT 0/0 +chr19 38451850 rs118192116 C G . PASS PX=RYR1 GT 0/0 +chr19 38455359 rs118192162 A C . PASS PX=RYR1 GT 0/0 +chr19 38455463 rs111888148 G A . PASS PX=RYR1 GT 0/0 +chr19 38455471 rs193922768 C T . PASS PX=RYR1 GT 0/0 +chr19 38455472 rs144336148 G A . PASS PX=RYR1 GT 0/0 +chr19 38455528 rs193922770 C T . PASS PX=RYR1 GT 0/0 +chr19 38457545 rs118192172 C T . PASS PX=RYR1 GT 0/0 +chr19 38457546 rs193922772 G T . PASS PX=RYR1 GT 0/0 +chr19 38494564 rs118192175 C T . PASS PX=RYR1 GT 0/0 +chr19 38494565 rs118192163 G A . PASS PX=RYR1 GT 0/0 +chr19 38494579 rs118192176 G A . PASS PX=RYR1 GT 0/0 +chr19 38496283 rs118192177 C G,T . PASS PX=RYR1 GT 0/0 +chr19 38499223 rs112563513 G A . PASS PX=RYR1 GT 0/0 +chr19 38499644 rs121918596 TGGA T . PASS PX=RYR1 GT 0/0 +chr19 38499655 rs193922802 G A . PASS PX=RYR1 GT 0/0 +chr19 38499670 rs193922803 C T . PASS PX=RYR1 GT 0/0 +chr19 38499731 rs193922807 G C . PASS PX=RYR1 GT 0/0 +chr19 38499975 rs193922809 G A . PASS PX=RYR1 GT 0/0 +chr19 38499993 rs121918593 G A . PASS PX=RYR1 GT 0/0 +chr19 38499997 rs28933396 G A . PASS PX=RYR1 GT 0/0 +chr19 38500636 rs118192124 C T . PASS PX=RYR1 GT 0/0 +chr19 38500642 rs193922816 C T . PASS PX=RYR1 GT 0/0 +chr19 38500643 rs118192122 G A . PASS PX=RYR1 GT 0/0 +chr19 38500654 rs28933397 C T . PASS PX=RYR1 GT 0/0 +chr19 38500655 rs121918594 G A . PASS PX=RYR1 GT 0/0 +chr19 38500898 rs118192178 C G,T . PASS PX=RYR1 GT 0/0 +chr19 38500899 rs193922818 G A . PASS PX=RYR1 GT 0/0 +chr19 38512321 rs193922832 G A . PASS PX=RYR1 GT 0/0 +chr19 38543832 rs193922843 G T . PASS PX=RYR1 GT 0/0 +chr19 38580004 rs118192167 A G . PASS PX=RYR1 GT 0/0 +chr19 38580094 rs121918595 C T . PASS PX=RYR1 GT 0/0 +chr19 38580114 rs193922876 C T . PASS PX=RYR1 GT 0/0 +chr19 38580370 rs193922878 C G . PASS PX=RYR1 GT 0/0 +chr19 38580403 rs118192168 G A . PASS PX=RYR1 GT 0/0 +chr19 38580440 rs63749869 G A . PASS PX=RYR1 GT 0/0 +chr19 38584989 rs118192170 T C . PASS PX=RYR1 GT 0/0 +chr19 39248147 rs12979860 C T . PASS PX=IFNL3 GT 0/0 +chr19 40991224 rs34223104 T C . PASS PX=CYP2B6 GT 0/0 +chr19 40991367 rs34883432 A T . PASS PX=CYP2B6 GT 0/0 +chr19 40991369 rs8192709 C T . PASS PX=CYP2B6 GT 0/0 +chr19 40991381 rs33973337 A T . PASS PX=CYP2B6 GT 0/0 +chr19 40991388 rs33980385 A G . PASS PX=CYP2B6 GT 0/0 +chr19 40991390 rs33926104 C A . PASS PX=CYP2B6 GT 0/0 +chr19 40991391 rs34284776 G C . PASS PX=CYP2B6 GT 0/0 +chr19 40991441 rs35303484 A G . PASS PX=CYP2B6 GT 0/0 +chr19 41004015 rs281864907 T A . PASS PX=CYP2B6 GT 0/0 +chr19 41004125 rs36060847 G A . PASS PX=CYP2B6 GT 0/0 +chr19 41004158 rs186335453 G T . PASS PX=CYP2B6 GT 0/0 +chr19 41004303 rs139801276 T C . PASS PX=CYP2B6 GT 0/0 +chr19 41004377 rs12721655 A G . PASS PX=CYP2B6 GT 0/0 +chr19 41004381 rs35773040 G A . PASS PX=CYP2B6 GT 0/0 +chr19 41004406 rs145884402 G T . PASS PX=CYP2B6 GT 0/0 +chr19 41006919 rs3826711 C G . PASS PX=CYP2B6 GT 0/0 +chr19 41006923 rs36056539 C T . PASS PX=CYP2B6 GT 0/0 +chr19 41006936 rs3745274 G T . PASS PX=CYP2B6 GT 0/0 +chr19 41006968 rs373489637 T G . PASS PX=CYP2B6 GT 0/0 +chr19 41007013 rs36079186 T C . PASS PX=CYP2B6 GT 0/0 +chr19 41009350 rs45482602 C A . PASS PX=CYP2B6 GT 0/0 +chr19 41009358 rs2279343 A G . PASS PX=CYP2B6 GT 0/0 +chr19 41010006 rs139029625 G C . PASS PX=CYP2B6 GT 0/0 +chr19 41010088 rs34698757 C G . PASS PX=CYP2B6 GT 0/0 +chr19 41010108 rs193922917 C A . PASS PX=CYP2B6 GT 0/0 +chr19 41012316 rs28399499 T C . PASS PX=CYP2B6 GT 0/0 +chr19 41012339 rs34826503 C T . PASS PX=CYP2B6 GT 0/0 +chr19 41012465 rs34097093 C T . PASS PX=CYP2B6 GT 0/0 +chr19 41012693 rs35979566 T A . PASS PX=CYP2B6 GT 0/0 +chr19 41012740 rs193922918 G A . PASS PX=CYP2B6 GT 0/0 +chr19 41012803 rs35010098 C A . PASS PX=CYP2B6 GT 0/0 +chr19 41016726 rs3211369 A G . PASS PX=CYP2B6 GT 0/0 +chr19 41016778 rs564083989 G A . PASS PX=CYP2B6 GT 0/0 +chr19 41016805 . A T . PASS PX=CYP2B6 GT 0/0 +chr19 41016810 rs3211371 C A,T . PASS PX=CYP2B6 GT 0/0 diff -r 000000000000 -r 28aa54c800c0 test-data/test_1.pheno.json --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_1.pheno.json Fri Jan 28 21:17:56 2022 +0000 @@ -0,0 +1,6974 @@ +[ + { + "geneSymbol": "CACNA1S", + "chr": "chr1", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [], + "relatedDrugs": [ + { + "name": "desflurane", + "guidelineId": "RxNorm:27340" + }, + { + "name": "enflurane", + "guidelineId": "RxNorm:3920" + }, + { + "name": "halothane", + "guidelineId": "RxNorm:5095" + }, + { + "name": "isoflurane", + "guidelineId": "RxNorm:6026" + }, + { + "name": "methoxyflurane", + "guidelineId": "RxNorm:6857" + }, + { + "name": "sevoflurane", + "guidelineId": "RxNorm:36453" + }, + { + "name": "succinylcholine", + "guidelineId": "RxNorm:10154" + } + ], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "CACNA1S", + "name": "Reference", + "function": "Normal Function", + "reference": true + }, + "allele2": { + "gene": "CACNA1S", + "name": "Reference", + "function": "Normal Function", + "reference": true + }, + "gene": "CACNA1S", + "phenotype": "Uncertain Susceptibility", + "variant": null, + "lookupKey": "Uncertain Susceptibility", + "label": "Reference/Reference" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "CACNA1S", + "name": "Reference", + "function": "Normal Function", + "reference": true + }, + "allele2": { + "gene": "CACNA1S", + "name": "Reference", + "function": "Normal Function", + "reference": true + }, + "gene": "CACNA1S", + "phenotype": "Uncertain Susceptibility", + "variant": null, + "lookupKey": "Uncertain Susceptibility", + "label": "Reference/Reference" + } + ], + "variants": [ + { + "gene": "CACNA1S", + "chromosome": "chr1", + "position": 201060815, + "dbSnpId": "rs1800559", + "call": "C|C", + "alleles": [ + "c.3257G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CACNA1S", + "chromosome": "chr1", + "position": 201091993, + "dbSnpId": "rs772226819", + "call": "G|G", + "alleles": [ + "c.520C\u003eT" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "CFTR", + "chr": "chr7", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [], + "relatedDrugs": [ + { + "name": "ivacaftor", + "guidelineId": "RxNorm:1243041" + } + ], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "CFTR", + "name": "ivacaftor non-responsive CFTR sequence", + "function": "ivacaftor non-responsive", + "reference": true + }, + "allele2": { + "gene": "CFTR", + "name": "ivacaftor non-responsive CFTR sequence", + "function": "ivacaftor non-responsive", + "reference": true + }, + "gene": "CFTR", + "phenotype": "ivacaftor non-responsive in CF patients", + "variant": null, + "lookupKey": "ivacaftor non-responsive in CF patients", + "label": "No CPIC variants found" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "CFTR", + "name": "ivacaftor non-responsive CFTR sequence", + "function": "ivacaftor non-responsive", + "reference": true + }, + "allele2": { + "gene": "CFTR", + "name": "ivacaftor non-responsive CFTR sequence", + "function": "ivacaftor non-responsive", + "reference": true + }, + "gene": "CFTR", + "phenotype": "ivacaftor non-responsive in CF patients", + "variant": null, + "lookupKey": "ivacaftor non-responsive in CF patients", + "label": "No CPIC variants found" + } + ], + "variants": [ + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117509035, + "dbSnpId": "rs397508256", + "call": "G|G", + "alleles": [ + "E56K" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117509069, + "dbSnpId": "rs368505753", + "call": "C|C", + "alleles": [ + "P67L" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117509089, + "dbSnpId": "rs115545701", + "call": "C|C", + "alleles": [ + "R74W" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117530953, + "dbSnpId": "rs113993958", + "call": "G|G", + "alleles": [ + "D110H" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117530955, + "dbSnpId": "rs397508537", + "call": "C|C", + "alleles": [ + "D110E" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117530974, + "dbSnpId": "rs77834169", + "call": "C|C", + "alleles": [ + "R117C" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117530975, + "dbSnpId": "rs78655421", + "call": "G|G", + "alleles": [ + "R117H" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117534318, + "dbSnpId": "rs80282562", + "call": "G|G", + "alleles": [ + "G178R" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117534363, + "dbSnpId": "rs397508759", + "call": "G|G", + "alleles": [ + "E193K" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117534368, + "dbSnpId": "rs397508761", + "call": "A|A", + "alleles": [ + "711+3A-\u003eG" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117535285, + "dbSnpId": "rs121908752", + "call": "T|T", + "alleles": [ + "L206W" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117540270, + "dbSnpId": "rs77932196", + "call": "G|G", + "alleles": [ + "R347H" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117540285, + "dbSnpId": "rs121908753", + "call": "G|G", + "alleles": [ + "R352Q" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117548795, + "dbSnpId": "rs74551128", + "call": "C|C", + "alleles": [ + "A455E" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117587799, + "dbSnpId": "rs121908757", + "call": "A|A", + "alleles": [ + "S549R(A\u003eC)" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117587800, + "dbSnpId": "rs121908755", + "call": "G|G", + "alleles": [ + "S549N" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117587801, + "dbSnpId": "rs121909005", + "call": "T|T", + "alleles": [ + "S549R(T\u003eG)" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117587805, + "dbSnpId": "rs121909013", + "call": "G|G", + "alleles": [ + "G551S" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117587806, + "dbSnpId": "rs75527207", + "call": "G|G", + "alleles": [ + "G551D" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117590409, + "dbSnpId": "rs397508288", + "call": "A|A", + "alleles": [ + "D579G" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117594930, + "dbSnpId": "rs397508387", + "call": "G|G", + "alleles": [ + "E831X" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117602868, + "dbSnpId": "rs80224560", + "call": "G|G", + "alleles": [ + "2789+5G-\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117603708, + "dbSnpId": "rs397508442", + "call": "C|C", + "alleles": [ + "S945L" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117606695, + "dbSnpId": "rs141033578", + "call": "C|C", + "alleles": [ + "S977F" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117611555, + "dbSnpId": "rs76151804", + "call": "A|A", + "alleles": [ + "3272-26A-\u003eG" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117611595, + "dbSnpId": "rs150212784", + "call": "T|T", + "alleles": [ + "F1052V" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117611620, + "dbSnpId": "rs397508513", + "call": "A|A", + "alleles": [ + "K1060T" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117611640, + "dbSnpId": "rs121909020", + "call": "G|G", + "alleles": [ + "A1067T" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117611646, + "dbSnpId": "rs200321110", + "call": "G|G", + "alleles": [ + "G1069R" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117611649, + "dbSnpId": "rs202179988", + "call": "C|C", + "alleles": [ + "R1070W" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117611650, + "dbSnpId": "rs78769542", + "call": "G|G", + "alleles": [ + "R1070Q" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117611663, + "dbSnpId": "rs186045772", + "call": "T|T", + "alleles": [ + "F1074L" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117614699, + "dbSnpId": "rs75541969", + "call": "G|G", + "alleles": [ + "D1152H" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117639961, + "dbSnpId": "rs75039782", + "call": "C|C", + "alleles": [ + "3849+10kbC-\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117642451, + "dbSnpId": "rs267606723", + "call": "G|G", + "alleles": [ + "G1244E" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117642472, + "dbSnpId": "rs74503330", + "call": "G|G", + "alleles": [ + "S1251N" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117642483, + "dbSnpId": "rs121909041", + "call": "T|T", + "alleles": [ + "S1255P" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117642528, + "dbSnpId": "rs11971167", + "call": "G|G", + "alleles": [ + "D1270N" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117664770, + "dbSnpId": "rs193922525", + "call": "G|G", + "alleles": [ + "G1349D" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "CYP2B6", + "chr": "chr19", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [], + "relatedDrugs": [ + { + "name": "efavirenz", + "guidelineId": "RxNorm:195085" + } + ], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "CYP2B6", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "CYP2B6", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "gene": "CYP2B6", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*1/*1" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "CYP2B6", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "CYP2B6", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "gene": "CYP2B6", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*1/*1" + } + ], + "variants": [ + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 40991224, + "dbSnpId": "rs34223104", + "call": "T|T", + "alleles": [ + "*22", + "*34", + "*35", + "*36" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 40991367, + "dbSnpId": "rs34883432", + "call": "A|A", + "alleles": [ + "*10" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 40991369, + "dbSnpId": "rs8192709", + "call": "C|C", + "alleles": [ + "*2", + "*10" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 40991381, + "dbSnpId": "rs33973337", + "call": "A|A", + "alleles": [ + "*17" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 40991388, + "dbSnpId": "rs33980385", + "call": "A|A", + "alleles": [ + "*17" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 40991390, + "dbSnpId": "rs33926104", + "call": "C|C", + "alleles": [ + "*17" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 40991391, + "dbSnpId": "rs34284776", + "call": "G|G", + "alleles": [ + "*17" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 40991441, + "dbSnpId": "rs35303484", + "call": "A|A", + "alleles": [ + "*11" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41004015, + "dbSnpId": "rs281864907", + "call": "T|T", + "alleles": [ + "*38" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41004125, + "dbSnpId": "rs36060847", + "call": "G|G", + "alleles": [ + "*12" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41004158, + "dbSnpId": "rs186335453", + "call": "G|G", + "alleles": [ + "*35" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41004303, + "dbSnpId": "rs139801276", + "call": "T|T", + "alleles": [ + "*35" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41004377, + "dbSnpId": "rs12721655", + "call": "A|A", + "alleles": [ + "*8", + "*13" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41004381, + "dbSnpId": "rs35773040", + "call": "G|G", + "alleles": [ + "*14" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41004406, + "dbSnpId": "rs145884402", + "call": "G|G", + "alleles": [ + "*35" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41006919, + "dbSnpId": "rs3826711", + "call": "C|C", + "alleles": [ + "*26" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41006923, + "dbSnpId": "rs36056539", + "call": "C|C", + "alleles": [ + "*20" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41006936, + "dbSnpId": "rs3745274", + "call": "G|G", + "alleles": [ + "*6", + "*7", + "*9", + "*13", + "*19", + "*20", + "*26", + "*34", + "*36", + "*37", + "*38" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41006968, + "dbSnpId": "rs373489637", + "call": "T|T", + "alleles": [ + "*37" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41007013, + "dbSnpId": "rs36079186", + "call": "T|T", + "alleles": [ + "*27", + "*35" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41009350, + "dbSnpId": "rs45482602", + "call": "C|C", + "alleles": [ + "*3" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41009358, + "dbSnpId": "rs2279343", + "call": "A|A", + "alleles": [ + "*4", + "*6", + "*7", + "*13", + "*18", + "*19", + "*20", + "*26", + "*34", + "*36", + "*37", + "*38" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41010006, + "dbSnpId": "rs139029625", + "call": "G|G", + "alleles": [ + "*35" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41010088, + "dbSnpId": "rs34698757", + "call": "C|C", + "alleles": [ + "*28" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41010108, + "dbSnpId": "rs193922917", + "call": "C|C", + "alleles": [ + "*31" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41012316, + "dbSnpId": "rs28399499", + "call": "T|T", + "alleles": [ + "*18" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41012339, + "dbSnpId": "rs34826503", + "call": "C|C", + "alleles": [ + "*19" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41012465, + "dbSnpId": "rs34097093", + "call": "C|C", + "alleles": [ + "*28" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41012693, + "dbSnpId": "rs35979566", + "call": "T|T", + "alleles": [ + "*15" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41012740, + "dbSnpId": "rs193922918", + "call": "G|G", + "alleles": [ + "*32" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41012803, + "dbSnpId": "rs35010098", + "call": "C|C", + "alleles": [ + "*21" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41016726, + "dbSnpId": "rs3211369", + "call": "A|A", + "alleles": [ + "*23" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41016778, + "dbSnpId": "rs564083989", + "call": "G|G", + "alleles": [ + "*24" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41016805, + "dbSnpId": null, + "call": "A|A", + "alleles": [ + "*25" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41016810, + "dbSnpId": "rs3211371", + "call": "C|C", + "alleles": [ + "*5", + "*7", + "*33", + "*34" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "CYP2C19", + "chr": "chr10", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [], + "relatedDrugs": [ + { + "name": "amitriptyline", + "guidelineId": "RxNorm:704" + }, + { + "name": "citalopram", + "guidelineId": "RxNorm:2556" + }, + { + "name": "clomipramine", + "guidelineId": "RxNorm:2597" + }, + { + "name": "clopidogrel", + "guidelineId": "RxNorm:32968" + }, + { + "name": "dexlansoprazole", + "guidelineId": "RxNorm:816346" + }, + { + "name": "doxepin", + "guidelineId": "RxNorm:3638" + }, + { + "name": "escitalopram", + "guidelineId": "RxNorm:321988" + }, + { + "name": "imipramine", + "guidelineId": "RxNorm:5691" + }, + { + "name": "lansoprazole", + "guidelineId": "RxNorm:17128" + }, + { + "name": "omeprazole", + "guidelineId": "RxNorm:7646" + }, + { + "name": "pantoprazole", + "guidelineId": "RxNorm:40790" + }, + { + "name": "sertraline", + "guidelineId": "RxNorm:36437" + }, + { + "name": "trimipramine", + "guidelineId": "RxNorm:10834" + }, + { + "name": "voriconazole", + "guidelineId": "RxNorm:121243" + } + ], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "CYP2C19", + "name": "*38", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "CYP2C19", + "name": "*38", + "function": "Normal function", + "reference": true + }, + "gene": "CYP2C19", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*38/*38" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "CYP2C19", + "name": "*38", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "CYP2C19", + "name": "*38", + "function": "Normal function", + "reference": true + }, + "gene": "CYP2C19", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*38/*38" + } + ], + "variants": [ + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94761900, + "dbSnpId": "rs12248560", + "call": "C|C", + "alleles": [ + "*4", + "*17" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94762706, + "dbSnpId": "rs28399504", + "call": "A|A", + "alleles": [ + "*4" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94762712, + "dbSnpId": "rs367543002", + "call": "C|C", + "alleles": [ + "*34" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94762715, + "dbSnpId": "rs367543003", + "call": "T|T", + "alleles": [ + "*34" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94762755, + "dbSnpId": "rs55752064", + "call": "T|T", + "alleles": [ + "*14" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94762760, + "dbSnpId": "rs17882687", + "call": "A|A", + "alleles": [ + "*15", + "*28", + "*35", + "*39" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94762788, + "dbSnpId": "rs1564656981", + "call": "A|A", + "alleles": [ + "*29" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94762856, + "dbSnpId": "rs1564657013", + "call": "A|A", + "alleles": [ + "*19" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94775106, + "dbSnpId": "rs145328984", + "call": "C|C", + "alleles": [ + "*30" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94775121, + "dbSnpId": "rs1564660997", + "call": "C|C", + "alleles": [ + "*31" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94775160, + "dbSnpId": "rs118203756", + "call": "G|G", + "alleles": [ + "*23" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94775185, + "dbSnpId": "rs1288601658", + "call": "A|A", + "alleles": [ + "*32" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94775367, + "dbSnpId": "rs12769205", + "call": "A|A", + "alleles": [ + "*2", + "*35" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94775416, + "dbSnpId": "rs41291556", + "call": "T|T", + "alleles": [ + "*8" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94775423, + "dbSnpId": "rs17885179", + "call": "A|A", + "alleles": [ + "*39" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94775453, + "dbSnpId": "rs72552267", + "call": "G|G", + "alleles": [ + "*6" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94775489, + "dbSnpId": "rs17884712", + "call": "G|G", + "alleles": [ + "*9" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94775507, + "dbSnpId": "rs58973490", + "call": "G|G", + "alleles": [ + "*2", + "*11" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94780574, + "dbSnpId": "rs140278421", + "call": "G|G", + "alleles": [ + "*22" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94780579, + "dbSnpId": "rs370803989", + "call": "G|G", + "alleles": [ + "*33" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94780653, + "dbSnpId": "rs4986893", + "call": "G|G", + "alleles": [ + "*3" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94781858, + "dbSnpId": "rs6413438", + "call": "C|C", + "alleles": [ + "*10" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94781859, + "dbSnpId": "rs4244285", + "call": "G|G", + "alleles": [ + "*2" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94781944, + "dbSnpId": "rs375781227", + "call": "G|G", + "alleles": [ + "*26" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94781999, + "dbSnpId": "rs72558186", + "call": "T|T", + "alleles": [ + "*7" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94842861, + "dbSnpId": "rs138142612", + "call": "G|G", + "alleles": [ + "*18" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94842866, + "dbSnpId": "rs3758581", + "call": "A|A", + "alleles": [ + "*2", + "*3", + "*4", + "*5", + "*6", + "*8", + "*9", + "*10", + "*11", + "*12", + "*13", + "*14", + "*15", + "*17", + "*18", + "*19", + "*22", + "*23", + "*24", + "*25", + "*26", + "*28", + "*29", + "*31", + "*32", + "*33", + "*35", + "*39" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94842879, + "dbSnpId": "rs118203757", + "call": "G|G", + "alleles": [ + "*24" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94842995, + "dbSnpId": "rs113934938", + "call": "G|G", + "alleles": [ + "*28" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94849995, + "dbSnpId": "rs17879685", + "call": "C|C", + "alleles": [ + "*13" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94852738, + "dbSnpId": "rs56337013", + "call": "C|C", + "alleles": [ + "*5" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94852765, + "dbSnpId": "rs192154563", + "call": "C|C", + "alleles": [ + "*16" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94852785, + "dbSnpId": "rs118203759", + "call": "C|C", + "alleles": [ + "*25" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94852914, + "dbSnpId": "rs55640102", + "call": "A|A", + "alleles": [ + "*12" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "CYP2C9", + "chr": "chr10", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [ + "*72", + "*73", + "*74", + "*75" + ], + "messages": [], + "relatedDrugs": [ + { + "name": "celecoxib", + "guidelineId": "RxNorm:140587" + }, + { + "name": "flurbiprofen", + "guidelineId": "RxNorm:4502" + }, + { + "name": "ibuprofen", + "guidelineId": "RxNorm:5640" + }, + { + "name": "lornoxicam", + "guidelineId": "RxNorm:20890" + }, + { + "name": "meloxicam", + "guidelineId": "RxNorm:41493" + }, + { + "name": "piroxicam", + "guidelineId": "RxNorm:8356" + }, + { + "name": "tenoxicam", + "guidelineId": "RxNorm:37790" + }, + { + "name": "warfarin", + "guidelineId": "RxNorm:11289" + } + ], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "CYP2C9", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "CYP2C9", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "gene": "CYP2C9", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "2", + "label": "*1/*1" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "CYP2C9", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "CYP2C9", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "gene": "CYP2C9", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "2", + "label": "*1/*1" + } + ], + "variants": [ + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94938683, + "dbSnpId": "rs114071557", + "call": "A|A", + "alleles": [ + "*36" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94938737, + "dbSnpId": "rs67807361", + "call": "C|C", + "alleles": [ + "*7" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94938771, + "dbSnpId": "rs142240658", + "call": "C|C", + "alleles": [ + "*21" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94938803, + "dbSnpId": "rs2031308986", + "call": "A|A", + "alleles": [ + "*22" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94938828, + "dbSnpId": "rs564813580", + "call": "A|A", + "alleles": [ + "*37" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94941897, + "dbSnpId": "rs371055887", + "call": "G|G", + "alleles": [ + "*20" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94941915, + "dbSnpId": null, + "call": "G|G", + "alleles": [ + "*23" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94941958, + "dbSnpId": "rs72558187", + "call": "T|T", + "alleles": [ + "*13" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94941976, + "dbSnpId": null, + "call": "G|G", + "alleles": [ + "*38" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94941982, + "dbSnpId": "rs762239445", + "call": "G|G", + "alleles": [ + "*39" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942018, + "dbSnpId": null, + "call": "T|T", + "alleles": [ + "*40" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942205, + "dbSnpId": "rs1304490498", + "call": "CAATGGAAAGA|CAATGGAAAGA", + "alleles": [ + "*25" + ], + "phased": true, + "wildtypeAllele": "CAATGGAAAGA", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942216, + "dbSnpId": "rs774607211", + "call": "A|A", + "alleles": [ + "*41" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942230, + "dbSnpId": "rs767576260", + "call": "C|C", + "alleles": [ + "*43" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942231, + "dbSnpId": "rs12414460", + "call": "G|G", + "alleles": [ + "*42" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942233, + "dbSnpId": "rs375805362", + "call": "C|C", + "alleles": [ + "*62" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942234, + "dbSnpId": "rs72558189", + "call": "G|G", + "alleles": [ + "*14", + "*35" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942249, + "dbSnpId": "rs200965026", + "call": "C|C", + "alleles": [ + "*26", + "*44" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942254, + "dbSnpId": "rs199523631", + "call": "C|C", + "alleles": [ + "*45" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942255, + "dbSnpId": "rs200183364", + "call": "G|G", + "alleles": [ + "*33" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942290, + "dbSnpId": "rs1799853", + "call": "C|C", + "alleles": [ + "*2", + "*35", + "*61" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942291, + "dbSnpId": "rs141489852", + "call": "G|G", + "alleles": [ + "*63" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942305, + "dbSnpId": "rs754487195", + "call": "G|G", + "alleles": [ + "*46" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942309, + "dbSnpId": "rs7900194", + "call": "G|G", + "alleles": [ + "*8", + "*27" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94947782, + "dbSnpId": "rs72558190", + "call": "C|C", + "alleles": [ + "*15" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94947785, + "dbSnpId": "rs774550549", + "call": "C|C", + "alleles": [ + "*47" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94947869, + "dbSnpId": null, + "call": "A|A", + "alleles": [ + "*69" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94947907, + "dbSnpId": null, + "call": "A|A", + "alleles": [ + "*57" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94947917, + "dbSnpId": "rs1326630788", + "call": "T|T", + "alleles": [ + "*48" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94947938, + "dbSnpId": "rs2031531005", + "call": "A|A", + "alleles": [ + "*28" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94949129, + "dbSnpId": null, + "call": "A|A", + "alleles": [ + "*49" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94949144, + "dbSnpId": null, + "call": "C|C", + "alleles": [ + "*50" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94949217, + "dbSnpId": "rs2256871", + "call": "A|A", + "alleles": [ + "*9" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94949280, + "dbSnpId": "rs9332130", + "call": "A|A", + "alleles": [ + "*10", + "*71" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94949281, + "dbSnpId": "rs9332131", + "call": "GA|GA", + "alleles": [ + "*6" + ], + "phased": true, + "wildtypeAllele": "GA", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94972119, + "dbSnpId": "rs182132442", + "call": "C|C", + "alleles": [ + "*29" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94972123, + "dbSnpId": null, + "call": "C|C", + "alleles": [ + "*64" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94972134, + "dbSnpId": null, + "call": "A|A", + "alleles": [ + "*51" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94972179, + "dbSnpId": "rs72558192", + "call": "A|A", + "alleles": [ + "*16" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94972180, + "dbSnpId": "rs988617574", + "call": "C|C", + "alleles": [ + "*52" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94972233, + "dbSnpId": "rs1237225311", + "call": "C|C", + "alleles": [ + "*53" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981199, + "dbSnpId": null, + "call": "G|G", + "alleles": [ + "*65" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981201, + "dbSnpId": "rs57505750", + "call": "T|T", + "alleles": [ + "*31" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981224, + "dbSnpId": "rs28371685", + "call": "C|C", + "alleles": [ + "*11" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981225, + "dbSnpId": "rs367826293", + "call": "G|G", + "alleles": [ + "*34" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981230, + "dbSnpId": "rs1274535931", + "call": "C|C", + "alleles": [ + "*58" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981250, + "dbSnpId": "rs750820937", + "call": "C|C", + "alleles": [ + "*54" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981281, + "dbSnpId": "rs749060448", + "call": "G|G", + "alleles": [ + "*24" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981296, + "dbSnpId": "rs1057910", + "call": "A|A", + "alleles": [ + "*3", + "*18", + "*68" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981297, + "dbSnpId": "rs56165452", + "call": "T|T", + "alleles": [ + "*4" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981301, + "dbSnpId": "rs28371686", + "call": "C|C", + "alleles": [ + "*5" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981302, + "dbSnpId": "rs1250577724", + "call": "C|C", + "alleles": [ + "*55" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981305, + "dbSnpId": "rs578144976", + "call": "C|C", + "alleles": [ + "*66" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981365, + "dbSnpId": null, + "call": "C|C", + "alleles": [ + "*17" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981371, + "dbSnpId": "rs542577750", + "call": "G|G", + "alleles": [ + "*68" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94986042, + "dbSnpId": "rs764211126", + "call": "A|A", + "alleles": [ + "*56" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94986073, + "dbSnpId": "rs72558193", + "call": "A|A", + "alleles": [ + "*18" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94988852, + "dbSnpId": "rs776908257", + "call": "C|C", + "alleles": [ + "*67" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94988855, + "dbSnpId": null, + "call": "A|A", + "alleles": [ + "*59" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94988880, + "dbSnpId": null, + "call": "G|G", + "alleles": [ + "*70" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94988917, + "dbSnpId": "rs769942899", + "call": "G|G", + "alleles": [ + "*19" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94988925, + "dbSnpId": "rs202201137", + "call": "A|A", + "alleles": [ + "*61" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94988955, + "dbSnpId": "rs767284820", + "call": "T|T", + "alleles": [ + "*60" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94988984, + "dbSnpId": "rs781583846", + "call": "G|G", + "alleles": [ + "*30" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94989020, + "dbSnpId": "rs9332239", + "call": "C|C", + "alleles": [ + "*12", + "*71" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94989023, + "dbSnpId": "rs868182778", + "call": "G|G", + "alleles": [ + "*32" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942306, + "dbSnpId": "rs1289704600", + "call": null, + "alleles": [ + "*72" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942308, + "dbSnpId": "rs17847037", + "call": null, + "alleles": [ + "*73" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94947439, + "dbSnpId": null, + "call": null, + "alleles": [ + "*74" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94986136, + "dbSnpId": "rs1254213342", + "call": null, + "alleles": [ + "*75" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + } + ], + "variantsOfInterest": [ + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94645745, + "dbSnpId": "rs12777823", + "call": "G|G", + "alleles": [], + "phased": true, + "wildtypeAllele": null, + "mismatch": false + } + ], + "highlightedVariants": [] + }, + { + "geneSymbol": "CYP2D6", + "chr": null, + "phased": false, + "callSource": "OUTSIDE", + "uncalledHaplotypes": [], + "messages": [ + { + "rule_name": "CYP2D6 warning", + "version": "1", + "matches": { + "gene": "CYP2D6", + "hapsCalled": [], + "hapsMissing": [], + "variantsMissing": [], + "variant": "", + "dips": [], + "drugs": [] + }, + "exception_type": "note", + "message": "CYP2D6 genotypes are called by a separate algorithm from other genes in the PharmCAT report. Please refer to \u003ca href\u003d\"https://github.com/PharmGKB/PharmCAT/wiki/Determining-Alleles\"\u003ethe PharmCAT wiki\u003c/a\u003e for more information." + } + ], + "relatedDrugs": [ + { + "name": "amitriptyline", + "guidelineId": "RxNorm:704" + }, + { + "name": "atomoxetine", + "guidelineId": "RxNorm:38400" + }, + { + "name": "clomipramine", + "guidelineId": "RxNorm:2597" + }, + { + "name": "codeine", + "guidelineId": "RxNorm:2670" + }, + { + "name": "desipramine", + "guidelineId": "RxNorm:3247" + }, + { + "name": "doxepin", + "guidelineId": "RxNorm:3638" + }, + { + "name": "fluvoxamine", + "guidelineId": "RxNorm:42355" + }, + { + "name": "hydrocodone", + "guidelineId": "RxNorm:5489" + }, + { + "name": "imipramine", + "guidelineId": "RxNorm:5691" + }, + { + "name": "nortriptyline", + "guidelineId": "RxNorm:7531" + }, + { + "name": "ondansetron", + "guidelineId": "RxNorm:26225" + }, + { + "name": "paroxetine", + "guidelineId": "RxNorm:32937" + }, + { + "name": "tamoxifen", + "guidelineId": "RxNorm:10324" + }, + { + "name": "tramadol", + "guidelineId": "RxNorm:10689" + }, + { + "name": "trimipramine", + "guidelineId": "RxNorm:10834" + }, + { + "name": "tropisetron", + "guidelineId": "RxNorm:27392" + } + ], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "CYP2D6", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "CYP2D6", + "name": "*3", + "function": "No function", + "reference": false + }, + "gene": "CYP2D6", + "phenotype": "Intermediate Metabolizer", + "variant": null, + "lookupKey": "1", + "label": "*1/*3" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "CYP2D6", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "CYP2D6", + "name": "*3", + "function": "No function", + "reference": false + }, + "gene": "CYP2D6", + "phenotype": "Intermediate Metabolizer", + "variant": null, + "lookupKey": "1", + "label": "*1/*3" + } + ], + "variants": [], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "CYP3A5", + "chr": "chr7", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [ + { + "rule_name": "CYP3A5 reverse complement footnote", + "version": "1", + "matches": { + "gene": "CYP3A5", + "hapsCalled": [], + "hapsMissing": [], + "variantsMissing": [], + "variant": "", + "dips": [], + "drugs": [] + }, + "exception_type": "footnote", + "message": "The CYP3A5 gene is on the negative chromosomal strand, all genotype calls for CYP3A5 in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases." + } + ], + "relatedDrugs": [ + { + "name": "tacrolimus", + "guidelineId": "RxNorm:42316" + } + ], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "CYP3A5", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "CYP3A5", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "gene": "CYP3A5", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*1/*1" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "CYP3A5", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "CYP3A5", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "gene": "CYP3A5", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*1/*1" + } + ], + "variants": [ + { + "gene": "CYP3A5", + "chromosome": "chr7", + "position": 99652613, + "dbSnpId": "rs28365083", + "call": "G|G", + "alleles": [ + "*2", + "*3" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP3A5", + "chromosome": "chr7", + "position": 99652770, + "dbSnpId": "rs41303343", + "call": "T|T", + "alleles": [ + "*7" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP3A5", + "chromosome": "chr7", + "position": 99660516, + "dbSnpId": "rs28383479", + "call": "C|C", + "alleles": [ + "*3", + "*9" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP3A5", + "chromosome": "chr7", + "position": 99665212, + "dbSnpId": "rs10264272", + "call": "C|C", + "alleles": [ + "*6" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP3A5", + "chromosome": "chr7", + "position": 99665237, + "dbSnpId": "rs56411402", + "call": "T|T", + "alleles": [ + "*3", + "*4" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP3A5", + "chromosome": "chr7", + "position": 99666950, + "dbSnpId": "rs55965422", + "call": "A|A", + "alleles": [ + "*3", + "*5" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP3A5", + "chromosome": "chr7", + "position": 99672916, + "dbSnpId": "rs776746", + "call": "T|T", + "alleles": [ + "*3" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP3A5", + "chromosome": "chr7", + "position": 99676198, + "dbSnpId": "rs55817950", + "call": "G|G", + "alleles": [ + "*8" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "CYP4F2", + "chr": "chr19", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [], + "relatedDrugs": [ + { + "name": "warfarin", + "guidelineId": "RxNorm:11289" + } + ], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "CYP4F2", + "name": "*1", + "function": null, + "reference": true + }, + "allele2": { + "gene": "CYP4F2", + "name": "*1", + "function": null, + "reference": true + }, + "gene": "CYP4F2", + "phenotype": null, + "variant": null, + "lookupKey": null, + "label": "*1/*1" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "CYP4F2", + "name": "*1", + "function": null, + "reference": true + }, + "allele2": { + "gene": "CYP4F2", + "name": "*1", + "function": null, + "reference": true + }, + "gene": "CYP4F2", + "phenotype": null, + "variant": null, + "lookupKey": null, + "label": "*1/*1" + } + ], + "variants": [ + { + "gene": "CYP4F2", + "chromosome": "chr19", + "position": 15879621, + "dbSnpId": "rs2108622", + "call": "C|C", + "alleles": [ + "*3" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP4F2", + "chromosome": "chr19", + "position": 15897578, + "dbSnpId": "rs3093105", + "call": "A|A", + "alleles": [ + "*2" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "DPYD", + "chr": "chr1", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [ + { + "rule_name": "DPYD reverse complement footnote", + "version": "1", + "matches": { + "gene": "DPYD", + "hapsCalled": [], + "hapsMissing": [], + "variantsMissing": [], + "variant": "", + "dips": [], + "drugs": [] + }, + "exception_type": "footnote", + "message": "The DPYD gene is on the negative chromosomal strand, all genotype calls for DPYD in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases." + } + ], + "relatedDrugs": [ + { + "name": "capecitabine", + "guidelineId": "RxNorm:194000" + }, + { + "name": "fluorouracil", + "guidelineId": "RxNorm:4492" + } + ], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "DPYD", + "name": "Reference", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "DPYD", + "name": "Reference", + "function": "Normal function", + "reference": true + }, + "gene": "DPYD", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "2", + "label": "Reference/Reference" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "DPYD", + "name": "Reference", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "DPYD", + "name": "Reference", + "function": "Normal function", + "reference": true + }, + "gene": "DPYD", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "2", + "label": "Reference/Reference" + } + ], + "variants": [ + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97078987, + "dbSnpId": "rs114096998", + "call": "G|G", + "alleles": [ + "c.3067C\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97078993, + "dbSnpId": "rs148799944", + "call": "C|C", + "alleles": [ + "c.3061G\u003eC" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97079005, + "dbSnpId": "rs140114515", + "call": "C|C", + "alleles": [ + "c.3049G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97079071, + "dbSnpId": "rs1801268", + "call": "C|C", + "alleles": [ + "c.2983G\u003eT (*10)" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97079076, + "dbSnpId": "rs139459586", + "call": "A|A", + "alleles": [ + "c.2978T\u003eG" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97079077, + "dbSnpId": "rs202144771", + "call": "G|G", + "alleles": [ + "c.2977C\u003eT" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97079121, + "dbSnpId": "rs72547601", + "call": "T|T", + "alleles": [ + "c.2933A\u003eG" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97079133, + "dbSnpId": "rs72547602", + "call": "T|T", + "alleles": [ + "c.2921A\u003eT" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97079139, + "dbSnpId": "rs145529148", + "call": "T|T", + "alleles": [ + "c.2915A\u003eG" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97082365, + "dbSnpId": "rs141044036", + "call": "T|T", + "alleles": [ + "c.2872A\u003eG" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97082391, + "dbSnpId": "rs67376798", + "call": "T|T", + "alleles": [ + "c.2846A\u003eT" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97098598, + "dbSnpId": "rs1801267", + "call": "C|C", + "alleles": [ + "c.2657G\u003eA (*9B)" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97098599, + "dbSnpId": "rs147545709", + "call": "G|G", + "alleles": [ + "c.2656C\u003eT" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97098616, + "dbSnpId": "rs55674432", + "call": "C|C", + "alleles": [ + "c.2639G\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97098632, + "dbSnpId": "rs201035051", + "call": "T|T", + "alleles": [ + "c.2623A\u003eC" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97193109, + "dbSnpId": "rs60139309", + "call": "T|T", + "alleles": [ + "c.2582A\u003eG" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97193209, + "dbSnpId": "rs200687447", + "call": "C|C", + "alleles": [ + "c.2482G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97234958, + "dbSnpId": "rs199634007", + "call": "G|G", + "alleles": [ + "c.2336C\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97234991, + "dbSnpId": "rs56005131", + "call": "G|G", + "alleles": [ + "c.2303C\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97305279, + "dbSnpId": "rs112766203", + "call": "G|G", + "alleles": [ + "c.2279C\u003eT" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97305363, + "dbSnpId": "rs60511679", + "call": "A|A", + "alleles": [ + "c.2195T\u003eG" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97305364, + "dbSnpId": "rs1801160", + "call": "C|C", + "alleles": [ + "c.2194G\u003eA (*6)" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97305372, + "dbSnpId": "rs146529561", + "call": "G|G", + "alleles": [ + "c.2186C\u003eT" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97306195, + "dbSnpId": "rs145548112", + "call": "C|C", + "alleles": [ + "c.2161G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97373598, + "dbSnpId": "rs137999090", + "call": "C|C", + "alleles": [ + "c.2021G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97373629, + "dbSnpId": "rs138545885", + "call": "C|C", + "alleles": [ + "c.1990G\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97382461, + "dbSnpId": "rs55971861", + "call": "T|T", + "alleles": [ + "c.1906A\u003eC" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97450058, + "dbSnpId": "rs3918290", + "call": "C|C", + "alleles": [ + "c.1905+1G\u003eA (*2A)" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97450059, + "dbSnpId": "rs3918289", + "call": "G|G", + "alleles": [ + "c.1905C\u003eG" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97450065, + "dbSnpId": "rs72549303", + "call": "TG|TG", + "alleles": [ + "c.1898delC (*3)" + ], + "phased": true, + "wildtypeAllele": "TG", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97450068, + "dbSnpId": "rs17376848", + "call": "A|A", + "alleles": [ + "c.1896T\u003eC" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97450168, + "dbSnpId": "rs147601618", + "call": "A|A", + "alleles": [ + "c.1796T\u003eC" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97450187, + "dbSnpId": "rs145773863", + "call": "C|C", + "alleles": [ + "c.1777G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97450189, + "dbSnpId": "rs138616379", + "call": "C|C", + "alleles": [ + "c.1775G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97450190, + "dbSnpId": "rs59086055", + "call": "G|G", + "alleles": [ + "c.1774C\u003eT" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97515784, + "dbSnpId": "rs201615754", + "call": "C|C", + "alleles": [ + "c.1682G\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97515787, + "dbSnpId": "rs55886062", + "call": "A|A", + "alleles": [ + "c.1679T\u003eG (*13)" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97515839, + "dbSnpId": "rs1801159", + "call": "T|T", + "alleles": [ + "c.1627A\u003eG (*5)" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97515851, + "dbSnpId": "rs142619737", + "call": "C|C", + "alleles": [ + "c.1615G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97515865, + "dbSnpId": "rs1801158", + "call": "C|C", + "alleles": [ + "c.1601G\u003eA (*4)" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97515889, + "dbSnpId": "rs190951787", + "call": "G|G", + "alleles": [ + "c.1577C\u003eG" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97515923, + "dbSnpId": "rs148994843", + "call": "C|C", + "alleles": [ + "c.1543G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97549565, + "dbSnpId": "rs138391898", + "call": "C|C", + "alleles": [ + "c.1519G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97549600, + "dbSnpId": "rs111858276", + "call": "T|T", + "alleles": [ + "c.1484A\u003eG" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97549609, + "dbSnpId": "rs72549304", + "call": "G|G", + "alleles": [ + "c.1475C\u003eT" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97549681, + "dbSnpId": "rs199549923", + "call": "G|G", + "alleles": [ + "c.1403C\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97549713, + "dbSnpId": "rs57918000", + "call": "G|G", + "alleles": [ + "c.1371C\u003eT" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97549726, + "dbSnpId": "rs144395748", + "call": "G|G", + "alleles": [ + "c.1358C\u003eG" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97549735, + "dbSnpId": "rs72975710", + "call": "G|G", + "alleles": [ + "c.1349C\u003eT" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97573785, + "dbSnpId": "rs186169810", + "call": "A|A", + "alleles": [ + "c.1314T\u003eG" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97573805, + "dbSnpId": "rs142512579", + "call": "C|C", + "alleles": [ + "c.1294G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97573821, + "dbSnpId": "rs764666241", + "call": "C|C", + "alleles": [ + "c.1278G\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97573839, + "dbSnpId": "rs200064537", + "call": "A|A", + "alleles": [ + "c.1260T\u003eA" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97573863, + "dbSnpId": "rs56038477", + "call": "C|C", + "alleles": [ + "c.1129-5923C\u003eG, c.1236G\u003eA (HapB3)" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97573881, + "dbSnpId": "rs61622928", + "call": "C|C", + "alleles": [ + "c.1218G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97573918, + "dbSnpId": "rs143815742", + "call": "C|C", + "alleles": [ + "c.1181G\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97573919, + "dbSnpId": "rs140602333", + "call": "G|G", + "alleles": [ + "c.1180C\u003eT" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97573943, + "dbSnpId": "rs78060119", + "call": "C|C", + "alleles": [ + "c.1156G\u003eT (*12)" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97579893, + "dbSnpId": "rs75017182", + "call": "G|G", + "alleles": [ + "c.1129-5923C\u003eG, c.1236G\u003eA (HapB3)" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97593238, + "dbSnpId": "rs72549305", + "call": "T|T", + "alleles": [ + "c.1108A\u003eG" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97593289, + "dbSnpId": "rs143154602", + "call": "G|G", + "alleles": [ + "c.1057C\u003eT" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97593322, + "dbSnpId": "rs183385770", + "call": "C|C", + "alleles": [ + "c.1024G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97593343, + "dbSnpId": "rs72549306", + "call": "C|C", + "alleles": [ + "c.1003G\u003eT (*11)" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97593379, + "dbSnpId": "rs201018345", + "call": "C|C", + "alleles": [ + "c.967G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97595083, + "dbSnpId": "rs145112791", + "call": "G|G", + "alleles": [ + "c.934C\u003eT" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97595088, + "dbSnpId": "rs150437414", + "call": "A|A", + "alleles": [ + "c.929T\u003eC" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97595149, + "dbSnpId": "rs146356975", + "call": "T|T", + "alleles": [ + "c.868A\u003eG" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97679170, + "dbSnpId": "rs45589337", + "call": "T|T", + "alleles": [ + "c.775A\u003eG" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97691776, + "dbSnpId": "rs1801266", + "call": "G|G", + "alleles": [ + "c.703C\u003eT (*8)" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97699399, + "dbSnpId": "rs72549307", + "call": "T|T", + "alleles": [ + "c.632A\u003eG" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97699430, + "dbSnpId": "rs72549308", + "call": "T|T", + "alleles": [ + "c.601A\u003eC" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97699474, + "dbSnpId": "rs115232898", + "call": "T|T", + "alleles": [ + "c.557A\u003eG" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97699506, + "dbSnpId": "rs6670886", + "call": "C|C", + "alleles": [ + "c.525G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97699533, + "dbSnpId": "rs139834141", + "call": "C|C", + "alleles": [ + "c.498G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97699535, + "dbSnpId": "rs2297595", + "call": "T|T", + "alleles": [ + "c.496A\u003eG" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97721542, + "dbSnpId": "rs200562975", + "call": "T|T", + "alleles": [ + "c.451A\u003eG" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97721650, + "dbSnpId": "rs141462178", + "call": "T|T", + "alleles": [ + "c.343A\u003eG" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97740400, + "dbSnpId": "rs150385342", + "call": "C|C", + "alleles": [ + "c.313G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97740410, + "dbSnpId": "rs72549309", + "call": "GATGA|GATGA", + "alleles": [ + "c.295_298delTCAT (*7)" + ], + "phased": true, + "wildtypeAllele": "GATGA", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97883329, + "dbSnpId": "rs1801265", + "call": "A|A", + "alleles": [ + "c.85T\u003eC (*9A)" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97883352, + "dbSnpId": "rs80081766", + "call": "C|C", + "alleles": [ + "c.62G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97883353, + "dbSnpId": "rs72549310", + "call": "G|G", + "alleles": [ + "c.61C\u003eT" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97883368, + "dbSnpId": "rs150036960", + "call": "G|G", + "alleles": [ + "c.46C\u003eG" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "G6PD", + "chr": null, + "phased": false, + "callSource": "OUTSIDE", + "uncalledHaplotypes": [], + "messages": [], + "relatedDrugs": [ + { + "name": "rasburicase", + "guidelineId": "RxNorm:283821" + } + ], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "G6PD", + "name": "B (wildtype)", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "G6PD", + "name": "B (wildtype)", + "function": "Normal function", + "reference": true + }, + "gene": "G6PD", + "phenotype": "Normal", + "variant": null, + "lookupKey": "Normal", + "label": "B (wildtype)/B (wildtype)" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "G6PD", + "name": "B (wildtype)", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "G6PD", + "name": "B (wildtype)", + "function": "Normal function", + "reference": true + }, + "gene": "G6PD", + "phenotype": "Normal", + "variant": null, + "lookupKey": "Normal", + "label": "B (wildtype)/B (wildtype)" + } + ], + "variants": [], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "IFNL3", + "chr": "chr19", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [ + { + "rule_name": "IFNL3 reverse complement footnote", + "version": "1", + "matches": { + "gene": "IFNL3", + "hapsCalled": [], + "hapsMissing": [], + "variantsMissing": [], + "variant": "", + "dips": [], + "drugs": [] + }, + "exception_type": "footnote", + "message": "The IFNL3 gene is on the negative chromosomal strand, all genotype calls for IFNL3 in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases." + } + ], + "relatedDrugs": [ + { + "name": "peginterferon alfa-2a", + "guidelineId": "RxNorm:120608" + }, + { + "name": "peginterferon alfa-2b", + "guidelineId": "RxNorm:253453" + } + ], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "IFNL3", + "name": "rs12979860 reference (C)", + "function": null, + "reference": true + }, + "allele2": { + "gene": "IFNL3", + "name": "rs12979860 reference (C)", + "function": null, + "reference": true + }, + "gene": "IFNL3", + "phenotype": null, + "variant": null, + "lookupKey": null, + "label": "rs12979860 reference (C)/rs12979860 reference (C)" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "IFNL3", + "name": "rs12979860 reference (C)", + "function": null, + "reference": true + }, + "allele2": { + "gene": "IFNL3", + "name": "rs12979860 reference (C)", + "function": null, + "reference": true + }, + "gene": "IFNL3", + "phenotype": null, + "variant": null, + "lookupKey": null, + "label": "rs12979860 reference (C)/rs12979860 reference (C)" + } + ], + "variants": [ + { + "gene": "IFNL3", + "chromosome": "chr19", + "position": 39248147, + "dbSnpId": "rs12979860", + "call": "C|C", + "alleles": [ + "rs12979860 variant (T)" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "MT-RNR1", + "chr": null, + "phased": false, + "callSource": "OUTSIDE", + "uncalledHaplotypes": [], + "messages": [], + "relatedDrugs": [ + { + "name": "amikacin", + "guidelineId": "RxNorm:641" + }, + { + "name": "gentamicin", + "guidelineId": "ATC:D06AX07" + }, + { + "name": "kanamycin", + "guidelineId": "RxNorm:6099" + }, + { + "name": "paromomycin", + "guidelineId": "RxNorm:7934" + }, + { + "name": "plazomicin", + "guidelineId": "RxNorm:2049549" + }, + { + "name": "streptomycin", + "guidelineId": "RxNorm:10109" + }, + { + "name": "tobramycin", + "guidelineId": "RxNorm:10627" + } + ], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "MT-RNR1", + "name": "1555A\u003eG", + "function": "increased risk of aminoglycoside-induced hearing loss", + "reference": false + }, + "allele2": null, + "gene": "MT-RNR1", + "phenotype": "increased risk of aminoglycoside-induced hearing loss", + "variant": null, + "lookupKey": "increased risk of aminoglycoside-induced hearing loss", + "label": "1555A\u003eG" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "MT-RNR1", + "name": "1555A\u003eG", + "function": "increased risk of aminoglycoside-induced hearing loss", + "reference": false + }, + "allele2": null, + "gene": "MT-RNR1", + "phenotype": "increased risk of aminoglycoside-induced hearing loss", + "variant": null, + "lookupKey": "increased risk of aminoglycoside-induced hearing loss", + "label": "1555A\u003eG" + } + ], + "variants": [], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "NUDT15", + "chr": "chr13", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [], + "relatedDrugs": [ + { + "name": "azathioprine", + "guidelineId": "RxNorm:1256" + }, + { + "name": "mercaptopurine", + "guidelineId": "RxNorm:103" + }, + { + "name": "thioguanine", + "guidelineId": "RxNorm:10485" + } + ], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "NUDT15", + "name": "*1", + "function": "Normal Function", + "reference": true + }, + "allele2": { + "gene": "NUDT15", + "name": "*1", + "function": "Normal Function", + "reference": true + }, + "gene": "NUDT15", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*1/*1" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "NUDT15", + "name": "*1", + "function": "Normal Function", + "reference": true + }, + "allele2": { + "gene": "NUDT15", + "name": "*1", + "function": "Normal Function", + "reference": true + }, + "gene": "NUDT15", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*1/*1" + } + ], + "variants": [ + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48037748, + "dbSnpId": "rs769369441", + "call": "T|T", + "alleles": [ + "*10" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48037749, + "dbSnpId": null, + "call": "G|G", + "alleles": [ + "*19" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48037782, + "dbSnpId": "rs746071566", + "call": "AGGAGTC|AGGAGTC", + "alleles": [ + "*2", + "*6", + "*9" + ], + "phased": true, + "wildtypeAllele": "AGGAGTC", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48037798, + "dbSnpId": "rs186364861", + "call": "G|G", + "alleles": [ + "*5" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48037825, + "dbSnpId": "rs777311140", + "call": "C|C", + "alleles": [ + "*14" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48037834, + "dbSnpId": "rs1202487323", + "call": "C|C", + "alleles": [ + "*16" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48037847, + "dbSnpId": "rs766023281", + "call": "G|G", + "alleles": [ + "*7" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48037849, + "dbSnpId": null, + "call": "A|A", + "alleles": [ + "*8" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48037885, + "dbSnpId": "rs1950545307", + "call": "G|G", + "alleles": [ + "*11" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48037902, + "dbSnpId": "rs149436418", + "call": "C|C", + "alleles": [ + "*12" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48040977, + "dbSnpId": "rs1457579126", + "call": "GA|GA", + "alleles": [ + "*18" + ], + "phased": true, + "wildtypeAllele": "GA", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48041103, + "dbSnpId": "rs761191455", + "call": "T|T", + "alleles": [ + "*13" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48041113, + "dbSnpId": "rs1368252918", + "call": "G|G", + "alleles": [ + "*17" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48045690, + "dbSnpId": "rs768324690", + "call": "C|C", + "alleles": [ + "*20" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48045719, + "dbSnpId": "rs116855232", + "call": "C|C", + "alleles": [ + "*2", + "*3" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48045720, + "dbSnpId": "rs147390019", + "call": "G|G", + "alleles": [ + "*4" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48045771, + "dbSnpId": "rs139551410", + "call": "T|T", + "alleles": [ + "*15" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "RYR1", + "chr": "chr19", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [], + "relatedDrugs": [ + { + "name": "desflurane", + "guidelineId": "RxNorm:27340" + }, + { + "name": "enflurane", + "guidelineId": "RxNorm:3920" + }, + { + "name": "halothane", + "guidelineId": "RxNorm:5095" + }, + { + "name": "isoflurane", + "guidelineId": "RxNorm:6026" + }, + { + "name": "methoxyflurane", + "guidelineId": "RxNorm:6857" + }, + { + "name": "sevoflurane", + "guidelineId": "RxNorm:36453" + }, + { + "name": "succinylcholine", + "guidelineId": "RxNorm:10154" + } + ], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "RYR1", + "name": "Reference", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "RYR1", + "name": "Reference", + "function": "Normal function", + "reference": true + }, + "gene": "RYR1", + "phenotype": "Uncertain Susceptibility", + "variant": null, + "lookupKey": "Uncertain Susceptibility", + "label": "Reference/Reference" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "RYR1", + "name": "Reference", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "RYR1", + "name": "Reference", + "function": "Normal function", + "reference": true + }, + "gene": "RYR1", + "phenotype": "Uncertain Susceptibility", + "variant": null, + "lookupKey": "Uncertain Susceptibility", + "label": "Reference/Reference" + } + ], + "variants": [ + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38440802, + "dbSnpId": "rs193922747", + "call": "T|T", + "alleles": [ + "c.103T\u003eC" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38440829, + "dbSnpId": "rs193922748", + "call": "C|C", + "alleles": [ + "c.130C\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38444211, + "dbSnpId": "rs118192161", + "call": "C|C", + "alleles": [ + "c.487C\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38444212, + "dbSnpId": "rs193922753", + "call": "G|G", + "alleles": [ + "c.488G\u003eT" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38446710, + "dbSnpId": "rs1801086", + "call": "G|G", + "alleles": [ + "c.742G\u003eA", + "c.742G\u003eC" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38448673, + "dbSnpId": "rs193922762", + "call": "C|C", + "alleles": [ + "c.982C\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38448712, + "dbSnpId": "rs121918592", + "call": "G|G", + "alleles": [ + "c.1021G\u003eA", + "c.1021G\u003eC" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38451842, + "dbSnpId": "rs193922764", + "call": "C|C", + "alleles": [ + "c.1201C\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38451850, + "dbSnpId": "rs118192116", + "call": "C|C", + "alleles": [ + "c.1209C\u003eG" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38455359, + "dbSnpId": "rs118192162", + "call": "A|A", + "alleles": [ + "c.1565A\u003eC" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38455463, + "dbSnpId": "rs111888148", + "call": "G|G", + "alleles": [ + "c.1589G\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38455471, + "dbSnpId": "rs193922768", + "call": "C|C", + "alleles": [ + "c.1597C\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38455472, + "dbSnpId": "rs144336148", + "call": "G|G", + "alleles": [ + "c.1598G\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38455528, + "dbSnpId": "rs193922770", + "call": "C|C", + "alleles": [ + "c.1654C\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38457545, + "dbSnpId": "rs118192172", + "call": "C|C", + "alleles": [ + "c.1840C\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38457546, + "dbSnpId": "rs193922772", + "call": "G|G", + "alleles": [ + "c.1841G\u003eT" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38494564, + "dbSnpId": "rs118192175", + "call": "C|C", + "alleles": [ + "c.6487C\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38494565, + "dbSnpId": "rs118192163", + "call": "G|G", + "alleles": [ + "c.6488G\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38494579, + "dbSnpId": "rs118192176", + "call": "G|G", + "alleles": [ + "c.6502G\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38496283, + "dbSnpId": "rs118192177", + "call": "C|C", + "alleles": [ + "c.6617C\u003eG", + "c.6617C\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38499223, + "dbSnpId": "rs112563513", + "call": "G|G", + "alleles": [ + "c.7007G\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38499644, + "dbSnpId": "rs121918596", + "call": "TGGA|TGGA", + "alleles": [ + "c.7042_7044delGAG" + ], + "phased": true, + "wildtypeAllele": "TGGA", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38499655, + "dbSnpId": "rs193922802", + "call": "G|G", + "alleles": [ + "c.7048G\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38499670, + "dbSnpId": "rs193922803", + "call": "C|C", + "alleles": [ + "c.7063C\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38499731, + "dbSnpId": "rs193922807", + "call": "G|G", + "alleles": [ + "c.7124G\u003eC" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38499975, + "dbSnpId": "rs193922809", + "call": "G|G", + "alleles": [ + "c.7282G\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38499993, + "dbSnpId": "rs121918593", + "call": "G|G", + "alleles": [ + "c.7300G\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38499997, + "dbSnpId": "rs28933396", + "call": "G|G", + "alleles": [ + "c.7304G\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38500636, + "dbSnpId": "rs118192124", + "call": "C|C", + "alleles": [ + "c.7354C\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38500642, + "dbSnpId": "rs193922816", + "call": "C|C", + "alleles": [ + "c.7360C\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38500643, + "dbSnpId": "rs118192122", + "call": "G|G", + "alleles": [ + "c.7361G\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38500654, + "dbSnpId": "rs28933397", + "call": "C|C", + "alleles": [ + "c.7372C\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38500655, + "dbSnpId": "rs121918594", + "call": "G|G", + "alleles": [ + "c.7373G\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38500898, + "dbSnpId": "rs118192178", + "call": "C|C", + "alleles": [ + "c.7522C\u003eG", + "c.7522C\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38500899, + "dbSnpId": "rs193922818", + "call": "G|G", + "alleles": [ + "c.7523G\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38512321, + "dbSnpId": "rs193922832", + "call": "G|G", + "alleles": [ + "c.9310G\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38543832, + "dbSnpId": "rs193922843", + "call": "G|G", + "alleles": [ + "c.11969G\u003eT" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38580004, + "dbSnpId": "rs118192167", + "call": "A|A", + "alleles": [ + "c.14387A\u003eG" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38580094, + "dbSnpId": "rs121918595", + "call": "C|C", + "alleles": [ + "c.14477C\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38580114, + "dbSnpId": "rs193922876", + "call": "C|C", + "alleles": [ + "c.14497C\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38580370, + "dbSnpId": "rs193922878", + "call": "C|C", + "alleles": [ + "c.14512C\u003eG" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38580403, + "dbSnpId": "rs118192168", + "call": "G|G", + "alleles": [ + "c.14545G\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38580440, + "dbSnpId": "rs63749869", + "call": "G|G", + "alleles": [ + "c.14582G\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38584989, + "dbSnpId": "rs118192170", + "call": "T|T", + "alleles": [ + "c.14693T\u003eC" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "SLCO1B1", + "chr": "chr12", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [ + "*38", + "*41", + "*45" + ], + "messages": [], + "relatedDrugs": [ + { + "name": "simvastatin", + "guidelineId": "RxNorm:36567" + } + ], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "SLCO1B1", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "SLCO1B1", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "gene": "SLCO1B1", + "phenotype": "Normal function", + "variant": null, + "lookupKey": "Normal function", + "label": "*1/*1" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "SLCO1B1", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "SLCO1B1", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "gene": "SLCO1B1", + "phenotype": "Normal function", + "variant": null, + "lookupKey": "Normal function", + "label": "*1/*1" + } + ], + "variants": [ + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21172734, + "dbSnpId": "rs139257324", + "call": "C|C", + "alleles": [ + "*33" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21172776, + "dbSnpId": "rs373327528", + "call": "G|G", + "alleles": [ + "*23" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21172782, + "dbSnpId": "rs56101265", + "call": "T|T", + "alleles": [ + "*2", + "*12" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21174595, + "dbSnpId": "rs56061388", + "call": "T|T", + "alleles": [ + "*3", + "*13" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21176804, + "dbSnpId": "rs2306283", + "call": "A|A", + "alleles": [ + "*14", + "*15", + "*20", + "*24", + "*25", + "*27", + "*28", + "*29", + "*30", + "*31", + "*32", + "*33", + "*37", + "*39", + "*42", + "*43", + "*44", + "*46", + "*47" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21176868, + "dbSnpId": "rs2306282", + "call": "A|A", + "alleles": [ + "*16" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21176879, + "dbSnpId": "rs11045819", + "call": "C|C", + "alleles": [ + "*4", + "*14", + "*25", + "*32", + "*43" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21176883, + "dbSnpId": "rs72559745", + "call": "A|A", + "alleles": [ + "*3", + "*13" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21178615, + "dbSnpId": "rs4149056", + "call": "T|T", + "alleles": [ + "*5", + "*15", + "*40", + "*46", + "*47" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21178957, + "dbSnpId": "rs79135870", + "call": "A|A", + "alleles": [ + "*30" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21196951, + "dbSnpId": "rs11045852", + "call": "A|A", + "alleles": [ + "*24", + "*25", + "*28", + "*32", + "*33", + "*43", + "*44" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21196976, + "dbSnpId": "rs11045853", + "call": "G|G", + "alleles": [ + "*25", + "*28", + "*33" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21200595, + "dbSnpId": "rs55901008", + "call": "T|T", + "alleles": [ + "*6" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21202553, + "dbSnpId": "rs1228465562", + "call": "T|T", + "alleles": [ + "*36" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21202555, + "dbSnpId": "rs59113707", + "call": "C|C", + "alleles": [ + "*27" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21202649, + "dbSnpId": "rs56387224", + "call": "A|A", + "alleles": [ + "*7" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21202664, + "dbSnpId": "rs142965323", + "call": "G|G", + "alleles": [ + "*26" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21205921, + "dbSnpId": "rs72559748", + "call": "A|A", + "alleles": [ + "*8" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21205999, + "dbSnpId": "rs59502379", + "call": "G|G", + "alleles": [ + "*9", + "*31" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21239042, + "dbSnpId": "rs34671512", + "call": "A|A", + "alleles": [ + "*19", + "*20", + "*40" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21239077, + "dbSnpId": "rs56199088", + "call": "A|A", + "alleles": [ + "*10", + "*12" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21239113, + "dbSnpId": "rs55737008", + "call": "A|A", + "alleles": [ + "*11", + "*13" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21239145, + "dbSnpId": "rs200995543", + "call": "C|C", + "alleles": [ + "*34" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21239158, + "dbSnpId": "rs140790673", + "call": "C|C", + "alleles": [ + "*29" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21176871, + "dbSnpId": null, + "call": null, + "alleles": [ + "*38" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21176898, + "dbSnpId": "rs77271279", + "call": null, + "alleles": [ + "*41" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21178612, + "dbSnpId": "rs141467543", + "call": null, + "alleles": [ + "*42" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21196975, + "dbSnpId": "rs183501729", + "call": null, + "alleles": [ + "*39" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21200544, + "dbSnpId": "rs72559747", + "call": null, + "alleles": [ + "*47" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21206031, + "dbSnpId": "rs74064213", + "call": null, + "alleles": [ + "*43", + "*44" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21222355, + "dbSnpId": "rs71581941", + "call": null, + "alleles": [ + "*45", + "*46" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [ + "rs4149056T/rs4149056T" + ] + }, + { + "geneSymbol": "TPMT", + "chr": "chr6", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [ + { + "rule_name": "TPMT reverse complement footnote", + "version": "1", + "matches": { + "gene": "TPMT", + "hapsCalled": [], + "hapsMissing": [], + "variantsMissing": [], + "variant": "", + "dips": [], + "drugs": [] + }, + "exception_type": "footnote", + "message": "The TPMT gene is on the negative chromosomal strand, all genotype calls for TPMT in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases." + } + ], + "relatedDrugs": [ + { + "name": "azathioprine", + "guidelineId": "RxNorm:1256" + }, + { + "name": "mercaptopurine", + "guidelineId": "RxNorm:103" + }, + { + "name": "thioguanine", + "guidelineId": "RxNorm:10485" + } + ], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "TPMT", + "name": "*1", + "function": "Normal Function", + "reference": true + }, + "allele2": { + "gene": "TPMT", + "name": "*1", + "function": "Normal Function", + "reference": true + }, + "gene": "TPMT", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*1/*1" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "TPMT", + "name": "*1", + "function": "Normal Function", + "reference": true + }, + "allele2": { + "gene": "TPMT", + "name": "*1", + "function": "Normal Function", + "reference": true + }, + "gene": "TPMT", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*1/*1" + } + ], + "variants": [ + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18130687, + "dbSnpId": "rs1142345", + "call": "T|T", + "alleles": [ + "*3A", + "*3C", + "*41" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18130694, + "dbSnpId": "rs150900439", + "call": "T|T", + "alleles": [ + "*20" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18130725, + "dbSnpId": "rs72552736", + "call": "A|A", + "alleles": [ + "*7" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18130729, + "dbSnpId": "rs139392616", + "call": "C|C", + "alleles": [ + "*40" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18130758, + "dbSnpId": "rs398122996", + "call": "A|A", + "alleles": [ + "*37" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18130762, + "dbSnpId": "rs56161402", + "call": "C|C", + "alleles": [ + "*8" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18130772, + "dbSnpId": "rs377085266", + "call": "A|A", + "alleles": [ + "*25" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18130781, + "dbSnpId": "rs1800584", + "call": "C|C", + "alleles": [ + "*4" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18132136, + "dbSnpId": "rs72556347", + "call": "A|A", + "alleles": [ + "*26" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18132147, + "dbSnpId": "rs79901429", + "call": "A|A", + "alleles": [ + "*31" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18132163, + "dbSnpId": null, + "call": "C|C", + "alleles": [ + "*36" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18133845, + "dbSnpId": "rs75543815", + "call": "T|T", + "alleles": [ + "*6" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18133847, + "dbSnpId": "rs6921269", + "call": "C|C", + "alleles": [ + "*24" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18133870, + "dbSnpId": "rs772832951", + "call": "A|A", + "alleles": [ + "*38" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18133884, + "dbSnpId": "rs74423290", + "call": "G|G", + "alleles": [ + "*23" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18133887, + "dbSnpId": "rs201695576", + "call": "T|T", + "alleles": [ + "*44" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18133890, + "dbSnpId": "rs9333570", + "call": "C|C", + "alleles": [ + "*15" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18138969, + "dbSnpId": "rs144041067", + "call": "C|C", + "alleles": [ + "*16", + "*22" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18138970, + "dbSnpId": "rs112339338", + "call": "G|G", + "alleles": [ + "*33" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18138997, + "dbSnpId": "rs1800460", + "call": "C|C", + "alleles": [ + "*3A", + "*3B" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18139027, + "dbSnpId": "rs72552737", + "call": "C|C", + "alleles": [ + "*10" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18139689, + "dbSnpId": "rs72552738", + "call": "C|C", + "alleles": [ + "*11" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18139710, + "dbSnpId": "rs200220210", + "call": "G|G", + "alleles": [ + "*12" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18143597, + "dbSnpId": null, + "call": "T|T", + "alleles": [ + "*19" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18143606, + "dbSnpId": "rs151149760", + "call": "T|T", + "alleles": [ + "*9" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18143613, + "dbSnpId": null, + "call": "C|C", + "alleles": [ + "*28" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18143622, + "dbSnpId": "rs115106679", + "call": "C|C", + "alleles": [ + "*32" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18143643, + "dbSnpId": null, + "call": "A|A", + "alleles": [ + "*27" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18143700, + "dbSnpId": "rs753545734", + "call": "C|C", + "alleles": [ + "*43" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18143718, + "dbSnpId": "rs111901354", + "call": "G|G", + "alleles": [ + "*34" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18143724, + "dbSnpId": "rs1800462", + "call": "C|C", + "alleles": [ + "*2" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18143728, + "dbSnpId": "rs1256618794", + "call": "C|C", + "alleles": [ + "*43" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18147838, + "dbSnpId": "rs281874771", + "call": "G|G", + "alleles": [ + "*39" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18147845, + "dbSnpId": "rs777686348", + "call": "C|C", + "alleles": [ + "*18" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18147851, + "dbSnpId": "rs200591577", + "call": "G|G", + "alleles": [ + "*21" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18147856, + "dbSnpId": null, + "call": "A|A", + "alleles": [ + "*35" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18147910, + "dbSnpId": "rs72552740", + "call": "A|A", + "alleles": [ + "*5" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18149004, + "dbSnpId": null, + "call": "G|G", + "alleles": [ + "*17" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18149022, + "dbSnpId": "rs750424422", + "call": "C|C", + "alleles": [ + "*30" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18149032, + "dbSnpId": "rs759836180", + "call": "C|C", + "alleles": [ + "*42" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18149045, + "dbSnpId": "rs72552742", + "call": "T|T", + "alleles": [ + "*13" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18149126, + "dbSnpId": "rs267607275", + "call": "A|A", + "alleles": [ + "*29" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18149127, + "dbSnpId": "rs9333569", + "call": "T|T", + "alleles": [ + "*14" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "UGT1A1", + "chr": "chr2", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [ + { + "rule_name": "UGT1A1 repeat warning", + "version": "1", + "matches": { + "gene": "UGT1A1", + "hapsCalled": [], + "hapsMissing": [], + "variantsMissing": [], + "variant": "", + "dips": [], + "drugs": [] + }, + "exception_type": "footnote", + "message": "Some alleles in UGT1A1 are distinguished by a repeat sequence; some genotyping technologies may not accurately call the repeat." + } + ], + "relatedDrugs": [ + { + "name": "atazanavir", + "guidelineId": "RxNorm:343047" + } + ], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "UGT1A1", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "UGT1A1", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "gene": "UGT1A1", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*1/*1" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "UGT1A1", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "UGT1A1", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "gene": "UGT1A1", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*1/*1" + } + ], + "variants": [ + { + "gene": "UGT1A1", + "chromosome": "chr2", + "position": 233759924, + "dbSnpId": "rs887829", + "call": "C|C", + "alleles": [ + "*80", + "*80+*28", + "*80+*37" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "UGT1A1", + "chromosome": "chr2", + "position": 233760233, + "dbSnpId": "rs3064744", + "call": "CAT|CAT", + "alleles": [ + "*28", + "*36", + "*37", + "*80+*28", + "*80+*37" + ], + "phased": true, + "wildtypeAllele": "CAT", + "mismatch": false + }, + { + "gene": "UGT1A1", + "chromosome": "chr2", + "position": 233760498, + "dbSnpId": "rs4148323", + "call": "G|G", + "alleles": [ + "*6" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "UGT1A1", + "chromosome": "chr2", + "position": 233760973, + "dbSnpId": "rs35350960", + "call": "C|C", + "alleles": [ + "*27" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "VKORC1", + "chr": "chr16", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [ + { + "rule_name": "VKORC1", + "version": "1", + "matches": { + "gene": "VKORC1", + "hapsCalled": [], + "hapsMissing": [], + "variantsMissing": [], + "variant": "", + "dips": [], + "drugs": [] + }, + "exception_type": "footnote", + "message": "CPIC recommendations for warfarin use only rs9923231; however, other variants in VKORC1 may have functional consequences and may be more common in some populations." + }, + { + "rule_name": "VKORC1 reverse complement footnote", + "version": "1", + "matches": { + "gene": "VKORC1", + "hapsCalled": [], + "hapsMissing": [], + "variantsMissing": [], + "variant": "", + "dips": [], + "drugs": [] + }, + "exception_type": "footnote", + "message": "The VKORC1 gene is on the negative chromosomal strand, all genotype calls for VKORC1 in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases." + } + ], + "relatedDrugs": [ + { + "name": "warfarin", + "guidelineId": "RxNorm:11289" + } + ], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "VKORC1", + "name": "rs9923231 reference (C)", + "function": null, + "reference": true + }, + "allele2": { + "gene": "VKORC1", + "name": "rs9923231 reference (C)", + "function": null, + "reference": true + }, + "gene": "VKORC1", + "phenotype": null, + "variant": null, + "lookupKey": null, + "label": "rs9923231 reference (C)/rs9923231 reference (C)" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "VKORC1", + "name": "rs9923231 reference (C)", + "function": null, + "reference": true + }, + "allele2": { + "gene": "VKORC1", + "name": "rs9923231 reference (C)", + "function": null, + "reference": true + }, + "gene": "VKORC1", + "phenotype": null, + "variant": null, + "lookupKey": null, + "label": "rs9923231 reference (C)/rs9923231 reference (C)" + } + ], + "variants": [ + { + "gene": "VKORC1", + "chromosome": "chr16", + "position": 31096368, + "dbSnpId": "rs9923231", + "call": "C|C", + "alleles": [ + "rs9923231 variant (T)" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + } +] \ No newline at end of file diff -r 000000000000 -r 28aa54c800c0 test-data/test_2.html --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_2.html Fri Jan 28 21:17:56 2022 +0000 @@ -0,0 +1,69 @@ + + + + + + PharmCAT Allele Call Report for input.vcf + + + + + + + + + + + + + + + +
+

CACNA1S

  • Reference/Reference (4)
Definition Position201060815201091993
rs1800559rs772226819
VCF Position201060815201091993
VCF REF,ALTsC,TG,A
VCF CallC|CG|G
ReferenceCG
CG

CFTR

  • ivacaftor non-responsive CFTR sequence/ivacaftor non-responsive CFTR sequence (78)
Definition Position117509035117509069117509089117530953117530955117530974117530975117534318117534363117534368117535285117540270117540285117548795117587799117587800117587801117587805117587806117590409117594930117602868117603708117606695117611555117611595117611620117611640117611646117611649117611650117611663117614699117639961117642451117642472117642483117642528117664770
rs397508256rs368505753rs115545701rs113993958rs397508537rs77834169rs78655421rs80282562rs397508759rs397508761rs121908752rs77932196rs121908753rs74551128rs121908757rs121908755rs121909005rs121909013rs75527207rs397508288rs397508387rs80224560rs397508442rs141033578rs76151804rs150212784rs397508513rs121909020rs200321110rs202179988rs78769542rs186045772rs75541969rs75039782rs267606723rs74503330rs121909041rs11971167rs193922525
VCF Position117509035117509069117509089117530953117530955117530974117530975117534318117534363117534368117535285117540270117540285117548795117587799117587800117587801117587805117587806117590409117594930117602868117603708117606695117611555117611595117611620117611640117611646117611649117611650117611663117614699117639961117642451117642472117642483117642528117664770
VCF REF,ALTsG,AC,TC,TG,CC,AC,TG,AG,AG,AA,GT,GG,AG,AC,AA,CG,AT,GG,AG,AA,GG,TG,AC,TC,TA,GT,GA,CG,AG,AC,TG,AT,AG,CC,TG,AG,AT,CG,AG,A
VCF CallG|GC|CC|CG|GC|CC|CG|GG|GG|GA|AT|TG|GG|GC|CA|AG|GT|TG|GG|GA|AG|GG|GC|CC|CA|AT|TA|AG|GG|GC|CG|GT|TG|GC|CG|GG|GT|TG|GG|G
ivacaftor non-responsive CFTR sequenceGCCGCCGGGATGGCAGTGGAGGCCATAGGCGTGCGGTGG
GCCGCCGGGATGGCAGTGGAGGCCATAGGCGTGCGGTGG

CYP2B6

  • *1/*1 (70)
Definition Position4099122440991367409913694099138140991388409913904099139140991441410040154100412541004158410043034100437741004381410044064100691941006923410069364100696841007013410093504100935841010006410100884101010841012316410123394101246541012693410127404101280341016726410167784101680541016810
rs34223104rs34883432rs8192709rs33973337rs33980385rs33926104rs34284776rs35303484rs281864907rs36060847rs186335453rs139801276rs12721655rs35773040rs145884402rs3826711rs36056539rs3745274rs373489637rs36079186rs45482602rs2279343rs139029625rs34698757rs193922917rs28399499rs34826503rs34097093rs35979566rs193922918rs35010098rs3211369rs564083989rs3211371
VCF Position4099122440991367409913694099138140991388409913904099139140991441410040154100412541004158410043034100437741004381410044064100691941006923410069364100696841007013410093504100935841010006410100884101010841012316410123394101246541012693410127404101280341016726410167784101680541016810
VCF REF,ALTsT,CA,TC,TA,TA,GC,AG,CA,GT,AG,AG,TT,CA,GG,AG,TC,GC,TG,TT,GT,CC,AA,GG,CC,GC,AT,CC,TC,TT,AG,AC,AA,GG,AA,TC,A,T
VCF CallT|TA|AC|CA|AA|AC|CG|GA|AT|TG|GG|GT|TA|AG|GG|GC|CC|CG|GT|TT|TC|CA|AG|GC|CC|CT|TC|CC|CT|TG|GC|CA|AG|GA|AC|C
*1TACAACGATGGTAGGCCGTTCAGCCTCCTGCAGAC
TACAACGATGGTAGGCCGTTCAGCCTCCTGCAGAC

CYP2C19

  • *38/*38 (68)
Definition Position94761900947627069476271294762715947627559476276094762788947628569477510694775121947751609477518594775367947754169477542394775453947754899477550794780574947805799478065394781858947818599478194494781999948428619484286694842879948429959484999594852738948527659485278594852914
rs12248560rs28399504rs367543002rs367543003rs55752064rs17882687rs1564656981rs1564657013rs145328984rs1564660997rs118203756rs1288601658rs12769205rs41291556rs17885179rs72552267rs17884712rs58973490rs140278421rs370803989rs4986893rs6413438rs4244285rs375781227rs72558186rs138142612rs3758581rs118203757rs113934938rs17879685rs56337013rs192154563rs118203759rs55640102
VCF Position94761900947627069476271294762715947627559476276094762788947628569477510694775121947751609477518594775367947754169477542394775453947754899477550794780574947805799478065394781858947818599478194494781999948428619484286694842879948429959484999594852738948527659485278594852914
VCF REF,ALTsC,TA,GC,TT,CT,CA,CA,TA,GC,TC,TG,CA,GA,GT,CA,CG,AG,AG,AG,CG,AG,AC,TG,AG,AT,AG,AA,GG,AG,AC,TC,TC,TC,GA,C
VCF CallC|CA|AC|CT|TT|TA|AA|AA|AC|CC|CG|GA|AA|AT|TA|AG|GG|GG|GG|GG|GG|GC|CG|GG|GT|TG|GA|AG|GG|GC|CC|CC|CC|CA|A
*38CACTTAAACCGAATAGGGGGGCGGTGAGGCCCCA
CACTTAAACCGAATAGGGGGGCGGTGAGGCCCCA

CYP2C9

  • *1/*1 (132)
Definition Position949386839493873794938771949388039493882894941897949419159494195894941976949419829494201894942205949422169494223094942231949422339494223494942249949422549494225594942290949422919494230594942309949477829494778594947869949479079494791794947938949491299494914494949217949492809494928194972119949721239497213494972179949721809497223394981199949812019498122494981225949812309498125094981281949812969498129794981301949813029498130594981365949813719498604294986073949888529498885594988880949889179498892594988955949889849498902094989023
rs114071557rs67807361rs142240658rs2031308986rs564813580rs371055887rs72558187rs762239445rs1304490498rs774607211rs767576260rs12414460rs375805362rs72558189rs200965026rs199523631rs200183364rs1799853rs141489852rs754487195rs7900194rs72558190rs774550549rs1326630788rs2031531005rs2256871rs9332130rs9332131rs182132442rs72558192rs988617574rs1237225311rs57505750rs28371685rs367826293rs1274535931rs750820937rs749060448rs1057910rs56165452rs28371686rs1250577724rs578144976rs542577750rs764211126rs72558193rs776908257rs769942899rs202201137rs767284820rs781583846rs9332239rs868182778
VCF Position949386839493873794938771949388039493882894941897949419159494195894941976949419829494201894942205949422169494223094942231949422339494223494942249949422549494225594942290949422919494230594942309949477829494778594947869949479079494791794947938949491299494914494949217949492809494928194972119949721239497213494972179949721809497223394981199949812019498122494981225949812309498125094981281949812969498129794981301949813029498130594981365949813719498604294986073949888529498885594988880949889179498892594988955949889849498902094989023
VCF REF,ALTsA,GC,AC,TA,GA,GG,CG,AT,CG,CG,TT,CCAATGGAAAGA,CA,GC,TG,AC,TG,A,TC,G,TC,TG,AC,TG,AG,AG,A,TC,AC,TA,GA,CT,CA,TA,GC,TA,GA,GGA,GC,AC,GA,GA,GC,GC,TG,TT,CC,TG,AC,AC,AG,AA,CT,CC,GC,AC,GC,TG,AA,GA,CC,TA,TG,TG,CA,GT,CG,AC,TG,T
VCF CallA|AC|CC|CA|AA|AG|GG|GT|TG|GG|GT|TCAATGGAAAGA|CAATGGAAAGAA|AC|CG|GC|CG|GC|CC|CG|GC|CG|GG|GG|GC|CC|CA|AA|AT|TA|AA|AC|CA|AA|AGA|GAC|CC|CA|AA|AC|CC|CG|GT|TC|CG|GC|CC|CG|GA|AT|TC|CC|CC|CC|CG|GA|AA|AC|CA|AG|GG|GA|AT|TG|GC|CG|G
*1ACCAAGGTGGTCAATGGAAAGAACGCGCCGCGGGCCAATAACAAGACCAACCGTCGCCGATCCCCGAACAGGATGCG
ACCAAGGTGGTCAATGGAAAGAACGCGCCGCGGGCCAATAACAAGACCAACCGTCGCCGATCCCCGAACAGGATGCG

There were 4 missing positions from the VCF file:

  • 94942306 (g.94942306C>T)
  • 94942308 (g.94942308C>T)
  • 94947439 (g.94947439G>T)
  • 94986136 (g.94986136A>C)

The following haplotype(s) were eliminated from consideration:

  • *72
  • *73
  • *74
  • *75

The following haplotypes were called even though tag positions were missing:

  • Called *1 without g.94942306C>T, g.94942308C>T, g.94947439G>T, g.94986136A>C

CYP3A5

  • *1/*1 (16)
Definition Position9965261399652770996605169966521299665237996669509967291699676198
rs28365083rs41303343rs28383479rs10264272rs56411402rs55965422rs776746rs55817950
VCF Position9965261399652770996605169966521299665237996669509967291699676198
VCF REF,ALTsG,TT,TAC,TC,TT,CA,GT,CG,A
VCF CallG|GT|TC|CC|CT|TA|AT|TG|G
*1GTCCTATG
GTCCTATG

CYP4F2

  • *1/*1 (4)
Definition Position1587962115897578
rs2108622rs3093105
VCF Position1587962115897578
VCF REF,ALTsC,TA,C
VCF CallC|CA|A
*1CA
CA

DPYD

  • Reference/Reference (166)
Definition Position9707898797078993970790059707907197079076970790779707912197079133970791399708236597082391970985989709859997098616970986329719310997193209972349589723499197305279973053639730536497305372973061959737359897373629973824619745005897450059974500659745006897450168974501879745018997450190975157849751578797515839975158519751586597515889975159239754956597549600975496099754968197549713975497269754973597573785975738059757382197573839975738639757388197573918975739199757394397579893975932389759328997593322975933439759337997595083975950889759514997679170976917769769939997699430976994749769950697699533976995359772154297721650977404009774041097883329978833529788335397883368
rs114096998rs148799944rs140114515rs1801268rs139459586rs202144771rs72547601rs72547602rs145529148rs141044036rs67376798rs1801267rs147545709rs55674432rs201035051rs60139309rs200687447rs199634007rs56005131rs112766203rs60511679rs1801160rs146529561rs145548112rs137999090rs138545885rs55971861rs3918290rs3918289rs72549303rs17376848rs147601618rs145773863rs138616379rs59086055rs201615754rs55886062rs1801159rs142619737rs1801158rs190951787rs148994843rs138391898rs111858276rs72549304rs199549923rs57918000rs144395748rs72975710rs186169810rs142512579rs764666241rs200064537rs56038477rs61622928rs143815742rs140602333rs78060119rs75017182rs72549305rs143154602rs183385770rs72549306rs201018345rs145112791rs150437414rs146356975rs45589337rs1801266rs72549307rs72549308rs115232898rs6670886rs139834141rs2297595rs200562975rs141462178rs150385342rs72549309rs1801265rs80081766rs72549310rs150036960
VCF Position9707898797078993970790059707907197079076970790779707912197079133970791399708236597082391970985989709859997098616970986329719310997193209972349589723499197305279973053639730536497305372973061959737359897373629973824619745005897450059974500659745006897450168974501879745018997450190975157849751578797515839975158519751586597515889975159239754956597549600975496099754968197549713975497269754973597573785975738059757382197573839975738639757388197573918975739199757394397579893975932389759328997593322975933439759337997595083975950889759514997679170976917769769939997699430976994749769950697699533976995359772154297721650977404009774041097883329978833529788335397883368
VCF REF,ALTsG,TC,GC,TC,AA,CG,AT,CT,AT,CT,CT,AC,TG,AC,AT,GT,CC,TG,TG,TG,AA,CC,TG,AC,TC,TC,AT,GC,TG,CTG,TA,GA,GC,TC,TG,AC,AA,CT,CC,TC,TG,CC,TC,TT,CG,AG,TG,AG,CG,AA,CC,TC,AA,TC,TC,TC,AG,AC,AG,CT,CG,AC,TC,AC,TG,AA,GT,CT,CG,AT,CT,GT,CC,TC,TT,CT,CT,CC,TGATGA,GA,GC,TG,AG,C
VCF CallG|GC|CC|CC|CA|AG|GT|TT|TT|TT|TT|TC|CG|GC|CT|TT|TC|CG|GG|GG|GA|AC|CG|GC|CC|CC|CT|TC|CG|GTG|TGA|AA|AC|CC|CG|GC|CA|AT|TC|CC|CG|GC|CC|CT|TG|GG|GG|GG|GG|GA|AC|CC|CA|AC|CC|CC|CG|GC|CG|GT|TG|GC|CC|CC|CG|GA|AT|TT|TG|GT|TT|TT|TC|CC|CT|TT|TT|TC|CGATGA|GATGAA|AC|CG|GG|G
ReferenceGCCCAGTTTTTCGCTTCGGGACGCCCTCGTGAACCGCATCCGCCTGGGGGACCACCCGCGTGCCCGATTGTTTCCTTTCGATGAACGG
GCCCAGTTTTTCGCTTCGGGACGCCCTCGTGAACCGCATCCGCCTGGGGGACCACCCGCGTGCCCGATTGTTTCCTTTCGATGAACGG

IFNL3

  • rs12979860 reference (C)/rs12979860 reference (C) (2)
Definition Position39248147
rs12979860
VCF Position39248147
VCF REF,ALTsC,T
VCF CallC|C
rs12979860 reference (C)C
C

NUDT15

  • *1/*1 (34)
Definition Position4803774848037749480377824803779848037825480378344803784748037849480378854803790248040977480411034804111348045690480457194804572048045771
rs769369441rs746071566rs186364861rs777311140rs1202487323rs766023281rs1950545307rs149436418rs1457579126rs761191455rs1368252918rs768324690rs116855232rs147390019rs139551410
VCF Position4803774848037749480377824803779848037825480378344803784748037849480378854803790248040977480411034804111348045690480457194804572048045771
VCF REF,ALTsT,CG,CAGGAGTC,A,AGGAGTCGGAGTCG,AC,CGCGGC,TG,CA,GG,AC,GGA,GT,TGG,TC,GC,TG,AT,A
VCF CallT|TG|GAGGAGTC|AGGAGTCG|GC|CC|CG|GA|AG|GC|CGA|GAT|TG|GC|CC|CG|GT|T
*1TGAGGAGTCGCCGAGCGATGCCGT
TGAGGAGTCGCCGAGCGATGCCGT

RYR1

  • Reference/Reference (88)
Definition Position3844080238440829384442113844421238446710384486733844871238451842384518503845535938455463384554713845547238455528384575453845754638494564384945653849457938496283384992233849964438499655384996703849973138499975384999933849999738500636385006423850064338500654385006553850089838500899385123213854383238580004385800943858011438580370385804033858044038584989
rs193922747rs193922748rs118192161rs193922753rs1801086rs193922762rs121918592rs193922764rs118192116rs118192162rs111888148rs193922768rs144336148rs193922770rs118192172rs193922772rs118192175rs118192163rs118192176rs118192177rs112563513rs121918596rs193922802rs193922803rs193922807rs193922809rs121918593rs28933396rs118192124rs193922816rs118192122rs28933397rs121918594rs118192178rs193922818rs193922832rs193922843rs118192167rs121918595rs193922876rs193922878rs118192168rs63749869rs118192170
VCF Position3844080238440829384442113844421238446710384486733844871238451842384518503845535938455463384554713845547238455528384575453845754638494564384945653849457938496283384992233849964438499655384996703849973138499975384999933849999738500636385006423850064338500654385006553850089838500899385123213854383238580004385800943858011438580370385804033858044038584989
VCF REF,ALTsT,CC,TC,TG,TG,A,CC,TG,A,CC,TC,GA,CG,AC,TG,AC,TC,TG,TC,TG,AG,AC,G,TG,ATGGA,TG,AC,TG,CG,AG,AG,AC,TC,TG,AC,TG,AC,G,TG,AG,AG,TA,GC,TC,TC,GG,AG,AT,C
VCF CallT|TC|CC|CG|GG|GC|CG|GC|CC|CA|AG|GC|CG|GC|CC|CG|GC|CG|GG|GC|CG|GTGGA|TGGAG|GC|CG|GG|GG|GG|GC|CC|CG|GC|CG|GC|CG|GG|GG|GA|AC|CC|CC|CG|GG|GT|T
ReferenceTCCGGCGCCAGCGCCGCGGCGTGGAGCGGGGCCGCGCGGGACCCGGT
TCCGGCGCCAGCGCCGCGGCGTGGAGCGGGGCCGCGCGGGACCCGGT

SLCO1B1

  • *1/*1 (48)
Definition Position211727342117277621172782211745952117680421176868211768792117688321178615211789572119695121196976212005952120255321202555212026492120266421205921212059992123904221239077212391132123914521239158
rs139257324rs373327528rs56101265rs56061388rs2306283rs2306282rs11045819rs72559745rs4149056rs79135870rs11045852rs11045853rs55901008rs1228465562rs59113707rs56387224rs142965323rs72559748rs59502379rs34671512rs56199088rs55737008rs200995543rs140790673
VCF Position211727342117277621172782211745952117680421176868211768792117688321178615211789572119695121196976212005952120255321202555212026492120266421205921212059992123904221239077212391132123914521239158
VCF REF,ALTsC,TG,AT,CT,CA,GA,GC,AA,GT,CA,GA,GG,AT,CT,GC,GA,GG,AA,GG,CA,CA,GA,GC,TC,T
VCF CallC|CG|GT|TT|TA|AA|AC|CA|AT|TA|AA|AG|GT|TT|TC|CA|AG|GA|AG|GA|AA|AA|AC|CC|C
*1CGTTAACATAAGTTCAGAGAAACC
CGTTAACATAAGTTCAGAGAAACC

There were 7 missing positions from the VCF file:

  • 21176871 (g.21176871G>A)
  • 21176898 (g.21176898G>T)
  • 21178612 (g.21178612A>G)
  • 21196975 (g.21196975C>T)
  • 21200544 (g.21200544C>G)
  • 21206031 (g.21206031A>G)
  • 21222355 (g.21222355C>T)

The following haplotype(s) were eliminated from consideration:

  • *41
  • *45
  • *38

The following haplotypes were called even though tag positions were missing:

  • Called *1 without g.21176871G>A, g.21176898G>T, g.21178612A>G, g.21196975C>T, g.21200544C>G, g.21206031A>G, g.21222355C>T

TPMT

  • *1/*1 (86)
Definition Position18130687181306941813072518130729181307581813076218130772181307811813213618132147181321631813384518133847181338701813388418133887181338901813896918138970181389971813902718139689181397101814359718143606181436131814362218143643181437001814371818143724181437281814783818147845181478511814785618147910181490041814902218149032181490451814912618149127
rs1142345rs150900439rs72552736rs139392616rs398122996rs56161402rs377085266rs1800584rs72556347rs79901429rs75543815rs6921269rs772832951rs74423290rs201695576rs9333570rs144041067rs112339338rs1800460rs72552737rs72552738rs200220210rs151149760rs115106679rs753545734rs111901354rs1800462rs1256618794rs281874771rs777686348rs200591577rs72552740rs750424422rs759836180rs72552742rs267607275rs9333569
VCF Position18130687181306941813072518130729181307581813076218130772181307811813213618132147181321631813384518133847181338701813388418133887181338901813896918138970181389971813902718139689181397101814359718143606181436131814362218143643181437001814371818143724181437281814783818147845181478511814785618147910181490041814902218149032181490451814912618149127
VCF REF,ALTsT,C,GT,CA,CC,TA,TC,TA,GC,TA,GA,GC,TT,AC,AA,GG,CT,CC,TC,G,TG,AC,TC,GC,TG,AT,GT,GC,GC,TA,CC,TG,AC,GC,AG,AC,TG,CA,GA,GG,CC,TC,CTT,AA,GT,C
VCF CallT|TT|TA|AC|CA|AC|CA|AC|CA|AA|AC|CT|TC|CA|AG|GT|TC|CC|CG|GC|CC|CC|CG|GT|TT|TC|CC|CA|AC|CG|GC|CC|CG|GC|CG|GA|AA|AG|GC|CC|CT|TA|AT|T
*1TTACACACAACTCAGTCCGCCCGTTCCACGCCGCGAAGCCTAT
TTACACACAACTCAGTCCGCCCGTTCCACGCCGCGAAGCCTAT

UGT1A1

  • *1/*1 (8)
Definition Position233759924233760233233760498233760973
rs887829rs3064744rs4148323rs35350960
VCF Position233759924233760233233760498233760973
VCF REF,ALTsC,TCAT,C,CATAT,CATATATG,AC,A
VCF CallC|CCAT|CATG|GC|C
*1CCATGC
CCATGC

VKORC1

  • rs9923231 reference (C)/rs9923231 reference (C) (2)
Definition Position31096368
rs9923231
VCF Position31096368
VCF REF,ALTsC,T
VCF CallC|C
rs9923231 reference (C)C
C
+
+
+
+
+ +

Generated on 01/27/22.

+ +
+
+ + + + + + diff -r 000000000000 -r 28aa54c800c0 test-data/test_2.json --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_2.json Fri Jan 28 21:17:56 2022 +0000 @@ -0,0 +1,2867 @@ +{ + "metadata": { + "namedAlleleMatcherVersion": "1.0.0", + "genomeBuild": "GRCh38.p13", + "inputFilename": "input.vcf", + "timestamp": "Jan 27, 2022, 11:53:07 PM" + }, + "results": [ + { + "alleleDefinitionVersion": "01/10/22", + "chromosome": "chr1", + "gene": "CACNA1S", + "diplotypes": [ + { + "name": "Reference/Reference", + "haplotype1": { + "name": "Reference", + "sequences": [ + "201060815:C;201091993:G;" + ] + }, + "haplotype2": { + "name": "Reference", + "sequences": [ + "201060815:C;201091993:G;" + ] + }, + "score": 4 + } + ], + "haplotypes": [ + { + "name": "Reference", + "sequences": [ + "201060815:C;201091993:G;" + ] + } + ], + "phased": true, + "variants": [ + { + "position": 201060815, + "rsid": "rs1800559", + "vcfCall": "C|C" + }, + { + "position": 201091993, + "rsid": "rs772226819", + "vcfCall": "G|G" + } + ], + "variantsOfInterest": [], + "matchData": { + "missingPositions": [], + "mismatchedAlleles": [] + }, + "uncallableHaplotypes": [], + "ignoredHaplotypes": [] + }, + { + "alleleDefinitionVersion": "01/10/22", + "chromosome": "chr7", + "gene": "CFTR", + "diplotypes": [ + { + "name": "ivacaftor non-responsive CFTR sequence/ivacaftor non-responsive CFTR sequence", + "haplotype1": { + "name": "ivacaftor non-responsive CFTR sequence", + "sequences": [ + "117509035:G;117509069:C;117509089:C;117530953:G;117530955:C;117530974:C;117530975:G;117534318:G;117534363:G;117534368:A;117535285:T;117540270:G;117540285:G;117548795:C;117587799:A;117587800:G;117587801:T;117587805:G;117587806:G;117590409:A;117594930:G;117602868:G;117603708:C;117606695:C;117611555:A;117611595:T;117611620:A;117611640:G;117611646:G;117611649:C;117611650:G;117611663:T;117614699:G;117639961:C;117642451:G;117642472:G;117642483:T;117642528:G;117664770:G;" + ] + }, + "haplotype2": { + "name": "ivacaftor non-responsive CFTR sequence", + "sequences": [ + "117509035:G;117509069:C;117509089:C;117530953:G;117530955:C;117530974:C;117530975:G;117534318:G;117534363:G;117534368:A;117535285:T;117540270:G;117540285:G;117548795:C;117587799:A;117587800:G;117587801:T;117587805:G;117587806:G;117590409:A;117594930:G;117602868:G;117603708:C;117606695:C;117611555:A;117611595:T;117611620:A;117611640:G;117611646:G;117611649:C;117611650:G;117611663:T;117614699:G;117639961:C;117642451:G;117642472:G;117642483:T;117642528:G;117664770:G;" + ] + }, + "score": 78 + } + ], + "haplotypes": [ + { + "name": "ivacaftor non-responsive CFTR sequence", + "sequences": [ + "117509035:G;117509069:C;117509089:C;117530953:G;117530955:C;117530974:C;117530975:G;117534318:G;117534363:G;117534368:A;117535285:T;117540270:G;117540285:G;117548795:C;117587799:A;117587800:G;117587801:T;117587805:G;117587806:G;117590409:A;117594930:G;117602868:G;117603708:C;117606695:C;117611555:A;117611595:T;117611620:A;117611640:G;117611646:G;117611649:C;117611650:G;117611663:T;117614699:G;117639961:C;117642451:G;117642472:G;117642483:T;117642528:G;117664770:G;" + ] + } + ], + "phased": true, + "variants": [ + { + "position": 117509035, + "rsid": "rs397508256", + "vcfCall": "G|G" + }, + { + "position": 117509069, + "rsid": "rs368505753", + "vcfCall": "C|C" + }, + { + "position": 117509089, + "rsid": "rs115545701", + "vcfCall": "C|C" + }, + { + "position": 117530953, + "rsid": "rs113993958", + "vcfCall": "G|G" + }, + { + "position": 117530955, + "rsid": "rs397508537", + "vcfCall": "C|C" + }, + { + "position": 117530974, + "rsid": "rs77834169", + "vcfCall": "C|C" + }, + { + "position": 117530975, + "rsid": "rs78655421", + "vcfCall": "G|G" + }, + { + "position": 117534318, + "rsid": "rs80282562", + "vcfCall": "G|G" + }, + { + "position": 117534363, + "rsid": "rs397508759", + "vcfCall": "G|G" + }, + { + "position": 117534368, + "rsid": "rs397508761", + "vcfCall": "A|A" + }, + { + "position": 117535285, + "rsid": "rs121908752", + "vcfCall": "T|T" + }, + { + "position": 117540270, + "rsid": "rs77932196", + "vcfCall": "G|G" + }, + { + "position": 117540285, + "rsid": "rs121908753", + "vcfCall": "G|G" + }, + { + "position": 117548795, + "rsid": "rs74551128", + "vcfCall": "C|C" + }, + { + "position": 117587799, + "rsid": "rs121908757", + "vcfCall": "A|A" + }, + { + "position": 117587800, + "rsid": "rs121908755", + "vcfCall": "G|G" + }, + { + "position": 117587801, + "rsid": "rs121909005", + "vcfCall": "T|T" + }, + { + "position": 117587805, + "rsid": "rs121909013", + "vcfCall": "G|G" + }, + { + "position": 117587806, + "rsid": "rs75527207", + "vcfCall": "G|G" + }, + { + "position": 117590409, + "rsid": "rs397508288", + "vcfCall": "A|A" + }, + { + "position": 117594930, + "rsid": "rs397508387", + "vcfCall": "G|G" + }, + { + "position": 117602868, + "rsid": "rs80224560", + "vcfCall": "G|G" + }, + { + "position": 117603708, + "rsid": "rs397508442", + "vcfCall": "C|C" + }, + { + "position": 117606695, + "rsid": "rs141033578", + "vcfCall": "C|C" + }, + { + "position": 117611555, + "rsid": "rs76151804", + "vcfCall": "A|A" + }, + { + "position": 117611595, + "rsid": "rs150212784", + "vcfCall": "T|T" + }, + { + "position": 117611620, + "rsid": "rs397508513", + "vcfCall": "A|A" + }, + { + "position": 117611640, + "rsid": "rs121909020", + "vcfCall": "G|G" + }, + { + "position": 117611646, + "rsid": "rs200321110", + "vcfCall": "G|G" + }, + { + "position": 117611649, + "rsid": "rs202179988", + "vcfCall": "C|C" + }, + { + "position": 117611650, + "rsid": "rs78769542", + "vcfCall": "G|G" + }, + { + "position": 117611663, + "rsid": "rs186045772", + "vcfCall": "T|T" + }, + { + "position": 117614699, + "rsid": "rs75541969", + "vcfCall": "G|G" + }, + { + "position": 117639961, + "rsid": "rs75039782", + "vcfCall": "C|C" + }, + { + "position": 117642451, + "rsid": "rs267606723", + "vcfCall": "G|G" + }, + { + "position": 117642472, + "rsid": "rs74503330", + "vcfCall": "G|G" + }, + { + "position": 117642483, + "rsid": "rs121909041", + "vcfCall": "T|T" + }, + { + "position": 117642528, + "rsid": "rs11971167", + "vcfCall": "G|G" + }, + { + "position": 117664770, + "rsid": "rs193922525", + "vcfCall": "G|G" + } + ], + "variantsOfInterest": [], + "matchData": { + "missingPositions": [], + "mismatchedAlleles": [] + }, + "uncallableHaplotypes": [], + "ignoredHaplotypes": [] + }, + { + "alleleDefinitionVersion": "01/10/22", + "chromosome": "chr19", + "gene": "CYP2B6", + "diplotypes": [ + { + "name": "*1/*1", + "haplotype1": { + "name": "*1", + "sequences": [ + "40991224:T;40991367:A;40991369:C;40991381:A;40991388:A;40991390:C;40991391:G;40991441:A;41004015:T;41004125:G;41004158:G;41004303:T;41004377:A;41004381:G;41004406:G;41006919:C;41006923:C;41006936:G;41006968:T;41007013:T;41009350:C;41009358:A;41010006:G;41010088:C;41010108:C;41012316:T;41012339:C;41012465:C;41012693:T;41012740:G;41012803:C;41016726:A;41016778:G;41016805:A;41016810:C;" + ] + }, + "haplotype2": { + "name": "*1", + "sequences": [ + "40991224:T;40991367:A;40991369:C;40991381:A;40991388:A;40991390:C;40991391:G;40991441:A;41004015:T;41004125:G;41004158:G;41004303:T;41004377:A;41004381:G;41004406:G;41006919:C;41006923:C;41006936:G;41006968:T;41007013:T;41009350:C;41009358:A;41010006:G;41010088:C;41010108:C;41012316:T;41012339:C;41012465:C;41012693:T;41012740:G;41012803:C;41016726:A;41016778:G;41016805:A;41016810:C;" + ] + }, + "score": 70 + } + ], + "haplotypes": [ + { + "name": "*1", + "sequences": [ + "40991224:T;40991367:A;40991369:C;40991381:A;40991388:A;40991390:C;40991391:G;40991441:A;41004015:T;41004125:G;41004158:G;41004303:T;41004377:A;41004381:G;41004406:G;41006919:C;41006923:C;41006936:G;41006968:T;41007013:T;41009350:C;41009358:A;41010006:G;41010088:C;41010108:C;41012316:T;41012339:C;41012465:C;41012693:T;41012740:G;41012803:C;41016726:A;41016778:G;41016805:A;41016810:C;" + ] + } + ], + "phased": true, + "variants": [ + { + "position": 40991224, + "rsid": "rs34223104", + "vcfCall": "T|T" + }, + { + "position": 40991367, + "rsid": "rs34883432", + "vcfCall": "A|A" + }, + { + "position": 40991369, + "rsid": "rs8192709", + "vcfCall": "C|C" + }, + { + "position": 40991381, + "rsid": "rs33973337", + "vcfCall": "A|A" + }, + { + "position": 40991388, + "rsid": "rs33980385", + "vcfCall": "A|A" + }, + { + "position": 40991390, + "rsid": "rs33926104", + "vcfCall": "C|C" + }, + { + "position": 40991391, + "rsid": "rs34284776", + "vcfCall": "G|G" + }, + { + "position": 40991441, + "rsid": "rs35303484", + "vcfCall": "A|A" + }, + { + "position": 41004015, + "rsid": "rs281864907", + "vcfCall": "T|T" + }, + { + "position": 41004125, + "rsid": "rs36060847", + "vcfCall": "G|G" + }, + { + "position": 41004158, + "rsid": "rs186335453", + "vcfCall": "G|G" + }, + { + "position": 41004303, + "rsid": "rs139801276", + "vcfCall": "T|T" + }, + { + "position": 41004377, + "rsid": "rs12721655", + "vcfCall": "A|A" + }, + { + "position": 41004381, + "rsid": "rs35773040", + "vcfCall": "G|G" + }, + { + "position": 41004406, + "rsid": "rs145884402", + "vcfCall": "G|G" + }, + { + "position": 41006919, + "rsid": "rs3826711", + "vcfCall": "C|C" + }, + { + "position": 41006923, + "rsid": "rs36056539", + "vcfCall": "C|C" + }, + { + "position": 41006936, + "rsid": "rs3745274", + "vcfCall": "G|G" + }, + { + "position": 41006968, + "rsid": "rs373489637", + "vcfCall": "T|T" + }, + { + "position": 41007013, + "rsid": "rs36079186", + "vcfCall": "T|T" + }, + { + "position": 41009350, + "rsid": "rs45482602", + "vcfCall": "C|C" + }, + { + "position": 41009358, + "rsid": "rs2279343", + "vcfCall": "A|A" + }, + { + "position": 41010006, + "rsid": "rs139029625", + "vcfCall": "G|G" + }, + { + "position": 41010088, + "rsid": "rs34698757", + "vcfCall": "C|C" + }, + { + "position": 41010108, + "rsid": "rs193922917", + "vcfCall": "C|C" + }, + { + "position": 41012316, + "rsid": "rs28399499", + "vcfCall": "T|T" + }, + { + "position": 41012339, + "rsid": "rs34826503", + "vcfCall": "C|C" + }, + { + "position": 41012465, + "rsid": "rs34097093", + "vcfCall": "C|C" + }, + { + "position": 41012693, + "rsid": "rs35979566", + "vcfCall": "T|T" + }, + { + "position": 41012740, + "rsid": "rs193922918", + "vcfCall": "G|G" + }, + { + "position": 41012803, + "rsid": "rs35010098", + "vcfCall": "C|C" + }, + { + "position": 41016726, + "rsid": "rs3211369", + "vcfCall": "A|A" + }, + { + "position": 41016778, + "rsid": "rs564083989", + "vcfCall": "G|G" + }, + { + "position": 41016805, + "rsid": null, + "vcfCall": "A|A" + }, + { + "position": 41016810, + "rsid": "rs3211371", + "vcfCall": "C|C" + } + ], + "variantsOfInterest": [], + "matchData": { + "missingPositions": [], + "mismatchedAlleles": [] + }, + "uncallableHaplotypes": [], + "ignoredHaplotypes": [] + }, + { + "alleleDefinitionVersion": "01/10/22", + "chromosome": "chr10", + "gene": "CYP2C19", + "diplotypes": [ + { + "name": "*38/*38", + "haplotype1": { + "name": "*38", + "sequences": [ + "94761900:C;94762706:A;94762712:C;94762715:T;94762755:T;94762760:A;94762788:A;94762856:A;94775106:C;94775121:C;94775160:G;94775185:A;94775367:A;94775416:T;94775423:A;94775453:G;94775489:G;94775507:G;94780574:G;94780579:G;94780653:G;94781858:C;94781859:G;94781944:G;94781999:T;94842861:G;94842866:A;94842879:G;94842995:G;94849995:C;94852738:C;94852765:C;94852785:C;94852914:A;" + ] + }, + "haplotype2": { + "name": "*38", + "sequences": [ + "94761900:C;94762706:A;94762712:C;94762715:T;94762755:T;94762760:A;94762788:A;94762856:A;94775106:C;94775121:C;94775160:G;94775185:A;94775367:A;94775416:T;94775423:A;94775453:G;94775489:G;94775507:G;94780574:G;94780579:G;94780653:G;94781858:C;94781859:G;94781944:G;94781999:T;94842861:G;94842866:A;94842879:G;94842995:G;94849995:C;94852738:C;94852765:C;94852785:C;94852914:A;" + ] + }, + "score": 68 + } + ], + "haplotypes": [ + { + "name": "*38", + "sequences": [ + "94761900:C;94762706:A;94762712:C;94762715:T;94762755:T;94762760:A;94762788:A;94762856:A;94775106:C;94775121:C;94775160:G;94775185:A;94775367:A;94775416:T;94775423:A;94775453:G;94775489:G;94775507:G;94780574:G;94780579:G;94780653:G;94781858:C;94781859:G;94781944:G;94781999:T;94842861:G;94842866:A;94842879:G;94842995:G;94849995:C;94852738:C;94852765:C;94852785:C;94852914:A;" + ] + } + ], + "phased": true, + "variants": [ + { + "position": 94761900, + "rsid": "rs12248560", + "vcfCall": "C|C" + }, + { + "position": 94762706, + "rsid": "rs28399504", + "vcfCall": "A|A" + }, + { + "position": 94762712, + "rsid": "rs367543002", + "vcfCall": "C|C" + }, + { + "position": 94762715, + "rsid": "rs367543003", + "vcfCall": "T|T" + }, + { + "position": 94762755, + "rsid": "rs55752064", + "vcfCall": "T|T" + }, + { + "position": 94762760, + "rsid": "rs17882687", + "vcfCall": "A|A" + }, + { + "position": 94762788, + "rsid": "rs1564656981", + "vcfCall": "A|A" + }, + { + "position": 94762856, + "rsid": "rs1564657013", + "vcfCall": "A|A" + }, + { + "position": 94775106, + "rsid": "rs145328984", + "vcfCall": "C|C" + }, + { + "position": 94775121, + "rsid": "rs1564660997", + "vcfCall": "C|C" + }, + { + "position": 94775160, + "rsid": "rs118203756", + "vcfCall": "G|G" + }, + { + "position": 94775185, + "rsid": "rs1288601658", + "vcfCall": "A|A" + }, + { + "position": 94775367, + "rsid": "rs12769205", + "vcfCall": "A|A" + }, + { + "position": 94775416, + "rsid": "rs41291556", + "vcfCall": "T|T" + }, + { + "position": 94775423, + "rsid": "rs17885179", + "vcfCall": "A|A" + }, + { + "position": 94775453, + "rsid": "rs72552267", + "vcfCall": "G|G" + }, + { + "position": 94775489, + "rsid": "rs17884712", + "vcfCall": "G|G" + }, + { + "position": 94775507, + "rsid": "rs58973490", + "vcfCall": "G|G" + }, + { + "position": 94780574, + "rsid": "rs140278421", + "vcfCall": "G|G" + }, + { + "position": 94780579, + "rsid": "rs370803989", + "vcfCall": "G|G" + }, + { + "position": 94780653, + "rsid": "rs4986893", + "vcfCall": "G|G" + }, + { + "position": 94781858, + "rsid": "rs6413438", + "vcfCall": "C|C" + }, + { + "position": 94781859, + "rsid": "rs4244285", + "vcfCall": "G|G" + }, + { + "position": 94781944, + "rsid": "rs375781227", + "vcfCall": "G|G" + }, + { + "position": 94781999, + "rsid": "rs72558186", + "vcfCall": "T|T" + }, + { + "position": 94842861, + "rsid": "rs138142612", + "vcfCall": "G|G" + }, + { + "position": 94842866, + "rsid": "rs3758581", + "vcfCall": "A|A" + }, + { + "position": 94842879, + "rsid": "rs118203757", + "vcfCall": "G|G" + }, + { + "position": 94842995, + "rsid": "rs113934938", + "vcfCall": "G|G" + }, + { + "position": 94849995, + "rsid": "rs17879685", + "vcfCall": "C|C" + }, + { + "position": 94852738, + "rsid": "rs56337013", + "vcfCall": "C|C" + }, + { + "position": 94852765, + "rsid": "rs192154563", + "vcfCall": "C|C" + }, + { + "position": 94852785, + "rsid": "rs118203759", + "vcfCall": "C|C" + }, + { + "position": 94852914, + "rsid": "rs55640102", + "vcfCall": "A|A" + } + ], + "variantsOfInterest": [], + "matchData": { + "missingPositions": [], + "mismatchedAlleles": [] + }, + "uncallableHaplotypes": [], + "ignoredHaplotypes": [] + }, + { + "alleleDefinitionVersion": "01/10/22", + "chromosome": "chr10", + "gene": "CYP2C9", + "diplotypes": [ + { + "name": "*1/*1", + "haplotype1": { + "name": "*1", + "sequences": [ + "94938683:A;94938737:C;94938771:C;94938803:A;94938828:A;94941897:G;94941915:G;94941958:T;94941976:G;94941982:G;94942018:T;94942205:CAATGGAAAGA;94942216:A;94942230:C;94942231:G;94942233:C;94942234:G;94942249:C;94942254:C;94942255:G;94942290:C;94942291:G;94942305:G;94942309:G;94947782:C;94947785:C;94947869:A;94947907:A;94947917:T;94947938:A;94949129:A;94949144:C;94949217:A;94949280:A;94949281:GA;94972119:C;94972123:C;94972134:A;94972179:A;94972180:C;94972233:C;94981199:G;94981201:T;94981224:C;94981225:G;94981230:C;94981250:C;94981281:G;94981296:A;94981297:T;94981301:C;94981302:C;94981305:C;94981365:C;94981371:G;94986042:A;94986073:A;94988852:C;94988855:A;94988880:G;94988917:G;94988925:A;94988955:T;94988984:G;94989020:C;94989023:G;" + ] + }, + "haplotype2": { + "name": "*1", + "sequences": [ + "94938683:A;94938737:C;94938771:C;94938803:A;94938828:A;94941897:G;94941915:G;94941958:T;94941976:G;94941982:G;94942018:T;94942205:CAATGGAAAGA;94942216:A;94942230:C;94942231:G;94942233:C;94942234:G;94942249:C;94942254:C;94942255:G;94942290:C;94942291:G;94942305:G;94942309:G;94947782:C;94947785:C;94947869:A;94947907:A;94947917:T;94947938:A;94949129:A;94949144:C;94949217:A;94949280:A;94949281:GA;94972119:C;94972123:C;94972134:A;94972179:A;94972180:C;94972233:C;94981199:G;94981201:T;94981224:C;94981225:G;94981230:C;94981250:C;94981281:G;94981296:A;94981297:T;94981301:C;94981302:C;94981305:C;94981365:C;94981371:G;94986042:A;94986073:A;94988852:C;94988855:A;94988880:G;94988917:G;94988925:A;94988955:T;94988984:G;94989020:C;94989023:G;" + ] + }, + "score": 132 + } + ], + "haplotypes": [ + { + "name": "*1", + "sequences": [ + "94938683:A;94938737:C;94938771:C;94938803:A;94938828:A;94941897:G;94941915:G;94941958:T;94941976:G;94941982:G;94942018:T;94942205:CAATGGAAAGA;94942216:A;94942230:C;94942231:G;94942233:C;94942234:G;94942249:C;94942254:C;94942255:G;94942290:C;94942291:G;94942305:G;94942309:G;94947782:C;94947785:C;94947869:A;94947907:A;94947917:T;94947938:A;94949129:A;94949144:C;94949217:A;94949280:A;94949281:GA;94972119:C;94972123:C;94972134:A;94972179:A;94972180:C;94972233:C;94981199:G;94981201:T;94981224:C;94981225:G;94981230:C;94981250:C;94981281:G;94981296:A;94981297:T;94981301:C;94981302:C;94981305:C;94981365:C;94981371:G;94986042:A;94986073:A;94988852:C;94988855:A;94988880:G;94988917:G;94988925:A;94988955:T;94988984:G;94989020:C;94989023:G;" + ] + } + ], + "phased": true, + "variants": [ + { + "position": 94938683, + "rsid": "rs114071557", + "vcfCall": "A|A" + }, + { + "position": 94938737, + "rsid": "rs67807361", + "vcfCall": "C|C" + }, + { + "position": 94938771, + "rsid": "rs142240658", + "vcfCall": "C|C" + }, + { + "position": 94938803, + "rsid": "rs2031308986", + "vcfCall": "A|A" + }, + { + "position": 94938828, + "rsid": "rs564813580", + "vcfCall": "A|A" + }, + { + "position": 94941897, + "rsid": "rs371055887", + "vcfCall": "G|G" + }, + { + "position": 94941915, + "rsid": null, + "vcfCall": "G|G" + }, + { + "position": 94941958, + "rsid": "rs72558187", + "vcfCall": "T|T" + }, + { + "position": 94941976, + "rsid": null, + "vcfCall": "G|G" + }, + { + "position": 94941982, + "rsid": "rs762239445", + "vcfCall": "G|G" + }, + { + "position": 94942018, + "rsid": null, + "vcfCall": "T|T" + }, + { + "position": 94942205, + "rsid": "rs1304490498", + "vcfCall": "CAATGGAAAGA|CAATGGAAAGA" + }, + { + "position": 94942216, + "rsid": "rs774607211", + "vcfCall": "A|A" + }, + { + "position": 94942230, + "rsid": "rs767576260", + "vcfCall": "C|C" + }, + { + "position": 94942231, + "rsid": "rs12414460", + "vcfCall": "G|G" + }, + { + "position": 94942233, + "rsid": "rs375805362", + "vcfCall": "C|C" + }, + { + "position": 94942234, + "rsid": "rs72558189", + "vcfCall": "G|G" + }, + { + "position": 94942249, + "rsid": "rs200965026", + "vcfCall": "C|C" + }, + { + "position": 94942254, + "rsid": "rs199523631", + "vcfCall": "C|C" + }, + { + "position": 94942255, + "rsid": "rs200183364", + "vcfCall": "G|G" + }, + { + "position": 94942290, + "rsid": "rs1799853", + "vcfCall": "C|C" + }, + { + "position": 94942291, + "rsid": "rs141489852", + "vcfCall": "G|G" + }, + { + "position": 94942305, + "rsid": "rs754487195", + "vcfCall": "G|G" + }, + { + "position": 94942309, + "rsid": "rs7900194", + "vcfCall": "G|G" + }, + { + "position": 94947782, + "rsid": "rs72558190", + "vcfCall": "C|C" + }, + { + "position": 94947785, + "rsid": "rs774550549", + "vcfCall": "C|C" + }, + { + "position": 94947869, + "rsid": null, + "vcfCall": "A|A" + }, + { + "position": 94947907, + "rsid": null, + "vcfCall": "A|A" + }, + { + "position": 94947917, + "rsid": "rs1326630788", + "vcfCall": "T|T" + }, + { + "position": 94947938, + "rsid": "rs2031531005", + "vcfCall": "A|A" + }, + { + "position": 94949129, + "rsid": null, + "vcfCall": "A|A" + }, + { + "position": 94949144, + "rsid": null, + "vcfCall": "C|C" + }, + { + "position": 94949217, + "rsid": "rs2256871", + "vcfCall": "A|A" + }, + { + "position": 94949280, + "rsid": "rs9332130", + "vcfCall": "A|A" + }, + { + "position": 94949281, + "rsid": "rs9332131", + "vcfCall": "GA|GA" + }, + { + "position": 94972119, + "rsid": "rs182132442", + "vcfCall": "C|C" + }, + { + "position": 94972123, + "rsid": null, + "vcfCall": "C|C" + }, + { + "position": 94972134, + "rsid": null, + "vcfCall": "A|A" + }, + { + "position": 94972179, + "rsid": "rs72558192", + "vcfCall": "A|A" + }, + { + "position": 94972180, + "rsid": "rs988617574", + "vcfCall": "C|C" + }, + { + "position": 94972233, + "rsid": "rs1237225311", + "vcfCall": "C|C" + }, + { + "position": 94981199, + "rsid": null, + "vcfCall": "G|G" + }, + { + "position": 94981201, + "rsid": "rs57505750", + "vcfCall": "T|T" + }, + { + "position": 94981224, + "rsid": "rs28371685", + "vcfCall": "C|C" + }, + { + "position": 94981225, + "rsid": "rs367826293", + "vcfCall": "G|G" + }, + { + "position": 94981230, + "rsid": "rs1274535931", + "vcfCall": "C|C" + }, + { + "position": 94981250, + "rsid": "rs750820937", + "vcfCall": "C|C" + }, + { + "position": 94981281, + "rsid": "rs749060448", + "vcfCall": "G|G" + }, + { + "position": 94981296, + "rsid": "rs1057910", + "vcfCall": "A|A" + }, + { + "position": 94981297, + "rsid": "rs56165452", + "vcfCall": "T|T" + }, + { + "position": 94981301, + "rsid": "rs28371686", + "vcfCall": "C|C" + }, + { + "position": 94981302, + "rsid": "rs1250577724", + "vcfCall": "C|C" + }, + { + "position": 94981305, + "rsid": "rs578144976", + "vcfCall": "C|C" + }, + { + "position": 94981365, + "rsid": null, + "vcfCall": "C|C" + }, + { + "position": 94981371, + "rsid": "rs542577750", + "vcfCall": "G|G" + }, + { + "position": 94986042, + "rsid": "rs764211126", + "vcfCall": "A|A" + }, + { + "position": 94986073, + "rsid": "rs72558193", + "vcfCall": "A|A" + }, + { + "position": 94988852, + "rsid": "rs776908257", + "vcfCall": "C|C" + }, + { + "position": 94988855, + "rsid": null, + "vcfCall": "A|A" + }, + { + "position": 94988880, + "rsid": null, + "vcfCall": "G|G" + }, + { + "position": 94988917, + "rsid": "rs769942899", + "vcfCall": "G|G" + }, + { + "position": 94988925, + "rsid": "rs202201137", + "vcfCall": "A|A" + }, + { + "position": 94988955, + "rsid": "rs767284820", + "vcfCall": "T|T" + }, + { + "position": 94988984, + "rsid": "rs781583846", + "vcfCall": "G|G" + }, + { + "position": 94989020, + "rsid": "rs9332239", + "vcfCall": "C|C" + }, + { + "position": 94989023, + "rsid": "rs868182778", + "vcfCall": "G|G" + } + ], + "variantsOfInterest": [ + { + "position": 94645745, + "rsid": "rs12777823", + "vcfCall": "G|G" + } + ], + "matchData": { + "missingPositions": [ + { + "chromosome": "chr10", + "position": 94942306, + "cpicPosition": 94942306, + "rsid": "rs1289704600", + "chromosomeHgvsName": "g.94942306C\u003eT", + "cpicAlleles": [ + "C", + "T" + ], + "cpicToVcfAlleleMap": { + "C": "C", + "T": "T" + }, + "ref": "C", + "alts": [ + "T" + ] + }, + { + "chromosome": "chr10", + "position": 94942308, + "cpicPosition": 94942308, + "rsid": "rs17847037", + "chromosomeHgvsName": "g.94942308C\u003eT", + "cpicAlleles": [ + "C", + "T" + ], + "cpicToVcfAlleleMap": { + "C": "C", + "T": "T" + }, + "ref": "C", + "alts": [ + "T" + ] + }, + { + "chromosome": "chr10", + "position": 94947439, + "cpicPosition": 94947439, + "rsid": null, + "chromosomeHgvsName": "g.94947439G\u003eT", + "cpicAlleles": [ + "G", + "T" + ], + "cpicToVcfAlleleMap": { + "T": "T", + "G": "G" + }, + "ref": "G", + "alts": [ + "T" + ] + }, + { + "chromosome": "chr10", + "position": 94986136, + "cpicPosition": 94986136, + "rsid": "rs1254213342", + "chromosomeHgvsName": "g.94986136A\u003eC", + "cpicAlleles": [ + "A", + "C" + ], + "cpicToVcfAlleleMap": { + "A": "A", + "C": "C" + }, + "ref": "A", + "alts": [ + "C" + ] + } + ], + "mismatchedAlleles": [] + }, + "uncallableHaplotypes": [ + "*72", + "*73", + "*74", + "*75" + ], + "ignoredHaplotypes": [] + }, + { + "alleleDefinitionVersion": "01/10/22", + "chromosome": "chr7", + "gene": "CYP3A5", + "diplotypes": [ + { + "name": "*1/*1", + "haplotype1": { + "name": "*1", + "sequences": [ + "99652613:G;99652770:T;99660516:C;99665212:C;99665237:T;99666950:A;99672916:T;99676198:G;" + ] + }, + "haplotype2": { + "name": "*1", + "sequences": [ + "99652613:G;99652770:T;99660516:C;99665212:C;99665237:T;99666950:A;99672916:T;99676198:G;" + ] + }, + "score": 16 + } + ], + "haplotypes": [ + { + "name": "*1", + "sequences": [ + "99652613:G;99652770:T;99660516:C;99665212:C;99665237:T;99666950:A;99672916:T;99676198:G;" + ] + } + ], + "phased": true, + "variants": [ + { + "position": 99652613, + "rsid": "rs28365083", + "vcfCall": "G|G" + }, + { + "position": 99652770, + "rsid": "rs41303343", + "vcfCall": "T|T" + }, + { + "position": 99660516, + "rsid": "rs28383479", + "vcfCall": "C|C" + }, + { + "position": 99665212, + "rsid": "rs10264272", + "vcfCall": "C|C" + }, + { + "position": 99665237, + "rsid": "rs56411402", + "vcfCall": "T|T" + }, + { + "position": 99666950, + "rsid": "rs55965422", + "vcfCall": "A|A" + }, + { + "position": 99672916, + "rsid": "rs776746", + "vcfCall": "T|T" + }, + { + "position": 99676198, + "rsid": "rs55817950", + "vcfCall": "G|G" + } + ], + "variantsOfInterest": [], + "matchData": { + "missingPositions": [], + "mismatchedAlleles": [] + }, + "uncallableHaplotypes": [], + "ignoredHaplotypes": [] + }, + { + "alleleDefinitionVersion": "01/10/22", + "chromosome": "chr19", + "gene": "CYP4F2", + "diplotypes": [ + { + "name": "*1/*1", + "haplotype1": { + "name": "*1", + "sequences": [ + "15879621:C;15897578:A;" + ] + }, + "haplotype2": { + "name": "*1", + "sequences": [ + "15879621:C;15897578:A;" + ] + }, + "score": 4 + } + ], + "haplotypes": [ + { + "name": "*1", + "sequences": [ + "15879621:C;15897578:A;" + ] + } + ], + "phased": true, + "variants": [ + { + "position": 15879621, + "rsid": "rs2108622", + "vcfCall": "C|C" + }, + { + "position": 15897578, + "rsid": "rs3093105", + "vcfCall": "A|A" + } + ], + "variantsOfInterest": [], + "matchData": { + "missingPositions": [], + "mismatchedAlleles": [] + }, + "uncallableHaplotypes": [], + "ignoredHaplotypes": [] + }, + { + "alleleDefinitionVersion": "01/10/22", + "chromosome": "chr1", + "gene": "DPYD", + "diplotypes": [ + { + "name": "Reference/Reference", + "haplotype1": { + "name": "Reference", + "sequences": [ + "97078987:G;97078993:C;97079005:C;97079071:C;97079076:A;97079077:G;97079121:T;97079133:T;97079139:T;97082365:T;97082391:T;97098598:C;97098599:G;97098616:C;97098632:T;97193109:T;97193209:C;97234958:G;97234991:G;97305279:G;97305363:A;97305364:C;97305372:G;97306195:C;97373598:C;97373629:C;97382461:T;97450058:C;97450059:G;97450065:TG;97450068:A;97450168:A;97450187:C;97450189:C;97450190:G;97515784:C;97515787:A;97515839:T;97515851:C;97515865:C;97515889:G;97515923:C;97549565:C;97549600:T;97549609:G;97549681:G;97549713:G;97549726:G;97549735:G;97573785:A;97573805:C;97573821:C;97573839:A;97573863:C;97573881:C;97573918:C;97573919:G;97573943:C;97579893:G;97593238:T;97593289:G;97593322:C;97593343:C;97593379:C;97595083:G;97595088:A;97595149:T;97679170:T;97691776:G;97699399:T;97699430:T;97699474:T;97699506:C;97699533:C;97699535:T;97721542:T;97721650:T;97740400:C;97740410:GATGA;97883329:A;97883352:C;97883353:G;97883368:G;" + ] + }, + "haplotype2": { + "name": "Reference", + "sequences": [ + "97078987:G;97078993:C;97079005:C;97079071:C;97079076:A;97079077:G;97079121:T;97079133:T;97079139:T;97082365:T;97082391:T;97098598:C;97098599:G;97098616:C;97098632:T;97193109:T;97193209:C;97234958:G;97234991:G;97305279:G;97305363:A;97305364:C;97305372:G;97306195:C;97373598:C;97373629:C;97382461:T;97450058:C;97450059:G;97450065:TG;97450068:A;97450168:A;97450187:C;97450189:C;97450190:G;97515784:C;97515787:A;97515839:T;97515851:C;97515865:C;97515889:G;97515923:C;97549565:C;97549600:T;97549609:G;97549681:G;97549713:G;97549726:G;97549735:G;97573785:A;97573805:C;97573821:C;97573839:A;97573863:C;97573881:C;97573918:C;97573919:G;97573943:C;97579893:G;97593238:T;97593289:G;97593322:C;97593343:C;97593379:C;97595083:G;97595088:A;97595149:T;97679170:T;97691776:G;97699399:T;97699430:T;97699474:T;97699506:C;97699533:C;97699535:T;97721542:T;97721650:T;97740400:C;97740410:GATGA;97883329:A;97883352:C;97883353:G;97883368:G;" + ] + }, + "score": 166 + } + ], + "haplotypes": [ + { + "name": "Reference", + "sequences": [ + "97078987:G;97078993:C;97079005:C;97079071:C;97079076:A;97079077:G;97079121:T;97079133:T;97079139:T;97082365:T;97082391:T;97098598:C;97098599:G;97098616:C;97098632:T;97193109:T;97193209:C;97234958:G;97234991:G;97305279:G;97305363:A;97305364:C;97305372:G;97306195:C;97373598:C;97373629:C;97382461:T;97450058:C;97450059:G;97450065:TG;97450068:A;97450168:A;97450187:C;97450189:C;97450190:G;97515784:C;97515787:A;97515839:T;97515851:C;97515865:C;97515889:G;97515923:C;97549565:C;97549600:T;97549609:G;97549681:G;97549713:G;97549726:G;97549735:G;97573785:A;97573805:C;97573821:C;97573839:A;97573863:C;97573881:C;97573918:C;97573919:G;97573943:C;97579893:G;97593238:T;97593289:G;97593322:C;97593343:C;97593379:C;97595083:G;97595088:A;97595149:T;97679170:T;97691776:G;97699399:T;97699430:T;97699474:T;97699506:C;97699533:C;97699535:T;97721542:T;97721650:T;97740400:C;97740410:GATGA;97883329:A;97883352:C;97883353:G;97883368:G;" + ] + } + ], + "phased": true, + "variants": [ + { + "position": 97078987, + "rsid": "rs114096998", + "vcfCall": "G|G" + }, + { + "position": 97078993, + "rsid": "rs148799944", + "vcfCall": "C|C" + }, + { + "position": 97079005, + "rsid": "rs140114515", + "vcfCall": "C|C" + }, + { + "position": 97079071, + "rsid": "rs1801268", + "vcfCall": "C|C" + }, + { + "position": 97079076, + "rsid": "rs139459586", + "vcfCall": "A|A" + }, + { + "position": 97079077, + "rsid": "rs202144771", + "vcfCall": "G|G" + }, + { + "position": 97079121, + "rsid": "rs72547601", + "vcfCall": "T|T" + }, + { + "position": 97079133, + "rsid": "rs72547602", + "vcfCall": "T|T" + }, + { + "position": 97079139, + "rsid": "rs145529148", + "vcfCall": "T|T" + }, + { + "position": 97082365, + "rsid": "rs141044036", + "vcfCall": "T|T" + }, + { + "position": 97082391, + "rsid": "rs67376798", + "vcfCall": "T|T" + }, + { + "position": 97098598, + "rsid": "rs1801267", + "vcfCall": "C|C" + }, + { + "position": 97098599, + "rsid": "rs147545709", + "vcfCall": "G|G" + }, + { + "position": 97098616, + "rsid": "rs55674432", + "vcfCall": "C|C" + }, + { + "position": 97098632, + "rsid": "rs201035051", + "vcfCall": "T|T" + }, + { + "position": 97193109, + "rsid": "rs60139309", + "vcfCall": "T|T" + }, + { + "position": 97193209, + "rsid": "rs200687447", + "vcfCall": "C|C" + }, + { + "position": 97234958, + "rsid": "rs199634007", + "vcfCall": "G|G" + }, + { + "position": 97234991, + "rsid": "rs56005131", + "vcfCall": "G|G" + }, + { + "position": 97305279, + "rsid": "rs112766203", + "vcfCall": "G|G" + }, + { + "position": 97305363, + "rsid": "rs60511679", + "vcfCall": "A|A" + }, + { + "position": 97305364, + "rsid": "rs1801160", + "vcfCall": "C|C" + }, + { + "position": 97305372, + "rsid": "rs146529561", + "vcfCall": "G|G" + }, + { + "position": 97306195, + "rsid": "rs145548112", + "vcfCall": "C|C" + }, + { + "position": 97373598, + "rsid": "rs137999090", + "vcfCall": "C|C" + }, + { + "position": 97373629, + "rsid": "rs138545885", + "vcfCall": "C|C" + }, + { + "position": 97382461, + "rsid": "rs55971861", + "vcfCall": "T|T" + }, + { + "position": 97450058, + "rsid": "rs3918290", + "vcfCall": "C|C" + }, + { + "position": 97450059, + "rsid": "rs3918289", + "vcfCall": "G|G" + }, + { + "position": 97450065, + "rsid": "rs72549303", + "vcfCall": "TG|TG" + }, + { + "position": 97450068, + "rsid": "rs17376848", + "vcfCall": "A|A" + }, + { + "position": 97450168, + "rsid": "rs147601618", + "vcfCall": "A|A" + }, + { + "position": 97450187, + "rsid": "rs145773863", + "vcfCall": "C|C" + }, + { + "position": 97450189, + "rsid": "rs138616379", + "vcfCall": "C|C" + }, + { + "position": 97450190, + "rsid": "rs59086055", + "vcfCall": "G|G" + }, + { + "position": 97515784, + "rsid": "rs201615754", + "vcfCall": "C|C" + }, + { + "position": 97515787, + "rsid": "rs55886062", + "vcfCall": "A|A" + }, + { + "position": 97515839, + "rsid": "rs1801159", + "vcfCall": "T|T" + }, + { + "position": 97515851, + "rsid": "rs142619737", + "vcfCall": "C|C" + }, + { + "position": 97515865, + "rsid": "rs1801158", + "vcfCall": "C|C" + }, + { + "position": 97515889, + "rsid": "rs190951787", + "vcfCall": "G|G" + }, + { + "position": 97515923, + "rsid": "rs148994843", + "vcfCall": "C|C" + }, + { + "position": 97549565, + "rsid": "rs138391898", + "vcfCall": "C|C" + }, + { + "position": 97549600, + "rsid": "rs111858276", + "vcfCall": "T|T" + }, + { + "position": 97549609, + "rsid": "rs72549304", + "vcfCall": "G|G" + }, + { + "position": 97549681, + "rsid": "rs199549923", + "vcfCall": "G|G" + }, + { + "position": 97549713, + "rsid": "rs57918000", + "vcfCall": "G|G" + }, + { + "position": 97549726, + "rsid": "rs144395748", + "vcfCall": "G|G" + }, + { + "position": 97549735, + "rsid": "rs72975710", + "vcfCall": "G|G" + }, + { + "position": 97573785, + "rsid": "rs186169810", + "vcfCall": "A|A" + }, + { + "position": 97573805, + "rsid": "rs142512579", + "vcfCall": "C|C" + }, + { + "position": 97573821, + "rsid": "rs764666241", + "vcfCall": "C|C" + }, + { + "position": 97573839, + "rsid": "rs200064537", + "vcfCall": "A|A" + }, + { + "position": 97573863, + "rsid": "rs56038477", + "vcfCall": "C|C" + }, + { + "position": 97573881, + "rsid": "rs61622928", + "vcfCall": "C|C" + }, + { + "position": 97573918, + "rsid": "rs143815742", + "vcfCall": "C|C" + }, + { + "position": 97573919, + "rsid": "rs140602333", + "vcfCall": "G|G" + }, + { + "position": 97573943, + "rsid": "rs78060119", + "vcfCall": "C|C" + }, + { + "position": 97579893, + "rsid": "rs75017182", + "vcfCall": "G|G" + }, + { + "position": 97593238, + "rsid": "rs72549305", + "vcfCall": "T|T" + }, + { + "position": 97593289, + "rsid": "rs143154602", + "vcfCall": "G|G" + }, + { + "position": 97593322, + "rsid": "rs183385770", + "vcfCall": "C|C" + }, + { + "position": 97593343, + "rsid": "rs72549306", + "vcfCall": "C|C" + }, + { + "position": 97593379, + "rsid": "rs201018345", + "vcfCall": "C|C" + }, + { + "position": 97595083, + "rsid": "rs145112791", + "vcfCall": "G|G" + }, + { + "position": 97595088, + "rsid": "rs150437414", + "vcfCall": "A|A" + }, + { + "position": 97595149, + "rsid": "rs146356975", + "vcfCall": "T|T" + }, + { + "position": 97679170, + "rsid": "rs45589337", + "vcfCall": "T|T" + }, + { + "position": 97691776, + "rsid": "rs1801266", + "vcfCall": "G|G" + }, + { + "position": 97699399, + "rsid": "rs72549307", + "vcfCall": "T|T" + }, + { + "position": 97699430, + "rsid": "rs72549308", + "vcfCall": "T|T" + }, + { + "position": 97699474, + "rsid": "rs115232898", + "vcfCall": "T|T" + }, + { + "position": 97699506, + "rsid": "rs6670886", + "vcfCall": "C|C" + }, + { + "position": 97699533, + "rsid": "rs139834141", + "vcfCall": "C|C" + }, + { + "position": 97699535, + "rsid": "rs2297595", + "vcfCall": "T|T" + }, + { + "position": 97721542, + "rsid": "rs200562975", + "vcfCall": "T|T" + }, + { + "position": 97721650, + "rsid": "rs141462178", + "vcfCall": "T|T" + }, + { + "position": 97740400, + "rsid": "rs150385342", + "vcfCall": "C|C" + }, + { + "position": 97740410, + "rsid": "rs72549309", + "vcfCall": "GATGA|GATGA" + }, + { + "position": 97883329, + "rsid": "rs1801265", + "vcfCall": "A|A" + }, + { + "position": 97883352, + "rsid": "rs80081766", + "vcfCall": "C|C" + }, + { + "position": 97883353, + "rsid": "rs72549310", + "vcfCall": "G|G" + }, + { + "position": 97883368, + "rsid": "rs150036960", + "vcfCall": "G|G" + } + ], + "variantsOfInterest": [], + "matchData": { + "missingPositions": [], + "mismatchedAlleles": [] + }, + "uncallableHaplotypes": [], + "ignoredHaplotypes": [] + }, + { + "alleleDefinitionVersion": "01/10/22", + "chromosome": "chr19", + "gene": "IFNL3", + "diplotypes": [ + { + "name": "rs12979860 reference (C)/rs12979860 reference (C)", + "haplotype1": { + "name": "rs12979860 reference (C)", + "sequences": [ + "39248147:C;" + ] + }, + "haplotype2": { + "name": "rs12979860 reference (C)", + "sequences": [ + "39248147:C;" + ] + }, + "score": 2 + } + ], + "haplotypes": [ + { + "name": "rs12979860 reference (C)", + "sequences": [ + "39248147:C;" + ] + } + ], + "phased": true, + "variants": [ + { + "position": 39248147, + "rsid": "rs12979860", + "vcfCall": "C|C" + } + ], + "variantsOfInterest": [], + "matchData": { + "missingPositions": [], + "mismatchedAlleles": [] + }, + "uncallableHaplotypes": [], + "ignoredHaplotypes": [] + }, + { + "alleleDefinitionVersion": "01/10/22", + "chromosome": "chr13", + "gene": "NUDT15", + "diplotypes": [ + { + "name": "*1/*1", + "haplotype1": { + "name": "*1", + "sequences": [ + "48037748:T;48037749:G;48037782:AGGAGTC;48037798:G;48037825:C;48037834:C;48037847:G;48037849:A;48037885:G;48037902:C;48040977:GA;48041103:T;48041113:G;48045690:C;48045719:C;48045720:G;48045771:T;" + ] + }, + "haplotype2": { + "name": "*1", + "sequences": [ + "48037748:T;48037749:G;48037782:AGGAGTC;48037798:G;48037825:C;48037834:C;48037847:G;48037849:A;48037885:G;48037902:C;48040977:GA;48041103:T;48041113:G;48045690:C;48045719:C;48045720:G;48045771:T;" + ] + }, + "score": 34 + } + ], + "haplotypes": [ + { + "name": "*1", + "sequences": [ + "48037748:T;48037749:G;48037782:AGGAGTC;48037798:G;48037825:C;48037834:C;48037847:G;48037849:A;48037885:G;48037902:C;48040977:GA;48041103:T;48041113:G;48045690:C;48045719:C;48045720:G;48045771:T;" + ] + } + ], + "phased": true, + "variants": [ + { + "position": 48037748, + "rsid": "rs769369441", + "vcfCall": "T|T" + }, + { + "position": 48037749, + "rsid": null, + "vcfCall": "G|G" + }, + { + "position": 48037782, + "rsid": "rs746071566", + "vcfCall": "AGGAGTC|AGGAGTC" + }, + { + "position": 48037798, + "rsid": "rs186364861", + "vcfCall": "G|G" + }, + { + "position": 48037825, + "rsid": "rs777311140", + "vcfCall": "C|C" + }, + { + "position": 48037834, + "rsid": "rs1202487323", + "vcfCall": "C|C" + }, + { + "position": 48037847, + "rsid": "rs766023281", + "vcfCall": "G|G" + }, + { + "position": 48037849, + "rsid": null, + "vcfCall": "A|A" + }, + { + "position": 48037885, + "rsid": "rs1950545307", + "vcfCall": "G|G" + }, + { + "position": 48037902, + "rsid": "rs149436418", + "vcfCall": "C|C" + }, + { + "position": 48040977, + "rsid": "rs1457579126", + "vcfCall": "GA|GA" + }, + { + "position": 48041103, + "rsid": "rs761191455", + "vcfCall": "T|T" + }, + { + "position": 48041113, + "rsid": "rs1368252918", + "vcfCall": "G|G" + }, + { + "position": 48045690, + "rsid": "rs768324690", + "vcfCall": "C|C" + }, + { + "position": 48045719, + "rsid": "rs116855232", + "vcfCall": "C|C" + }, + { + "position": 48045720, + "rsid": "rs147390019", + "vcfCall": "G|G" + }, + { + "position": 48045771, + "rsid": "rs139551410", + "vcfCall": "T|T" + } + ], + "variantsOfInterest": [], + "matchData": { + "missingPositions": [], + "mismatchedAlleles": [] + }, + "uncallableHaplotypes": [], + "ignoredHaplotypes": [] + }, + { + "alleleDefinitionVersion": "01/10/22", + "chromosome": "chr19", + "gene": "RYR1", + "diplotypes": [ + { + "name": "Reference/Reference", + "haplotype1": { + "name": "Reference", + "sequences": [ + "38440802:T;38440829:C;38444211:C;38444212:G;38446710:G;38448673:C;38448712:G;38451842:C;38451850:C;38455359:A;38455463:G;38455471:C;38455472:G;38455528:C;38457545:C;38457546:G;38494564:C;38494565:G;38494579:G;38496283:C;38499223:G;38499644:TGGA;38499655:G;38499670:C;38499731:G;38499975:G;38499993:G;38499997:G;38500636:C;38500642:C;38500643:G;38500654:C;38500655:G;38500898:C;38500899:G;38512321:G;38543832:G;38580004:A;38580094:C;38580114:C;38580370:C;38580403:G;38580440:G;38584989:T;" + ] + }, + "haplotype2": { + "name": "Reference", + "sequences": [ + "38440802:T;38440829:C;38444211:C;38444212:G;38446710:G;38448673:C;38448712:G;38451842:C;38451850:C;38455359:A;38455463:G;38455471:C;38455472:G;38455528:C;38457545:C;38457546:G;38494564:C;38494565:G;38494579:G;38496283:C;38499223:G;38499644:TGGA;38499655:G;38499670:C;38499731:G;38499975:G;38499993:G;38499997:G;38500636:C;38500642:C;38500643:G;38500654:C;38500655:G;38500898:C;38500899:G;38512321:G;38543832:G;38580004:A;38580094:C;38580114:C;38580370:C;38580403:G;38580440:G;38584989:T;" + ] + }, + "score": 88 + } + ], + "haplotypes": [ + { + "name": "Reference", + "sequences": [ + "38440802:T;38440829:C;38444211:C;38444212:G;38446710:G;38448673:C;38448712:G;38451842:C;38451850:C;38455359:A;38455463:G;38455471:C;38455472:G;38455528:C;38457545:C;38457546:G;38494564:C;38494565:G;38494579:G;38496283:C;38499223:G;38499644:TGGA;38499655:G;38499670:C;38499731:G;38499975:G;38499993:G;38499997:G;38500636:C;38500642:C;38500643:G;38500654:C;38500655:G;38500898:C;38500899:G;38512321:G;38543832:G;38580004:A;38580094:C;38580114:C;38580370:C;38580403:G;38580440:G;38584989:T;" + ] + } + ], + "phased": true, + "variants": [ + { + "position": 38440802, + "rsid": "rs193922747", + "vcfCall": "T|T" + }, + { + "position": 38440829, + "rsid": "rs193922748", + "vcfCall": "C|C" + }, + { + "position": 38444211, + "rsid": "rs118192161", + "vcfCall": "C|C" + }, + { + "position": 38444212, + "rsid": "rs193922753", + "vcfCall": "G|G" + }, + { + "position": 38446710, + "rsid": "rs1801086", + "vcfCall": "G|G" + }, + { + "position": 38448673, + "rsid": "rs193922762", + "vcfCall": "C|C" + }, + { + "position": 38448712, + "rsid": "rs121918592", + "vcfCall": "G|G" + }, + { + "position": 38451842, + "rsid": "rs193922764", + "vcfCall": "C|C" + }, + { + "position": 38451850, + "rsid": "rs118192116", + "vcfCall": "C|C" + }, + { + "position": 38455359, + "rsid": "rs118192162", + "vcfCall": "A|A" + }, + { + "position": 38455463, + "rsid": "rs111888148", + "vcfCall": "G|G" + }, + { + "position": 38455471, + "rsid": "rs193922768", + "vcfCall": "C|C" + }, + { + "position": 38455472, + "rsid": "rs144336148", + "vcfCall": "G|G" + }, + { + "position": 38455528, + "rsid": "rs193922770", + "vcfCall": "C|C" + }, + { + "position": 38457545, + "rsid": "rs118192172", + "vcfCall": "C|C" + }, + { + "position": 38457546, + "rsid": "rs193922772", + "vcfCall": "G|G" + }, + { + "position": 38494564, + "rsid": "rs118192175", + "vcfCall": "C|C" + }, + { + "position": 38494565, + "rsid": "rs118192163", + "vcfCall": "G|G" + }, + { + "position": 38494579, + "rsid": "rs118192176", + "vcfCall": "G|G" + }, + { + "position": 38496283, + "rsid": "rs118192177", + "vcfCall": "C|C" + }, + { + "position": 38499223, + "rsid": "rs112563513", + "vcfCall": "G|G" + }, + { + "position": 38499644, + "rsid": "rs121918596", + "vcfCall": "TGGA|TGGA" + }, + { + "position": 38499655, + "rsid": "rs193922802", + "vcfCall": "G|G" + }, + { + "position": 38499670, + "rsid": "rs193922803", + "vcfCall": "C|C" + }, + { + "position": 38499731, + "rsid": "rs193922807", + "vcfCall": "G|G" + }, + { + "position": 38499975, + "rsid": "rs193922809", + "vcfCall": "G|G" + }, + { + "position": 38499993, + "rsid": "rs121918593", + "vcfCall": "G|G" + }, + { + "position": 38499997, + "rsid": "rs28933396", + "vcfCall": "G|G" + }, + { + "position": 38500636, + "rsid": "rs118192124", + "vcfCall": "C|C" + }, + { + "position": 38500642, + "rsid": "rs193922816", + "vcfCall": "C|C" + }, + { + "position": 38500643, + "rsid": "rs118192122", + "vcfCall": "G|G" + }, + { + "position": 38500654, + "rsid": "rs28933397", + "vcfCall": "C|C" + }, + { + "position": 38500655, + "rsid": "rs121918594", + "vcfCall": "G|G" + }, + { + "position": 38500898, + "rsid": "rs118192178", + "vcfCall": "C|C" + }, + { + "position": 38500899, + "rsid": "rs193922818", + "vcfCall": "G|G" + }, + { + "position": 38512321, + "rsid": "rs193922832", + "vcfCall": "G|G" + }, + { + "position": 38543832, + "rsid": "rs193922843", + "vcfCall": "G|G" + }, + { + "position": 38580004, + "rsid": "rs118192167", + "vcfCall": "A|A" + }, + { + "position": 38580094, + "rsid": "rs121918595", + "vcfCall": "C|C" + }, + { + "position": 38580114, + "rsid": "rs193922876", + "vcfCall": "C|C" + }, + { + "position": 38580370, + "rsid": "rs193922878", + "vcfCall": "C|C" + }, + { + "position": 38580403, + "rsid": "rs118192168", + "vcfCall": "G|G" + }, + { + "position": 38580440, + "rsid": "rs63749869", + "vcfCall": "G|G" + }, + { + "position": 38584989, + "rsid": "rs118192170", + "vcfCall": "T|T" + } + ], + "variantsOfInterest": [], + "matchData": { + "missingPositions": [], + "mismatchedAlleles": [] + }, + "uncallableHaplotypes": [], + "ignoredHaplotypes": [] + }, + { + "alleleDefinitionVersion": "01/10/22", + "chromosome": "chr12", + "gene": "SLCO1B1", + "diplotypes": [ + { + "name": "*1/*1", + "haplotype1": { + "name": "*1", + "sequences": [ + "21172734:C;21172776:G;21172782:T;21174595:T;21176804:A;21176868:A;21176879:C;21176883:A;21178615:T;21178957:A;21196951:A;21196976:G;21200595:T;21202553:T;21202555:C;21202649:A;21202664:G;21205921:A;21205999:G;21239042:A;21239077:A;21239113:A;21239145:C;21239158:C;" + ] + }, + "haplotype2": { + "name": "*1", + "sequences": [ + "21172734:C;21172776:G;21172782:T;21174595:T;21176804:A;21176868:A;21176879:C;21176883:A;21178615:T;21178957:A;21196951:A;21196976:G;21200595:T;21202553:T;21202555:C;21202649:A;21202664:G;21205921:A;21205999:G;21239042:A;21239077:A;21239113:A;21239145:C;21239158:C;" + ] + }, + "score": 48 + } + ], + "haplotypes": [ + { + "name": "*1", + "sequences": [ + "21172734:C;21172776:G;21172782:T;21174595:T;21176804:A;21176868:A;21176879:C;21176883:A;21178615:T;21178957:A;21196951:A;21196976:G;21200595:T;21202553:T;21202555:C;21202649:A;21202664:G;21205921:A;21205999:G;21239042:A;21239077:A;21239113:A;21239145:C;21239158:C;" + ] + } + ], + "phased": true, + "variants": [ + { + "position": 21172734, + "rsid": "rs139257324", + "vcfCall": "C|C" + }, + { + "position": 21172776, + "rsid": "rs373327528", + "vcfCall": "G|G" + }, + { + "position": 21172782, + "rsid": "rs56101265", + "vcfCall": "T|T" + }, + { + "position": 21174595, + "rsid": "rs56061388", + "vcfCall": "T|T" + }, + { + "position": 21176804, + "rsid": "rs2306283", + "vcfCall": "A|A" + }, + { + "position": 21176868, + "rsid": "rs2306282", + "vcfCall": "A|A" + }, + { + "position": 21176879, + "rsid": "rs11045819", + "vcfCall": "C|C" + }, + { + "position": 21176883, + "rsid": "rs72559745", + "vcfCall": "A|A" + }, + { + "position": 21178615, + "rsid": "rs4149056", + "vcfCall": "T|T" + }, + { + "position": 21178957, + "rsid": "rs79135870", + "vcfCall": "A|A" + }, + { + "position": 21196951, + "rsid": "rs11045852", + "vcfCall": "A|A" + }, + { + "position": 21196976, + "rsid": "rs11045853", + "vcfCall": "G|G" + }, + { + "position": 21200595, + "rsid": "rs55901008", + "vcfCall": "T|T" + }, + { + "position": 21202553, + "rsid": "rs1228465562", + "vcfCall": "T|T" + }, + { + "position": 21202555, + "rsid": "rs59113707", + "vcfCall": "C|C" + }, + { + "position": 21202649, + "rsid": "rs56387224", + "vcfCall": "A|A" + }, + { + "position": 21202664, + "rsid": "rs142965323", + "vcfCall": "G|G" + }, + { + "position": 21205921, + "rsid": "rs72559748", + "vcfCall": "A|A" + }, + { + "position": 21205999, + "rsid": "rs59502379", + "vcfCall": "G|G" + }, + { + "position": 21239042, + "rsid": "rs34671512", + "vcfCall": "A|A" + }, + { + "position": 21239077, + "rsid": "rs56199088", + "vcfCall": "A|A" + }, + { + "position": 21239113, + "rsid": "rs55737008", + "vcfCall": "A|A" + }, + { + "position": 21239145, + "rsid": "rs200995543", + "vcfCall": "C|C" + }, + { + "position": 21239158, + "rsid": "rs140790673", + "vcfCall": "C|C" + } + ], + "variantsOfInterest": [], + "matchData": { + "missingPositions": [ + { + "chromosome": "chr12", + "position": 21176871, + "cpicPosition": 21176871, + "rsid": null, + "chromosomeHgvsName": "g.21176871G\u003eA", + "cpicAlleles": [ + "A", + "G" + ], + "cpicToVcfAlleleMap": { + "A": "A", + "G": "G" + }, + "ref": "G", + "alts": [ + "A" + ] + }, + { + "chromosome": "chr12", + "position": 21176898, + "cpicPosition": 21176898, + "rsid": "rs77271279", + "chromosomeHgvsName": "g.21176898G\u003eT", + "cpicAlleles": [ + "G", + "T" + ], + "cpicToVcfAlleleMap": { + "T": "T", + "G": "G" + }, + "ref": "G", + "alts": [ + "T" + ] + }, + { + "chromosome": "chr12", + "position": 21178612, + "cpicPosition": 21178612, + "rsid": "rs141467543", + "chromosomeHgvsName": "g.21178612A\u003eG", + "cpicAlleles": [ + "A", + "G" + ], + "cpicToVcfAlleleMap": { + "A": "A", + "G": "G" + }, + "ref": "A", + "alts": [ + "G" + ] + }, + { + "chromosome": "chr12", + "position": 21196975, + "cpicPosition": 21196975, + "rsid": "rs183501729", + "chromosomeHgvsName": "g.21196975C\u003eT", + "cpicAlleles": [ + "C", + "T" + ], + "cpicToVcfAlleleMap": { + "C": "C", + "T": "T" + }, + "ref": "C", + "alts": [ + "T" + ] + }, + { + "chromosome": "chr12", + "position": 21200544, + "cpicPosition": 21200544, + "rsid": "rs72559747", + "chromosomeHgvsName": "g.21200544C\u003eG", + "cpicAlleles": [ + "C", + "G" + ], + "cpicToVcfAlleleMap": { + "C": "C", + "G": "G" + }, + "ref": "C", + "alts": [ + "G" + ] + }, + { + "chromosome": "chr12", + "position": 21206031, + "cpicPosition": 21206031, + "rsid": "rs74064213", + "chromosomeHgvsName": "g.21206031A\u003eG", + "cpicAlleles": [ + "A", + "G" + ], + "cpicToVcfAlleleMap": { + "A": "A", + "G": "G" + }, + "ref": "A", + "alts": [ + "G" + ] + }, + { + "chromosome": "chr12", + "position": 21222355, + "cpicPosition": 21222355, + "rsid": "rs71581941", + "chromosomeHgvsName": "g.21222355C\u003eT", + "cpicAlleles": [ + "C", + "T" + ], + "cpicToVcfAlleleMap": { + "C": "C", + "T": "T" + }, + "ref": "C", + "alts": [ + "T" + ] + } + ], + "mismatchedAlleles": [] + }, + "uncallableHaplotypes": [ + "*41", + "*45", + "*38" + ], + "ignoredHaplotypes": [] + }, + { + "alleleDefinitionVersion": "01/10/22", + "chromosome": "chr6", + "gene": "TPMT", + "diplotypes": [ + { + "name": "*1/*1", + "haplotype1": { + "name": "*1", + "sequences": [ + "18130687:T;18130694:T;18130725:A;18130729:C;18130758:A;18130762:C;18130772:A;18130781:C;18132136:A;18132147:A;18132163:C;18133845:T;18133847:C;18133870:A;18133884:G;18133887:T;18133890:C;18138969:C;18138970:G;18138997:C;18139027:C;18139689:C;18139710:G;18143597:T;18143606:T;18143613:C;18143622:C;18143643:A;18143700:C;18143718:G;18143724:C;18143728:C;18147838:G;18147845:C;18147851:G;18147856:A;18147910:A;18149004:G;18149022:C;18149032:C;18149045:T;18149126:A;18149127:T;" + ] + }, + "haplotype2": { + "name": "*1", + "sequences": [ + "18130687:T;18130694:T;18130725:A;18130729:C;18130758:A;18130762:C;18130772:A;18130781:C;18132136:A;18132147:A;18132163:C;18133845:T;18133847:C;18133870:A;18133884:G;18133887:T;18133890:C;18138969:C;18138970:G;18138997:C;18139027:C;18139689:C;18139710:G;18143597:T;18143606:T;18143613:C;18143622:C;18143643:A;18143700:C;18143718:G;18143724:C;18143728:C;18147838:G;18147845:C;18147851:G;18147856:A;18147910:A;18149004:G;18149022:C;18149032:C;18149045:T;18149126:A;18149127:T;" + ] + }, + "score": 86 + } + ], + "haplotypes": [ + { + "name": "*1", + "sequences": [ + "18130687:T;18130694:T;18130725:A;18130729:C;18130758:A;18130762:C;18130772:A;18130781:C;18132136:A;18132147:A;18132163:C;18133845:T;18133847:C;18133870:A;18133884:G;18133887:T;18133890:C;18138969:C;18138970:G;18138997:C;18139027:C;18139689:C;18139710:G;18143597:T;18143606:T;18143613:C;18143622:C;18143643:A;18143700:C;18143718:G;18143724:C;18143728:C;18147838:G;18147845:C;18147851:G;18147856:A;18147910:A;18149004:G;18149022:C;18149032:C;18149045:T;18149126:A;18149127:T;" + ] + } + ], + "phased": true, + "variants": [ + { + "position": 18130687, + "rsid": "rs1142345", + "vcfCall": "T|T" + }, + { + "position": 18130694, + "rsid": "rs150900439", + "vcfCall": "T|T" + }, + { + "position": 18130725, + "rsid": "rs72552736", + "vcfCall": "A|A" + }, + { + "position": 18130729, + "rsid": "rs139392616", + "vcfCall": "C|C" + }, + { + "position": 18130758, + "rsid": "rs398122996", + "vcfCall": "A|A" + }, + { + "position": 18130762, + "rsid": "rs56161402", + "vcfCall": "C|C" + }, + { + "position": 18130772, + "rsid": "rs377085266", + "vcfCall": "A|A" + }, + { + "position": 18130781, + "rsid": "rs1800584", + "vcfCall": "C|C" + }, + { + "position": 18132136, + "rsid": "rs72556347", + "vcfCall": "A|A" + }, + { + "position": 18132147, + "rsid": "rs79901429", + "vcfCall": "A|A" + }, + { + "position": 18132163, + "rsid": null, + "vcfCall": "C|C" + }, + { + "position": 18133845, + "rsid": "rs75543815", + "vcfCall": "T|T" + }, + { + "position": 18133847, + "rsid": "rs6921269", + "vcfCall": "C|C" + }, + { + "position": 18133870, + "rsid": "rs772832951", + "vcfCall": "A|A" + }, + { + "position": 18133884, + "rsid": "rs74423290", + "vcfCall": "G|G" + }, + { + "position": 18133887, + "rsid": "rs201695576", + "vcfCall": "T|T" + }, + { + "position": 18133890, + "rsid": "rs9333570", + "vcfCall": "C|C" + }, + { + "position": 18138969, + "rsid": "rs144041067", + "vcfCall": "C|C" + }, + { + "position": 18138970, + "rsid": "rs112339338", + "vcfCall": "G|G" + }, + { + "position": 18138997, + "rsid": "rs1800460", + "vcfCall": "C|C" + }, + { + "position": 18139027, + "rsid": "rs72552737", + "vcfCall": "C|C" + }, + { + "position": 18139689, + "rsid": "rs72552738", + "vcfCall": "C|C" + }, + { + "position": 18139710, + "rsid": "rs200220210", + "vcfCall": "G|G" + }, + { + "position": 18143597, + "rsid": null, + "vcfCall": "T|T" + }, + { + "position": 18143606, + "rsid": "rs151149760", + "vcfCall": "T|T" + }, + { + "position": 18143613, + "rsid": null, + "vcfCall": "C|C" + }, + { + "position": 18143622, + "rsid": "rs115106679", + "vcfCall": "C|C" + }, + { + "position": 18143643, + "rsid": null, + "vcfCall": "A|A" + }, + { + "position": 18143700, + "rsid": "rs753545734", + "vcfCall": "C|C" + }, + { + "position": 18143718, + "rsid": "rs111901354", + "vcfCall": "G|G" + }, + { + "position": 18143724, + "rsid": "rs1800462", + "vcfCall": "C|C" + }, + { + "position": 18143728, + "rsid": "rs1256618794", + "vcfCall": "C|C" + }, + { + "position": 18147838, + "rsid": "rs281874771", + "vcfCall": "G|G" + }, + { + "position": 18147845, + "rsid": "rs777686348", + "vcfCall": "C|C" + }, + { + "position": 18147851, + "rsid": "rs200591577", + "vcfCall": "G|G" + }, + { + "position": 18147856, + "rsid": null, + "vcfCall": "A|A" + }, + { + "position": 18147910, + "rsid": "rs72552740", + "vcfCall": "A|A" + }, + { + "position": 18149004, + "rsid": null, + "vcfCall": "G|G" + }, + { + "position": 18149022, + "rsid": "rs750424422", + "vcfCall": "C|C" + }, + { + "position": 18149032, + "rsid": "rs759836180", + "vcfCall": "C|C" + }, + { + "position": 18149045, + "rsid": "rs72552742", + "vcfCall": "T|T" + }, + { + "position": 18149126, + "rsid": "rs267607275", + "vcfCall": "A|A" + }, + { + "position": 18149127, + "rsid": "rs9333569", + "vcfCall": "T|T" + } + ], + "variantsOfInterest": [], + "matchData": { + "missingPositions": [], + "mismatchedAlleles": [] + }, + "uncallableHaplotypes": [], + "ignoredHaplotypes": [] + }, + { + "alleleDefinitionVersion": "01/10/22", + "chromosome": "chr2", + "gene": "UGT1A1", + "diplotypes": [ + { + "name": "*1/*1", + "haplotype1": { + "name": "*1", + "sequences": [ + "233759924:C;233760233:CAT;233760498:G;233760973:C;" + ] + }, + "haplotype2": { + "name": "*1", + "sequences": [ + "233759924:C;233760233:CAT;233760498:G;233760973:C;" + ] + }, + "score": 8 + } + ], + "haplotypes": [ + { + "name": "*1", + "sequences": [ + "233759924:C;233760233:CAT;233760498:G;233760973:C;" + ] + } + ], + "phased": true, + "variants": [ + { + "position": 233759924, + "rsid": "rs887829", + "vcfCall": "C|C" + }, + { + "position": 233760233, + "rsid": "rs3064744", + "vcfCall": "CAT|CAT" + }, + { + "position": 233760498, + "rsid": "rs4148323", + "vcfCall": "G|G" + }, + { + "position": 233760973, + "rsid": "rs35350960", + "vcfCall": "C|C" + } + ], + "variantsOfInterest": [], + "matchData": { + "missingPositions": [], + "mismatchedAlleles": [] + }, + "uncallableHaplotypes": [], + "ignoredHaplotypes": [] + }, + { + "alleleDefinitionVersion": "01/10/22", + "chromosome": "chr16", + "gene": "VKORC1", + "diplotypes": [ + { + "name": "rs9923231 reference (C)/rs9923231 reference (C)", + "haplotype1": { + "name": "rs9923231 reference (C)", + "sequences": [ + "31096368:C;" + ] + }, + "haplotype2": { + "name": "rs9923231 reference (C)", + "sequences": [ + "31096368:C;" + ] + }, + "score": 2 + } + ], + "haplotypes": [ + { + "name": "rs9923231 reference (C)", + "sequences": [ + "31096368:C;" + ] + } + ], + "phased": true, + "variants": [ + { + "position": 31096368, + "rsid": "rs9923231", + "vcfCall": "C|C" + } + ], + "variantsOfInterest": [], + "matchData": { + "missingPositions": [], + "mismatchedAlleles": [] + }, + "uncallableHaplotypes": [], + "ignoredHaplotypes": [] + } + ], + "vcfWarnings": {} +} \ No newline at end of file diff -r 000000000000 -r 28aa54c800c0 test-data/test_3.json --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_3.json Fri Jan 28 21:17:56 2022 +0000 @@ -0,0 +1,6648 @@ +[ + { + "geneSymbol": "CACNA1S", + "chr": "chr1", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [], + "relatedDrugs": [], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "CACNA1S", + "name": "Reference", + "function": "Normal Function", + "reference": true + }, + "allele2": { + "gene": "CACNA1S", + "name": "Reference", + "function": "Normal Function", + "reference": true + }, + "gene": "CACNA1S", + "phenotype": "Uncertain Susceptibility", + "variant": null, + "lookupKey": "Uncertain Susceptibility", + "label": "Reference/Reference" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "CACNA1S", + "name": "Reference", + "function": "Normal Function", + "reference": true + }, + "allele2": { + "gene": "CACNA1S", + "name": "Reference", + "function": "Normal Function", + "reference": true + }, + "gene": "CACNA1S", + "phenotype": "Uncertain Susceptibility", + "variant": null, + "lookupKey": "Uncertain Susceptibility", + "label": "Reference/Reference" + } + ], + "variants": [ + { + "gene": "CACNA1S", + "chromosome": "chr1", + "position": 201060815, + "dbSnpId": "rs1800559", + "call": "C|C", + "alleles": [ + "c.3257G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CACNA1S", + "chromosome": "chr1", + "position": 201091993, + "dbSnpId": "rs772226819", + "call": "G|G", + "alleles": [ + "c.520C\u003eT" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "CFTR", + "chr": "chr7", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [], + "relatedDrugs": [], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "CFTR", + "name": "ivacaftor non-responsive CFTR sequence", + "function": "ivacaftor non-responsive", + "reference": true + }, + "allele2": { + "gene": "CFTR", + "name": "ivacaftor non-responsive CFTR sequence", + "function": "ivacaftor non-responsive", + "reference": true + }, + "gene": "CFTR", + "phenotype": "ivacaftor non-responsive in CF patients", + "variant": null, + "lookupKey": "ivacaftor non-responsive in CF patients", + "label": "No CPIC variants found" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "CFTR", + "name": "ivacaftor non-responsive CFTR sequence", + "function": "ivacaftor non-responsive", + "reference": true + }, + "allele2": { + "gene": "CFTR", + "name": "ivacaftor non-responsive CFTR sequence", + "function": "ivacaftor non-responsive", + "reference": true + }, + "gene": "CFTR", + "phenotype": "ivacaftor non-responsive in CF patients", + "variant": null, + "lookupKey": "ivacaftor non-responsive in CF patients", + "label": "No CPIC variants found" + } + ], + "variants": [ + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117509035, + "dbSnpId": "rs397508256", + "call": "G|G", + "alleles": [ + "E56K" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117509069, + "dbSnpId": "rs368505753", + "call": "C|C", + "alleles": [ + "P67L" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117509089, + "dbSnpId": "rs115545701", + "call": "C|C", + "alleles": [ + "R74W" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117530953, + "dbSnpId": "rs113993958", + "call": "G|G", + "alleles": [ + "D110H" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117530955, + "dbSnpId": "rs397508537", + "call": "C|C", + "alleles": [ + "D110E" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117530974, + "dbSnpId": "rs77834169", + "call": "C|C", + "alleles": [ + "R117C" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117530975, + "dbSnpId": "rs78655421", + "call": "G|G", + "alleles": [ + "R117H" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117534318, + "dbSnpId": "rs80282562", + "call": "G|G", + "alleles": [ + "G178R" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117534363, + "dbSnpId": "rs397508759", + "call": "G|G", + "alleles": [ + "E193K" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117534368, + "dbSnpId": "rs397508761", + "call": "A|A", + "alleles": [ + "711+3A-\u003eG" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117535285, + "dbSnpId": "rs121908752", + "call": "T|T", + "alleles": [ + "L206W" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117540270, + "dbSnpId": "rs77932196", + "call": "G|G", + "alleles": [ + "R347H" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117540285, + "dbSnpId": "rs121908753", + "call": "G|G", + "alleles": [ + "R352Q" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117548795, + "dbSnpId": "rs74551128", + "call": "C|C", + "alleles": [ + "A455E" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117587799, + "dbSnpId": "rs121908757", + "call": "A|A", + "alleles": [ + "S549R(A\u003eC)" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117587800, + "dbSnpId": "rs121908755", + "call": "G|G", + "alleles": [ + "S549N" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117587801, + "dbSnpId": "rs121909005", + "call": "T|T", + "alleles": [ + "S549R(T\u003eG)" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117587805, + "dbSnpId": "rs121909013", + "call": "G|G", + "alleles": [ + "G551S" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117587806, + "dbSnpId": "rs75527207", + "call": "G|G", + "alleles": [ + "G551D" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117590409, + "dbSnpId": "rs397508288", + "call": "A|A", + "alleles": [ + "D579G" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117594930, + "dbSnpId": "rs397508387", + "call": "G|G", + "alleles": [ + "E831X" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117602868, + "dbSnpId": "rs80224560", + "call": "G|G", + "alleles": [ + "2789+5G-\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117603708, + "dbSnpId": "rs397508442", + "call": "C|C", + "alleles": [ + "S945L" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117606695, + "dbSnpId": "rs141033578", + "call": "C|C", + "alleles": [ + "S977F" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117611555, + "dbSnpId": "rs76151804", + "call": "A|A", + "alleles": [ + "3272-26A-\u003eG" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117611595, + "dbSnpId": "rs150212784", + "call": "T|T", + "alleles": [ + "F1052V" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117611620, + "dbSnpId": "rs397508513", + "call": "A|A", + "alleles": [ + "K1060T" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117611640, + "dbSnpId": "rs121909020", + "call": "G|G", + "alleles": [ + "A1067T" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117611646, + "dbSnpId": "rs200321110", + "call": "G|G", + "alleles": [ + "G1069R" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117611649, + "dbSnpId": "rs202179988", + "call": "C|C", + "alleles": [ + "R1070W" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117611650, + "dbSnpId": "rs78769542", + "call": "G|G", + "alleles": [ + "R1070Q" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117611663, + "dbSnpId": "rs186045772", + "call": "T|T", + "alleles": [ + "F1074L" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117614699, + "dbSnpId": "rs75541969", + "call": "G|G", + "alleles": [ + "D1152H" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117639961, + "dbSnpId": "rs75039782", + "call": "C|C", + "alleles": [ + "3849+10kbC-\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117642451, + "dbSnpId": "rs267606723", + "call": "G|G", + "alleles": [ + "G1244E" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117642472, + "dbSnpId": "rs74503330", + "call": "G|G", + "alleles": [ + "S1251N" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117642483, + "dbSnpId": "rs121909041", + "call": "T|T", + "alleles": [ + "S1255P" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117642528, + "dbSnpId": "rs11971167", + "call": "G|G", + "alleles": [ + "D1270N" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117664770, + "dbSnpId": "rs193922525", + "call": "G|G", + "alleles": [ + "G1349D" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "CYP2B6", + "chr": "chr19", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [], + "relatedDrugs": [], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "CYP2B6", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "CYP2B6", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "gene": "CYP2B6", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*1/*1" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "CYP2B6", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "CYP2B6", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "gene": "CYP2B6", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*1/*1" + } + ], + "variants": [ + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 40991224, + "dbSnpId": "rs34223104", + "call": "T|T", + "alleles": [ + "*22", + "*34", + "*35", + "*36" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 40991367, + "dbSnpId": "rs34883432", + "call": "A|A", + "alleles": [ + "*10" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 40991369, + "dbSnpId": "rs8192709", + "call": "C|C", + "alleles": [ + "*2", + "*10" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 40991381, + "dbSnpId": "rs33973337", + "call": "A|A", + "alleles": [ + "*17" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 40991388, + "dbSnpId": "rs33980385", + "call": "A|A", + "alleles": [ + "*17" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 40991390, + "dbSnpId": "rs33926104", + "call": "C|C", + "alleles": [ + "*17" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 40991391, + "dbSnpId": "rs34284776", + "call": "G|G", + "alleles": [ + "*17" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 40991441, + "dbSnpId": "rs35303484", + "call": "A|A", + "alleles": [ + "*11" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41004015, + "dbSnpId": "rs281864907", + "call": "T|T", + "alleles": [ + "*38" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41004125, + "dbSnpId": "rs36060847", + "call": "G|G", + "alleles": [ + "*12" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41004158, + "dbSnpId": "rs186335453", + "call": "G|G", + "alleles": [ + "*35" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41004303, + "dbSnpId": "rs139801276", + "call": "T|T", + "alleles": [ + "*35" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41004377, + "dbSnpId": "rs12721655", + "call": "A|A", + "alleles": [ + "*8", + "*13" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41004381, + "dbSnpId": "rs35773040", + "call": "G|G", + "alleles": [ + "*14" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41004406, + "dbSnpId": "rs145884402", + "call": "G|G", + "alleles": [ + "*35" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41006919, + "dbSnpId": "rs3826711", + "call": "C|C", + "alleles": [ + "*26" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41006923, + "dbSnpId": "rs36056539", + "call": "C|C", + "alleles": [ + "*20" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41006936, + "dbSnpId": "rs3745274", + "call": "G|G", + "alleles": [ + "*6", + "*7", + "*9", + "*13", + "*19", + "*20", + "*26", + "*34", + "*36", + "*37", + "*38" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41006968, + "dbSnpId": "rs373489637", + "call": "T|T", + "alleles": [ + "*37" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41007013, + "dbSnpId": "rs36079186", + "call": "T|T", + "alleles": [ + "*27", + "*35" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41009350, + "dbSnpId": "rs45482602", + "call": "C|C", + "alleles": [ + "*3" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41009358, + "dbSnpId": "rs2279343", + "call": "A|A", + "alleles": [ + "*4", + "*6", + "*7", + "*13", + "*18", + "*19", + "*20", + "*26", + "*34", + "*36", + "*37", + "*38" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41010006, + "dbSnpId": "rs139029625", + "call": "G|G", + "alleles": [ + "*35" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41010088, + "dbSnpId": "rs34698757", + "call": "C|C", + "alleles": [ + "*28" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41010108, + "dbSnpId": "rs193922917", + "call": "C|C", + "alleles": [ + "*31" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41012316, + "dbSnpId": "rs28399499", + "call": "T|T", + "alleles": [ + "*18" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41012339, + "dbSnpId": "rs34826503", + "call": "C|C", + "alleles": [ + "*19" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41012465, + "dbSnpId": "rs34097093", + "call": "C|C", + "alleles": [ + "*28" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41012693, + "dbSnpId": "rs35979566", + "call": "T|T", + "alleles": [ + "*15" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41012740, + "dbSnpId": "rs193922918", + "call": "G|G", + "alleles": [ + "*32" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41012803, + "dbSnpId": "rs35010098", + "call": "C|C", + "alleles": [ + "*21" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41016726, + "dbSnpId": "rs3211369", + "call": "A|A", + "alleles": [ + "*23" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41016778, + "dbSnpId": "rs564083989", + "call": "G|G", + "alleles": [ + "*24" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41016805, + "dbSnpId": null, + "call": "A|A", + "alleles": [ + "*25" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41016810, + "dbSnpId": "rs3211371", + "call": "C|C", + "alleles": [ + "*5", + "*7", + "*33", + "*34" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "CYP2C19", + "chr": "chr10", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [], + "relatedDrugs": [], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "CYP2C19", + "name": "*38", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "CYP2C19", + "name": "*38", + "function": "Normal function", + "reference": true + }, + "gene": "CYP2C19", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*38/*38" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "CYP2C19", + "name": "*38", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "CYP2C19", + "name": "*38", + "function": "Normal function", + "reference": true + }, + "gene": "CYP2C19", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*38/*38" + } + ], + "variants": [ + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94761900, + "dbSnpId": "rs12248560", + "call": "C|C", + "alleles": [ + "*4", + "*17" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94762706, + "dbSnpId": "rs28399504", + "call": "A|A", + "alleles": [ + "*4" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94762712, + "dbSnpId": "rs367543002", + "call": "C|C", + "alleles": [ + "*34" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94762715, + "dbSnpId": "rs367543003", + "call": "T|T", + "alleles": [ + "*34" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94762755, + "dbSnpId": "rs55752064", + "call": "T|T", + "alleles": [ + "*14" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94762760, + "dbSnpId": "rs17882687", + "call": "A|A", + "alleles": [ + "*15", + "*28", + "*35", + "*39" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94762788, + "dbSnpId": "rs1564656981", + "call": "A|A", + "alleles": [ + "*29" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94762856, + "dbSnpId": "rs1564657013", + "call": "A|A", + "alleles": [ + "*19" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94775106, + "dbSnpId": "rs145328984", + "call": "C|C", + "alleles": [ + "*30" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94775121, + "dbSnpId": "rs1564660997", + "call": "C|C", + "alleles": [ + "*31" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94775160, + "dbSnpId": "rs118203756", + "call": "G|G", + "alleles": [ + "*23" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94775185, + "dbSnpId": "rs1288601658", + "call": "A|A", + "alleles": [ + "*32" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94775367, + "dbSnpId": "rs12769205", + "call": "A|A", + "alleles": [ + "*2", + "*35" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94775416, + "dbSnpId": "rs41291556", + "call": "T|T", + "alleles": [ + "*8" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94775423, + "dbSnpId": "rs17885179", + "call": "A|A", + "alleles": [ + "*39" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94775453, + "dbSnpId": "rs72552267", + "call": "G|G", + "alleles": [ + "*6" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94775489, + "dbSnpId": "rs17884712", + "call": "G|G", + "alleles": [ + "*9" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94775507, + "dbSnpId": "rs58973490", + "call": "G|G", + "alleles": [ + "*2", + "*11" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94780574, + "dbSnpId": "rs140278421", + "call": "G|G", + "alleles": [ + "*22" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94780579, + "dbSnpId": "rs370803989", + "call": "G|G", + "alleles": [ + "*33" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94780653, + "dbSnpId": "rs4986893", + "call": "G|G", + "alleles": [ + "*3" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94781858, + "dbSnpId": "rs6413438", + "call": "C|C", + "alleles": [ + "*10" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94781859, + "dbSnpId": "rs4244285", + "call": "G|G", + "alleles": [ + "*2" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94781944, + "dbSnpId": "rs375781227", + "call": "G|G", + "alleles": [ + "*26" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94781999, + "dbSnpId": "rs72558186", + "call": "T|T", + "alleles": [ + "*7" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94842861, + "dbSnpId": "rs138142612", + "call": "G|G", + "alleles": [ + "*18" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94842866, + "dbSnpId": "rs3758581", + "call": "A|A", + "alleles": [ + "*2", + "*3", + "*4", + "*5", + "*6", + "*8", + "*9", + "*10", + "*11", + "*12", + "*13", + "*14", + "*15", + "*17", + "*18", + "*19", + "*22", + "*23", + "*24", + "*25", + "*26", + "*28", + "*29", + "*31", + "*32", + "*33", + "*35", + "*39" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94842879, + "dbSnpId": "rs118203757", + "call": "G|G", + "alleles": [ + "*24" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94842995, + "dbSnpId": "rs113934938", + "call": "G|G", + "alleles": [ + "*28" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94849995, + "dbSnpId": "rs17879685", + "call": "C|C", + "alleles": [ + "*13" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94852738, + "dbSnpId": "rs56337013", + "call": "C|C", + "alleles": [ + "*5" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94852765, + "dbSnpId": "rs192154563", + "call": "C|C", + "alleles": [ + "*16" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94852785, + "dbSnpId": "rs118203759", + "call": "C|C", + "alleles": [ + "*25" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94852914, + "dbSnpId": "rs55640102", + "call": "A|A", + "alleles": [ + "*12" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "CYP2C9", + "chr": "chr10", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [ + "*72", + "*73", + "*74", + "*75" + ], + "messages": [], + "relatedDrugs": [], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "CYP2C9", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "CYP2C9", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "gene": "CYP2C9", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "2", + "label": "*1/*1" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "CYP2C9", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "CYP2C9", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "gene": "CYP2C9", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "2", + "label": "*1/*1" + } + ], + "variants": [ + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94938683, + "dbSnpId": "rs114071557", + "call": "A|A", + "alleles": [ + "*36" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94938737, + "dbSnpId": "rs67807361", + "call": "C|C", + "alleles": [ + "*7" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94938771, + "dbSnpId": "rs142240658", + "call": "C|C", + "alleles": [ + "*21" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94938803, + "dbSnpId": "rs2031308986", + "call": "A|A", + "alleles": [ + "*22" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94938828, + "dbSnpId": "rs564813580", + "call": "A|A", + "alleles": [ + "*37" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94941897, + "dbSnpId": "rs371055887", + "call": "G|G", + "alleles": [ + "*20" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94941915, + "dbSnpId": null, + "call": "G|G", + "alleles": [ + "*23" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94941958, + "dbSnpId": "rs72558187", + "call": "T|T", + "alleles": [ + "*13" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94941976, + "dbSnpId": null, + "call": "G|G", + "alleles": [ + "*38" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94941982, + "dbSnpId": "rs762239445", + "call": "G|G", + "alleles": [ + "*39" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942018, + "dbSnpId": null, + "call": "T|T", + "alleles": [ + "*40" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942205, + "dbSnpId": "rs1304490498", + "call": "CAATGGAAAGA|CAATGGAAAGA", + "alleles": [ + "*25" + ], + "phased": true, + "wildtypeAllele": "CAATGGAAAGA", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942216, + "dbSnpId": "rs774607211", + "call": "A|A", + "alleles": [ + "*41" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942230, + "dbSnpId": "rs767576260", + "call": "C|C", + "alleles": [ + "*43" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942231, + "dbSnpId": "rs12414460", + "call": "G|G", + "alleles": [ + "*42" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942233, + "dbSnpId": "rs375805362", + "call": "C|C", + "alleles": [ + "*62" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942234, + "dbSnpId": "rs72558189", + "call": "G|G", + "alleles": [ + "*14", + "*35" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942249, + "dbSnpId": "rs200965026", + "call": "C|C", + "alleles": [ + "*26", + "*44" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942254, + "dbSnpId": "rs199523631", + "call": "C|C", + "alleles": [ + "*45" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942255, + "dbSnpId": "rs200183364", + "call": "G|G", + "alleles": [ + "*33" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942290, + "dbSnpId": "rs1799853", + "call": "C|C", + "alleles": [ + "*2", + "*35", + "*61" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942291, + "dbSnpId": "rs141489852", + "call": "G|G", + "alleles": [ + "*63" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942305, + "dbSnpId": "rs754487195", + "call": "G|G", + "alleles": [ + "*46" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942309, + "dbSnpId": "rs7900194", + "call": "G|G", + "alleles": [ + "*8", + "*27" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94947782, + "dbSnpId": "rs72558190", + "call": "C|C", + "alleles": [ + "*15" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94947785, + "dbSnpId": "rs774550549", + "call": "C|C", + "alleles": [ + "*47" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94947869, + "dbSnpId": null, + "call": "A|A", + "alleles": [ + "*69" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94947907, + "dbSnpId": null, + "call": "A|A", + "alleles": [ + "*57" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94947917, + "dbSnpId": "rs1326630788", + "call": "T|T", + "alleles": [ + "*48" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94947938, + "dbSnpId": "rs2031531005", + "call": "A|A", + "alleles": [ + "*28" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94949129, + "dbSnpId": null, + "call": "A|A", + "alleles": [ + "*49" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94949144, + "dbSnpId": null, + "call": "C|C", + "alleles": [ + "*50" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94949217, + "dbSnpId": "rs2256871", + "call": "A|A", + "alleles": [ + "*9" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94949280, + "dbSnpId": "rs9332130", + "call": "A|A", + "alleles": [ + "*10", + "*71" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94949281, + "dbSnpId": "rs9332131", + "call": "GA|GA", + "alleles": [ + "*6" + ], + "phased": true, + "wildtypeAllele": "GA", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94972119, + "dbSnpId": "rs182132442", + "call": "C|C", + "alleles": [ + "*29" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94972123, + "dbSnpId": null, + "call": "C|C", + "alleles": [ + "*64" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94972134, + "dbSnpId": null, + "call": "A|A", + "alleles": [ + "*51" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94972179, + "dbSnpId": "rs72558192", + "call": "A|A", + "alleles": [ + "*16" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94972180, + "dbSnpId": "rs988617574", + "call": "C|C", + "alleles": [ + "*52" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94972233, + "dbSnpId": "rs1237225311", + "call": "C|C", + "alleles": [ + "*53" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981199, + "dbSnpId": null, + "call": "G|G", + "alleles": [ + "*65" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981201, + "dbSnpId": "rs57505750", + "call": "T|T", + "alleles": [ + "*31" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981224, + "dbSnpId": "rs28371685", + "call": "C|C", + "alleles": [ + "*11" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981225, + "dbSnpId": "rs367826293", + "call": "G|G", + "alleles": [ + "*34" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981230, + "dbSnpId": "rs1274535931", + "call": "C|C", + "alleles": [ + "*58" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981250, + "dbSnpId": "rs750820937", + "call": "C|C", + "alleles": [ + "*54" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981281, + "dbSnpId": "rs749060448", + "call": "G|G", + "alleles": [ + "*24" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981296, + "dbSnpId": "rs1057910", + "call": "A|A", + "alleles": [ + "*3", + "*18", + "*68" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981297, + "dbSnpId": "rs56165452", + "call": "T|T", + "alleles": [ + "*4" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981301, + "dbSnpId": "rs28371686", + "call": "C|C", + "alleles": [ + "*5" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981302, + "dbSnpId": "rs1250577724", + "call": "C|C", + "alleles": [ + "*55" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981305, + "dbSnpId": "rs578144976", + "call": "C|C", + "alleles": [ + "*66" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981365, + "dbSnpId": null, + "call": "C|C", + "alleles": [ + "*17" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981371, + "dbSnpId": "rs542577750", + "call": "G|G", + "alleles": [ + "*68" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94986042, + "dbSnpId": "rs764211126", + "call": "A|A", + "alleles": [ + "*56" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94986073, + "dbSnpId": "rs72558193", + "call": "A|A", + "alleles": [ + "*18" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94988852, + "dbSnpId": "rs776908257", + "call": "C|C", + "alleles": [ + "*67" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94988855, + "dbSnpId": null, + "call": "A|A", + "alleles": [ + "*59" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94988880, + "dbSnpId": null, + "call": "G|G", + "alleles": [ + "*70" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94988917, + "dbSnpId": "rs769942899", + "call": "G|G", + "alleles": [ + "*19" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94988925, + "dbSnpId": "rs202201137", + "call": "A|A", + "alleles": [ + "*61" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94988955, + "dbSnpId": "rs767284820", + "call": "T|T", + "alleles": [ + "*60" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94988984, + "dbSnpId": "rs781583846", + "call": "G|G", + "alleles": [ + "*30" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94989020, + "dbSnpId": "rs9332239", + "call": "C|C", + "alleles": [ + "*12", + "*71" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94989023, + "dbSnpId": "rs868182778", + "call": "G|G", + "alleles": [ + "*32" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942306, + "dbSnpId": "rs1289704600", + "call": null, + "alleles": [ + "*72" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942308, + "dbSnpId": "rs17847037", + "call": null, + "alleles": [ + "*73" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94947439, + "dbSnpId": null, + "call": null, + "alleles": [ + "*74" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94986136, + "dbSnpId": "rs1254213342", + "call": null, + "alleles": [ + "*75" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + } + ], + "variantsOfInterest": [ + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94645745, + "dbSnpId": "rs12777823", + "call": "G|G", + "alleles": [], + "phased": true, + "wildtypeAllele": null, + "mismatch": false + } + ], + "highlightedVariants": [] + }, + { + "geneSymbol": "CYP2D6", + "chr": null, + "phased": false, + "callSource": "OUTSIDE", + "uncalledHaplotypes": [], + "messages": [ + { + "rule_name": "CYP2D6 warning", + "version": "1", + "matches": { + "gene": "CYP2D6", + "hapsCalled": [], + "hapsMissing": [], + "variantsMissing": [], + "variant": "", + "dips": [], + "drugs": [] + }, + "exception_type": "note", + "message": "CYP2D6 genotypes are called by a separate algorithm from other genes in the PharmCAT report. Please refer to \u003ca href\u003d\"https://github.com/PharmGKB/PharmCAT/wiki/Determining-Alleles\"\u003ethe PharmCAT wiki\u003c/a\u003e for more information." + } + ], + "relatedDrugs": [], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "CYP2D6", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "CYP2D6", + "name": "*3", + "function": "No function", + "reference": false + }, + "gene": "CYP2D6", + "phenotype": "Intermediate Metabolizer", + "variant": null, + "lookupKey": "1", + "label": "*1/*3" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "CYP2D6", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "CYP2D6", + "name": "*3", + "function": "No function", + "reference": false + }, + "gene": "CYP2D6", + "phenotype": "Intermediate Metabolizer", + "variant": null, + "lookupKey": "1", + "label": "*1/*3" + } + ], + "variants": [], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "CYP3A5", + "chr": "chr7", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [ + { + "rule_name": "CYP3A5 reverse complement footnote", + "version": "1", + "matches": { + "gene": "CYP3A5", + "hapsCalled": [], + "hapsMissing": [], + "variantsMissing": [], + "variant": "", + "dips": [], + "drugs": [] + }, + "exception_type": "footnote", + "message": "The CYP3A5 gene is on the negative chromosomal strand, all genotype calls for CYP3A5 in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases." + } + ], + "relatedDrugs": [], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "CYP3A5", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "CYP3A5", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "gene": "CYP3A5", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*1/*1" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "CYP3A5", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "CYP3A5", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "gene": "CYP3A5", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*1/*1" + } + ], + "variants": [ + { + "gene": "CYP3A5", + "chromosome": "chr7", + "position": 99652613, + "dbSnpId": "rs28365083", + "call": "G|G", + "alleles": [ + "*2", + "*3" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP3A5", + "chromosome": "chr7", + "position": 99652770, + "dbSnpId": "rs41303343", + "call": "T|T", + "alleles": [ + "*7" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP3A5", + "chromosome": "chr7", + "position": 99660516, + "dbSnpId": "rs28383479", + "call": "C|C", + "alleles": [ + "*3", + "*9" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP3A5", + "chromosome": "chr7", + "position": 99665212, + "dbSnpId": "rs10264272", + "call": "C|C", + "alleles": [ + "*6" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP3A5", + "chromosome": "chr7", + "position": 99665237, + "dbSnpId": "rs56411402", + "call": "T|T", + "alleles": [ + "*3", + "*4" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP3A5", + "chromosome": "chr7", + "position": 99666950, + "dbSnpId": "rs55965422", + "call": "A|A", + "alleles": [ + "*3", + "*5" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP3A5", + "chromosome": "chr7", + "position": 99672916, + "dbSnpId": "rs776746", + "call": "T|T", + "alleles": [ + "*3" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP3A5", + "chromosome": "chr7", + "position": 99676198, + "dbSnpId": "rs55817950", + "call": "G|G", + "alleles": [ + "*8" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "CYP4F2", + "chr": "chr19", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [], + "relatedDrugs": [], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "CYP4F2", + "name": "*1", + "function": null, + "reference": true + }, + "allele2": { + "gene": "CYP4F2", + "name": "*1", + "function": null, + "reference": true + }, + "gene": "CYP4F2", + "phenotype": null, + "variant": null, + "lookupKey": null, + "label": "*1/*1" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "CYP4F2", + "name": "*1", + "function": null, + "reference": true + }, + "allele2": { + "gene": "CYP4F2", + "name": "*1", + "function": null, + "reference": true + }, + "gene": "CYP4F2", + "phenotype": null, + "variant": null, + "lookupKey": null, + "label": "*1/*1" + } + ], + "variants": [ + { + "gene": "CYP4F2", + "chromosome": "chr19", + "position": 15879621, + "dbSnpId": "rs2108622", + "call": "C|C", + "alleles": [ + "*3" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP4F2", + "chromosome": "chr19", + "position": 15897578, + "dbSnpId": "rs3093105", + "call": "A|A", + "alleles": [ + "*2" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "DPYD", + "chr": "chr1", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [ + { + "rule_name": "DPYD reverse complement footnote", + "version": "1", + "matches": { + "gene": "DPYD", + "hapsCalled": [], + "hapsMissing": [], + "variantsMissing": [], + "variant": "", + "dips": [], + "drugs": [] + }, + "exception_type": "footnote", + "message": "The DPYD gene is on the negative chromosomal strand, all genotype calls for DPYD in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases." + } + ], + "relatedDrugs": [], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "DPYD", + "name": "Reference", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "DPYD", + "name": "Reference", + "function": "Normal function", + "reference": true + }, + "gene": "DPYD", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "2", + "label": "Reference/Reference" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "DPYD", + "name": "Reference", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "DPYD", + "name": "Reference", + "function": "Normal function", + "reference": true + }, + "gene": "DPYD", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "2", + "label": "Reference/Reference" + } + ], + "variants": [ + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97078987, + "dbSnpId": "rs114096998", + "call": "G|G", + "alleles": [ + "c.3067C\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97078993, + "dbSnpId": "rs148799944", + "call": "C|C", + "alleles": [ + "c.3061G\u003eC" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97079005, + "dbSnpId": "rs140114515", + "call": "C|C", + "alleles": [ + "c.3049G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97079071, + "dbSnpId": "rs1801268", + "call": "C|C", + "alleles": [ + "c.2983G\u003eT (*10)" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97079076, + "dbSnpId": "rs139459586", + "call": "A|A", + "alleles": [ + "c.2978T\u003eG" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97079077, + "dbSnpId": "rs202144771", + "call": "G|G", + "alleles": [ + "c.2977C\u003eT" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97079121, + "dbSnpId": "rs72547601", + "call": "T|T", + "alleles": [ + "c.2933A\u003eG" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97079133, + "dbSnpId": "rs72547602", + "call": "T|T", + "alleles": [ + "c.2921A\u003eT" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97079139, + "dbSnpId": "rs145529148", + "call": "T|T", + "alleles": [ + "c.2915A\u003eG" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97082365, + "dbSnpId": "rs141044036", + "call": "T|T", + "alleles": [ + "c.2872A\u003eG" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97082391, + "dbSnpId": "rs67376798", + "call": "T|T", + "alleles": [ + "c.2846A\u003eT" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97098598, + "dbSnpId": "rs1801267", + "call": "C|C", + "alleles": [ + "c.2657G\u003eA (*9B)" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97098599, + "dbSnpId": "rs147545709", + "call": "G|G", + "alleles": [ + "c.2656C\u003eT" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97098616, + "dbSnpId": "rs55674432", + "call": "C|C", + "alleles": [ + "c.2639G\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97098632, + "dbSnpId": "rs201035051", + "call": "T|T", + "alleles": [ + "c.2623A\u003eC" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97193109, + "dbSnpId": "rs60139309", + "call": "T|T", + "alleles": [ + "c.2582A\u003eG" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97193209, + "dbSnpId": "rs200687447", + "call": "C|C", + "alleles": [ + "c.2482G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97234958, + "dbSnpId": "rs199634007", + "call": "G|G", + "alleles": [ + "c.2336C\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97234991, + "dbSnpId": "rs56005131", + "call": "G|G", + "alleles": [ + "c.2303C\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97305279, + "dbSnpId": "rs112766203", + "call": "G|G", + "alleles": [ + "c.2279C\u003eT" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97305363, + "dbSnpId": "rs60511679", + "call": "A|A", + "alleles": [ + "c.2195T\u003eG" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97305364, + "dbSnpId": "rs1801160", + "call": "C|C", + "alleles": [ + "c.2194G\u003eA (*6)" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97305372, + "dbSnpId": "rs146529561", + "call": "G|G", + "alleles": [ + "c.2186C\u003eT" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97306195, + "dbSnpId": "rs145548112", + "call": "C|C", + "alleles": [ + "c.2161G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97373598, + "dbSnpId": "rs137999090", + "call": "C|C", + "alleles": [ + "c.2021G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97373629, + "dbSnpId": "rs138545885", + "call": "C|C", + "alleles": [ + "c.1990G\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97382461, + "dbSnpId": "rs55971861", + "call": "T|T", + "alleles": [ + "c.1906A\u003eC" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97450058, + "dbSnpId": "rs3918290", + "call": "C|C", + "alleles": [ + "c.1905+1G\u003eA (*2A)" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97450059, + "dbSnpId": "rs3918289", + "call": "G|G", + "alleles": [ + "c.1905C\u003eG" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97450065, + "dbSnpId": "rs72549303", + "call": "TG|TG", + "alleles": [ + "c.1898delC (*3)" + ], + "phased": true, + "wildtypeAllele": "TG", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97450068, + "dbSnpId": "rs17376848", + "call": "A|A", + "alleles": [ + "c.1896T\u003eC" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97450168, + "dbSnpId": "rs147601618", + "call": "A|A", + "alleles": [ + "c.1796T\u003eC" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97450187, + "dbSnpId": "rs145773863", + "call": "C|C", + "alleles": [ + "c.1777G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97450189, + "dbSnpId": "rs138616379", + "call": "C|C", + "alleles": [ + "c.1775G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97450190, + "dbSnpId": "rs59086055", + "call": "G|G", + "alleles": [ + "c.1774C\u003eT" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97515784, + "dbSnpId": "rs201615754", + "call": "C|C", + "alleles": [ + "c.1682G\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97515787, + "dbSnpId": "rs55886062", + "call": "A|A", + "alleles": [ + "c.1679T\u003eG (*13)" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97515839, + "dbSnpId": "rs1801159", + "call": "T|T", + "alleles": [ + "c.1627A\u003eG (*5)" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97515851, + "dbSnpId": "rs142619737", + "call": "C|C", + "alleles": [ + "c.1615G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97515865, + "dbSnpId": "rs1801158", + "call": "C|C", + "alleles": [ + "c.1601G\u003eA (*4)" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97515889, + "dbSnpId": "rs190951787", + "call": "G|G", + "alleles": [ + "c.1577C\u003eG" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97515923, + "dbSnpId": "rs148994843", + "call": "C|C", + "alleles": [ + "c.1543G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97549565, + "dbSnpId": "rs138391898", + "call": "C|C", + "alleles": [ + "c.1519G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97549600, + "dbSnpId": "rs111858276", + "call": "T|T", + "alleles": [ + "c.1484A\u003eG" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97549609, + "dbSnpId": "rs72549304", + "call": "G|G", + "alleles": [ + "c.1475C\u003eT" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97549681, + "dbSnpId": "rs199549923", + "call": "G|G", + "alleles": [ + "c.1403C\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97549713, + "dbSnpId": "rs57918000", + "call": "G|G", + "alleles": [ + "c.1371C\u003eT" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97549726, + "dbSnpId": "rs144395748", + "call": "G|G", + "alleles": [ + "c.1358C\u003eG" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97549735, + "dbSnpId": "rs72975710", + "call": "G|G", + "alleles": [ + "c.1349C\u003eT" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97573785, + "dbSnpId": "rs186169810", + "call": "A|A", + "alleles": [ + "c.1314T\u003eG" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97573805, + "dbSnpId": "rs142512579", + "call": "C|C", + "alleles": [ + "c.1294G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97573821, + "dbSnpId": "rs764666241", + "call": "C|C", + "alleles": [ + "c.1278G\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97573839, + "dbSnpId": "rs200064537", + "call": "A|A", + "alleles": [ + "c.1260T\u003eA" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97573863, + "dbSnpId": "rs56038477", + "call": "C|C", + "alleles": [ + "c.1129-5923C\u003eG, c.1236G\u003eA (HapB3)" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97573881, + "dbSnpId": "rs61622928", + "call": "C|C", + "alleles": [ + "c.1218G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97573918, + "dbSnpId": "rs143815742", + "call": "C|C", + "alleles": [ + "c.1181G\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97573919, + "dbSnpId": "rs140602333", + "call": "G|G", + "alleles": [ + "c.1180C\u003eT" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97573943, + "dbSnpId": "rs78060119", + "call": "C|C", + "alleles": [ + "c.1156G\u003eT (*12)" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97579893, + "dbSnpId": "rs75017182", + "call": "G|G", + "alleles": [ + "c.1129-5923C\u003eG, c.1236G\u003eA (HapB3)" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97593238, + "dbSnpId": "rs72549305", + "call": "T|T", + "alleles": [ + "c.1108A\u003eG" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97593289, + "dbSnpId": "rs143154602", + "call": "G|G", + "alleles": [ + "c.1057C\u003eT" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97593322, + "dbSnpId": "rs183385770", + "call": "C|C", + "alleles": [ + "c.1024G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97593343, + "dbSnpId": "rs72549306", + "call": "C|C", + "alleles": [ + "c.1003G\u003eT (*11)" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97593379, + "dbSnpId": "rs201018345", + "call": "C|C", + "alleles": [ + "c.967G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97595083, + "dbSnpId": "rs145112791", + "call": "G|G", + "alleles": [ + "c.934C\u003eT" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97595088, + "dbSnpId": "rs150437414", + "call": "A|A", + "alleles": [ + "c.929T\u003eC" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97595149, + "dbSnpId": "rs146356975", + "call": "T|T", + "alleles": [ + "c.868A\u003eG" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97679170, + "dbSnpId": "rs45589337", + "call": "T|T", + "alleles": [ + "c.775A\u003eG" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97691776, + "dbSnpId": "rs1801266", + "call": "G|G", + "alleles": [ + "c.703C\u003eT (*8)" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97699399, + "dbSnpId": "rs72549307", + "call": "T|T", + "alleles": [ + "c.632A\u003eG" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97699430, + "dbSnpId": "rs72549308", + "call": "T|T", + "alleles": [ + "c.601A\u003eC" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97699474, + "dbSnpId": "rs115232898", + "call": "T|T", + "alleles": [ + "c.557A\u003eG" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97699506, + "dbSnpId": "rs6670886", + "call": "C|C", + "alleles": [ + "c.525G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97699533, + "dbSnpId": "rs139834141", + "call": "C|C", + "alleles": [ + "c.498G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97699535, + "dbSnpId": "rs2297595", + "call": "T|T", + "alleles": [ + "c.496A\u003eG" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97721542, + "dbSnpId": "rs200562975", + "call": "T|T", + "alleles": [ + "c.451A\u003eG" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97721650, + "dbSnpId": "rs141462178", + "call": "T|T", + "alleles": [ + "c.343A\u003eG" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97740400, + "dbSnpId": "rs150385342", + "call": "C|C", + "alleles": [ + "c.313G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97740410, + "dbSnpId": "rs72549309", + "call": "GATGA|GATGA", + "alleles": [ + "c.295_298delTCAT (*7)" + ], + "phased": true, + "wildtypeAllele": "GATGA", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97883329, + "dbSnpId": "rs1801265", + "call": "A|A", + "alleles": [ + "c.85T\u003eC (*9A)" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97883352, + "dbSnpId": "rs80081766", + "call": "C|C", + "alleles": [ + "c.62G\u003eA" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97883353, + "dbSnpId": "rs72549310", + "call": "G|G", + "alleles": [ + "c.61C\u003eT" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97883368, + "dbSnpId": "rs150036960", + "call": "G|G", + "alleles": [ + "c.46C\u003eG" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "G6PD", + "chr": null, + "phased": false, + "callSource": "OUTSIDE", + "uncalledHaplotypes": [], + "messages": [], + "relatedDrugs": [], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "G6PD", + "name": "B (wildtype)", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "G6PD", + "name": "B (wildtype)", + "function": "Normal function", + "reference": true + }, + "gene": "G6PD", + "phenotype": "Normal", + "variant": null, + "lookupKey": "Normal", + "label": "B (wildtype)/B (wildtype)" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "G6PD", + "name": "B (wildtype)", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "G6PD", + "name": "B (wildtype)", + "function": "Normal function", + "reference": true + }, + "gene": "G6PD", + "phenotype": "Normal", + "variant": null, + "lookupKey": "Normal", + "label": "B (wildtype)/B (wildtype)" + } + ], + "variants": [], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "IFNL3", + "chr": "chr19", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [ + { + "rule_name": "IFNL3 reverse complement footnote", + "version": "1", + "matches": { + "gene": "IFNL3", + "hapsCalled": [], + "hapsMissing": [], + "variantsMissing": [], + "variant": "", + "dips": [], + "drugs": [] + }, + "exception_type": "footnote", + "message": "The IFNL3 gene is on the negative chromosomal strand, all genotype calls for IFNL3 in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases." + } + ], + "relatedDrugs": [], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "IFNL3", + "name": "rs12979860 reference (C)", + "function": null, + "reference": true + }, + "allele2": { + "gene": "IFNL3", + "name": "rs12979860 reference (C)", + "function": null, + "reference": true + }, + "gene": "IFNL3", + "phenotype": null, + "variant": null, + "lookupKey": null, + "label": "rs12979860 reference (C)/rs12979860 reference (C)" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "IFNL3", + "name": "rs12979860 reference (C)", + "function": null, + "reference": true + }, + "allele2": { + "gene": "IFNL3", + "name": "rs12979860 reference (C)", + "function": null, + "reference": true + }, + "gene": "IFNL3", + "phenotype": null, + "variant": null, + "lookupKey": null, + "label": "rs12979860 reference (C)/rs12979860 reference (C)" + } + ], + "variants": [ + { + "gene": "IFNL3", + "chromosome": "chr19", + "position": 39248147, + "dbSnpId": "rs12979860", + "call": "C|C", + "alleles": [ + "rs12979860 variant (T)" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "MT-RNR1", + "chr": null, + "phased": false, + "callSource": "OUTSIDE", + "uncalledHaplotypes": [], + "messages": [], + "relatedDrugs": [], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "MT-RNR1", + "name": "1555A\u003eG", + "function": "increased risk of aminoglycoside-induced hearing loss", + "reference": false + }, + "allele2": null, + "gene": "MT-RNR1", + "phenotype": "increased risk of aminoglycoside-induced hearing loss", + "variant": null, + "lookupKey": "increased risk of aminoglycoside-induced hearing loss", + "label": "1555A\u003eG" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "MT-RNR1", + "name": "1555A\u003eG", + "function": "increased risk of aminoglycoside-induced hearing loss", + "reference": false + }, + "allele2": null, + "gene": "MT-RNR1", + "phenotype": "increased risk of aminoglycoside-induced hearing loss", + "variant": null, + "lookupKey": "increased risk of aminoglycoside-induced hearing loss", + "label": "1555A\u003eG" + } + ], + "variants": [], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "NUDT15", + "chr": "chr13", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [], + "relatedDrugs": [], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "NUDT15", + "name": "*1", + "function": "Normal Function", + "reference": true + }, + "allele2": { + "gene": "NUDT15", + "name": "*1", + "function": "Normal Function", + "reference": true + }, + "gene": "NUDT15", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*1/*1" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "NUDT15", + "name": "*1", + "function": "Normal Function", + "reference": true + }, + "allele2": { + "gene": "NUDT15", + "name": "*1", + "function": "Normal Function", + "reference": true + }, + "gene": "NUDT15", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*1/*1" + } + ], + "variants": [ + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48037748, + "dbSnpId": "rs769369441", + "call": "T|T", + "alleles": [ + "*10" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48037749, + "dbSnpId": null, + "call": "G|G", + "alleles": [ + "*19" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48037782, + "dbSnpId": "rs746071566", + "call": "AGGAGTC|AGGAGTC", + "alleles": [ + "*2", + "*6", + "*9" + ], + "phased": true, + "wildtypeAllele": "AGGAGTC", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48037798, + "dbSnpId": "rs186364861", + "call": "G|G", + "alleles": [ + "*5" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48037825, + "dbSnpId": "rs777311140", + "call": "C|C", + "alleles": [ + "*14" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48037834, + "dbSnpId": "rs1202487323", + "call": "C|C", + "alleles": [ + "*16" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48037847, + "dbSnpId": "rs766023281", + "call": "G|G", + "alleles": [ + "*7" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48037849, + "dbSnpId": null, + "call": "A|A", + "alleles": [ + "*8" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48037885, + "dbSnpId": "rs1950545307", + "call": "G|G", + "alleles": [ + "*11" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48037902, + "dbSnpId": "rs149436418", + "call": "C|C", + "alleles": [ + "*12" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48040977, + "dbSnpId": "rs1457579126", + "call": "GA|GA", + "alleles": [ + "*18" + ], + "phased": true, + "wildtypeAllele": "GA", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48041103, + "dbSnpId": "rs761191455", + "call": "T|T", + "alleles": [ + "*13" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48041113, + "dbSnpId": "rs1368252918", + "call": "G|G", + "alleles": [ + "*17" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48045690, + "dbSnpId": "rs768324690", + "call": "C|C", + "alleles": [ + "*20" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48045719, + "dbSnpId": "rs116855232", + "call": "C|C", + "alleles": [ + "*2", + "*3" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48045720, + "dbSnpId": "rs147390019", + "call": "G|G", + "alleles": [ + "*4" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48045771, + "dbSnpId": "rs139551410", + "call": "T|T", + "alleles": [ + "*15" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "RYR1", + "chr": "chr19", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [], + "relatedDrugs": [], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "RYR1", + "name": "Reference", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "RYR1", + "name": "Reference", + "function": "Normal function", + "reference": true + }, + "gene": "RYR1", + "phenotype": "Uncertain Susceptibility", + "variant": null, + "lookupKey": "Uncertain Susceptibility", + "label": "Reference/Reference" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "RYR1", + "name": "Reference", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "RYR1", + "name": "Reference", + "function": "Normal function", + "reference": true + }, + "gene": "RYR1", + "phenotype": "Uncertain Susceptibility", + "variant": null, + "lookupKey": "Uncertain Susceptibility", + "label": "Reference/Reference" + } + ], + "variants": [ + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38440802, + "dbSnpId": "rs193922747", + "call": "T|T", + "alleles": [ + "c.103T\u003eC" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38440829, + "dbSnpId": "rs193922748", + "call": "C|C", + "alleles": [ + "c.130C\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38444211, + "dbSnpId": "rs118192161", + "call": "C|C", + "alleles": [ + "c.487C\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38444212, + "dbSnpId": "rs193922753", + "call": "G|G", + "alleles": [ + "c.488G\u003eT" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38446710, + "dbSnpId": "rs1801086", + "call": "G|G", + "alleles": [ + "c.742G\u003eA", + "c.742G\u003eC" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38448673, + "dbSnpId": "rs193922762", + "call": "C|C", + "alleles": [ + "c.982C\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38448712, + "dbSnpId": "rs121918592", + "call": "G|G", + "alleles": [ + "c.1021G\u003eA", + "c.1021G\u003eC" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38451842, + "dbSnpId": "rs193922764", + "call": "C|C", + "alleles": [ + "c.1201C\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38451850, + "dbSnpId": "rs118192116", + "call": "C|C", + "alleles": [ + "c.1209C\u003eG" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38455359, + "dbSnpId": "rs118192162", + "call": "A|A", + "alleles": [ + "c.1565A\u003eC" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38455463, + "dbSnpId": "rs111888148", + "call": "G|G", + "alleles": [ + "c.1589G\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38455471, + "dbSnpId": "rs193922768", + "call": "C|C", + "alleles": [ + "c.1597C\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38455472, + "dbSnpId": "rs144336148", + "call": "G|G", + "alleles": [ + "c.1598G\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38455528, + "dbSnpId": "rs193922770", + "call": "C|C", + "alleles": [ + "c.1654C\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38457545, + "dbSnpId": "rs118192172", + "call": "C|C", + "alleles": [ + "c.1840C\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38457546, + "dbSnpId": "rs193922772", + "call": "G|G", + "alleles": [ + "c.1841G\u003eT" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38494564, + "dbSnpId": "rs118192175", + "call": "C|C", + "alleles": [ + "c.6487C\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38494565, + "dbSnpId": "rs118192163", + "call": "G|G", + "alleles": [ + "c.6488G\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38494579, + "dbSnpId": "rs118192176", + "call": "G|G", + "alleles": [ + "c.6502G\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38496283, + "dbSnpId": "rs118192177", + "call": "C|C", + "alleles": [ + "c.6617C\u003eG", + "c.6617C\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38499223, + "dbSnpId": "rs112563513", + "call": "G|G", + "alleles": [ + "c.7007G\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38499644, + "dbSnpId": "rs121918596", + "call": "TGGA|TGGA", + "alleles": [ + "c.7042_7044delGAG" + ], + "phased": true, + "wildtypeAllele": "TGGA", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38499655, + "dbSnpId": "rs193922802", + "call": "G|G", + "alleles": [ + "c.7048G\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38499670, + "dbSnpId": "rs193922803", + "call": "C|C", + "alleles": [ + "c.7063C\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38499731, + "dbSnpId": "rs193922807", + "call": "G|G", + "alleles": [ + "c.7124G\u003eC" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38499975, + "dbSnpId": "rs193922809", + "call": "G|G", + "alleles": [ + "c.7282G\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38499993, + "dbSnpId": "rs121918593", + "call": "G|G", + "alleles": [ + "c.7300G\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38499997, + "dbSnpId": "rs28933396", + "call": "G|G", + "alleles": [ + "c.7304G\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38500636, + "dbSnpId": "rs118192124", + "call": "C|C", + "alleles": [ + "c.7354C\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38500642, + "dbSnpId": "rs193922816", + "call": "C|C", + "alleles": [ + "c.7360C\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38500643, + "dbSnpId": "rs118192122", + "call": "G|G", + "alleles": [ + "c.7361G\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38500654, + "dbSnpId": "rs28933397", + "call": "C|C", + "alleles": [ + "c.7372C\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38500655, + "dbSnpId": "rs121918594", + "call": "G|G", + "alleles": [ + "c.7373G\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38500898, + "dbSnpId": "rs118192178", + "call": "C|C", + "alleles": [ + "c.7522C\u003eG", + "c.7522C\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38500899, + "dbSnpId": "rs193922818", + "call": "G|G", + "alleles": [ + "c.7523G\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38512321, + "dbSnpId": "rs193922832", + "call": "G|G", + "alleles": [ + "c.9310G\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38543832, + "dbSnpId": "rs193922843", + "call": "G|G", + "alleles": [ + "c.11969G\u003eT" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38580004, + "dbSnpId": "rs118192167", + "call": "A|A", + "alleles": [ + "c.14387A\u003eG" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38580094, + "dbSnpId": "rs121918595", + "call": "C|C", + "alleles": [ + "c.14477C\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38580114, + "dbSnpId": "rs193922876", + "call": "C|C", + "alleles": [ + "c.14497C\u003eT" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38580370, + "dbSnpId": "rs193922878", + "call": "C|C", + "alleles": [ + "c.14512C\u003eG" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38580403, + "dbSnpId": "rs118192168", + "call": "G|G", + "alleles": [ + "c.14545G\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38580440, + "dbSnpId": "rs63749869", + "call": "G|G", + "alleles": [ + "c.14582G\u003eA" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38584989, + "dbSnpId": "rs118192170", + "call": "T|T", + "alleles": [ + "c.14693T\u003eC" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "SLCO1B1", + "chr": "chr12", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [ + "*38", + "*41", + "*45" + ], + "messages": [], + "relatedDrugs": [], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "SLCO1B1", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "SLCO1B1", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "gene": "SLCO1B1", + "phenotype": "Normal function", + "variant": null, + "lookupKey": "Normal function", + "label": "*1/*1" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "SLCO1B1", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "SLCO1B1", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "gene": "SLCO1B1", + "phenotype": "Normal function", + "variant": null, + "lookupKey": "Normal function", + "label": "*1/*1" + } + ], + "variants": [ + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21172734, + "dbSnpId": "rs139257324", + "call": "C|C", + "alleles": [ + "*33" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21172776, + "dbSnpId": "rs373327528", + "call": "G|G", + "alleles": [ + "*23" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21172782, + "dbSnpId": "rs56101265", + "call": "T|T", + "alleles": [ + "*2", + "*12" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21174595, + "dbSnpId": "rs56061388", + "call": "T|T", + "alleles": [ + "*3", + "*13" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21176804, + "dbSnpId": "rs2306283", + "call": "A|A", + "alleles": [ + "*14", + "*15", + "*20", + "*24", + "*25", + "*27", + "*28", + "*29", + "*30", + "*31", + "*32", + "*33", + "*37", + "*39", + "*42", + "*43", + "*44", + "*46", + "*47" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21176868, + "dbSnpId": "rs2306282", + "call": "A|A", + "alleles": [ + "*16" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21176879, + "dbSnpId": "rs11045819", + "call": "C|C", + "alleles": [ + "*4", + "*14", + "*25", + "*32", + "*43" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21176883, + "dbSnpId": "rs72559745", + "call": "A|A", + "alleles": [ + "*3", + "*13" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21178615, + "dbSnpId": "rs4149056", + "call": "T|T", + "alleles": [ + "*5", + "*15", + "*40", + "*46", + "*47" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21178957, + "dbSnpId": "rs79135870", + "call": "A|A", + "alleles": [ + "*30" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21196951, + "dbSnpId": "rs11045852", + "call": "A|A", + "alleles": [ + "*24", + "*25", + "*28", + "*32", + "*33", + "*43", + "*44" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21196976, + "dbSnpId": "rs11045853", + "call": "G|G", + "alleles": [ + "*25", + "*28", + "*33" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21200595, + "dbSnpId": "rs55901008", + "call": "T|T", + "alleles": [ + "*6" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21202553, + "dbSnpId": "rs1228465562", + "call": "T|T", + "alleles": [ + "*36" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21202555, + "dbSnpId": "rs59113707", + "call": "C|C", + "alleles": [ + "*27" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21202649, + "dbSnpId": "rs56387224", + "call": "A|A", + "alleles": [ + "*7" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21202664, + "dbSnpId": "rs142965323", + "call": "G|G", + "alleles": [ + "*26" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21205921, + "dbSnpId": "rs72559748", + "call": "A|A", + "alleles": [ + "*8" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21205999, + "dbSnpId": "rs59502379", + "call": "G|G", + "alleles": [ + "*9", + "*31" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21239042, + "dbSnpId": "rs34671512", + "call": "A|A", + "alleles": [ + "*19", + "*20", + "*40" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21239077, + "dbSnpId": "rs56199088", + "call": "A|A", + "alleles": [ + "*10", + "*12" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21239113, + "dbSnpId": "rs55737008", + "call": "A|A", + "alleles": [ + "*11", + "*13" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21239145, + "dbSnpId": "rs200995543", + "call": "C|C", + "alleles": [ + "*34" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21239158, + "dbSnpId": "rs140790673", + "call": "C|C", + "alleles": [ + "*29" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21176871, + "dbSnpId": null, + "call": null, + "alleles": [ + "*38" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21176898, + "dbSnpId": "rs77271279", + "call": null, + "alleles": [ + "*41" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21178612, + "dbSnpId": "rs141467543", + "call": null, + "alleles": [ + "*42" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21196975, + "dbSnpId": "rs183501729", + "call": null, + "alleles": [ + "*39" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21200544, + "dbSnpId": "rs72559747", + "call": null, + "alleles": [ + "*47" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21206031, + "dbSnpId": "rs74064213", + "call": null, + "alleles": [ + "*43", + "*44" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21222355, + "dbSnpId": "rs71581941", + "call": null, + "alleles": [ + "*45", + "*46" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [ + "rs4149056T/rs4149056T" + ] + }, + { + "geneSymbol": "TPMT", + "chr": "chr6", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [ + { + "rule_name": "TPMT reverse complement footnote", + "version": "1", + "matches": { + "gene": "TPMT", + "hapsCalled": [], + "hapsMissing": [], + "variantsMissing": [], + "variant": "", + "dips": [], + "drugs": [] + }, + "exception_type": "footnote", + "message": "The TPMT gene is on the negative chromosomal strand, all genotype calls for TPMT in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases." + } + ], + "relatedDrugs": [], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "TPMT", + "name": "*1", + "function": "Normal Function", + "reference": true + }, + "allele2": { + "gene": "TPMT", + "name": "*1", + "function": "Normal Function", + "reference": true + }, + "gene": "TPMT", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*1/*1" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "TPMT", + "name": "*1", + "function": "Normal Function", + "reference": true + }, + "allele2": { + "gene": "TPMT", + "name": "*1", + "function": "Normal Function", + "reference": true + }, + "gene": "TPMT", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*1/*1" + } + ], + "variants": [ + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18130687, + "dbSnpId": "rs1142345", + "call": "T|T", + "alleles": [ + "*3A", + "*3C", + "*41" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18130694, + "dbSnpId": "rs150900439", + "call": "T|T", + "alleles": [ + "*20" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18130725, + "dbSnpId": "rs72552736", + "call": "A|A", + "alleles": [ + "*7" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18130729, + "dbSnpId": "rs139392616", + "call": "C|C", + "alleles": [ + "*40" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18130758, + "dbSnpId": "rs398122996", + "call": "A|A", + "alleles": [ + "*37" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18130762, + "dbSnpId": "rs56161402", + "call": "C|C", + "alleles": [ + "*8" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18130772, + "dbSnpId": "rs377085266", + "call": "A|A", + "alleles": [ + "*25" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18130781, + "dbSnpId": "rs1800584", + "call": "C|C", + "alleles": [ + "*4" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18132136, + "dbSnpId": "rs72556347", + "call": "A|A", + "alleles": [ + "*26" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18132147, + "dbSnpId": "rs79901429", + "call": "A|A", + "alleles": [ + "*31" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18132163, + "dbSnpId": null, + "call": "C|C", + "alleles": [ + "*36" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18133845, + "dbSnpId": "rs75543815", + "call": "T|T", + "alleles": [ + "*6" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18133847, + "dbSnpId": "rs6921269", + "call": "C|C", + "alleles": [ + "*24" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18133870, + "dbSnpId": "rs772832951", + "call": "A|A", + "alleles": [ + "*38" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18133884, + "dbSnpId": "rs74423290", + "call": "G|G", + "alleles": [ + "*23" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18133887, + "dbSnpId": "rs201695576", + "call": "T|T", + "alleles": [ + "*44" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18133890, + "dbSnpId": "rs9333570", + "call": "C|C", + "alleles": [ + "*15" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18138969, + "dbSnpId": "rs144041067", + "call": "C|C", + "alleles": [ + "*16", + "*22" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18138970, + "dbSnpId": "rs112339338", + "call": "G|G", + "alleles": [ + "*33" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18138997, + "dbSnpId": "rs1800460", + "call": "C|C", + "alleles": [ + "*3A", + "*3B" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18139027, + "dbSnpId": "rs72552737", + "call": "C|C", + "alleles": [ + "*10" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18139689, + "dbSnpId": "rs72552738", + "call": "C|C", + "alleles": [ + "*11" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18139710, + "dbSnpId": "rs200220210", + "call": "G|G", + "alleles": [ + "*12" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18143597, + "dbSnpId": null, + "call": "T|T", + "alleles": [ + "*19" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18143606, + "dbSnpId": "rs151149760", + "call": "T|T", + "alleles": [ + "*9" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18143613, + "dbSnpId": null, + "call": "C|C", + "alleles": [ + "*28" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18143622, + "dbSnpId": "rs115106679", + "call": "C|C", + "alleles": [ + "*32" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18143643, + "dbSnpId": null, + "call": "A|A", + "alleles": [ + "*27" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18143700, + "dbSnpId": "rs753545734", + "call": "C|C", + "alleles": [ + "*43" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18143718, + "dbSnpId": "rs111901354", + "call": "G|G", + "alleles": [ + "*34" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18143724, + "dbSnpId": "rs1800462", + "call": "C|C", + "alleles": [ + "*2" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18143728, + "dbSnpId": "rs1256618794", + "call": "C|C", + "alleles": [ + "*43" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18147838, + "dbSnpId": "rs281874771", + "call": "G|G", + "alleles": [ + "*39" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18147845, + "dbSnpId": "rs777686348", + "call": "C|C", + "alleles": [ + "*18" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18147851, + "dbSnpId": "rs200591577", + "call": "G|G", + "alleles": [ + "*21" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18147856, + "dbSnpId": null, + "call": "A|A", + "alleles": [ + "*35" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18147910, + "dbSnpId": "rs72552740", + "call": "A|A", + "alleles": [ + "*5" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18149004, + "dbSnpId": null, + "call": "G|G", + "alleles": [ + "*17" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18149022, + "dbSnpId": "rs750424422", + "call": "C|C", + "alleles": [ + "*30" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18149032, + "dbSnpId": "rs759836180", + "call": "C|C", + "alleles": [ + "*42" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18149045, + "dbSnpId": "rs72552742", + "call": "T|T", + "alleles": [ + "*13" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18149126, + "dbSnpId": "rs267607275", + "call": "A|A", + "alleles": [ + "*29" + ], + "phased": true, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18149127, + "dbSnpId": "rs9333569", + "call": "T|T", + "alleles": [ + "*14" + ], + "phased": true, + "wildtypeAllele": "T", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "UGT1A1", + "chr": "chr2", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [ + { + "rule_name": "UGT1A1 repeat warning", + "version": "1", + "matches": { + "gene": "UGT1A1", + "hapsCalled": [], + "hapsMissing": [], + "variantsMissing": [], + "variant": "", + "dips": [], + "drugs": [] + }, + "exception_type": "footnote", + "message": "Some alleles in UGT1A1 are distinguished by a repeat sequence; some genotyping technologies may not accurately call the repeat." + } + ], + "relatedDrugs": [], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "UGT1A1", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "UGT1A1", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "gene": "UGT1A1", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*1/*1" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "UGT1A1", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "UGT1A1", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "gene": "UGT1A1", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*1/*1" + } + ], + "variants": [ + { + "gene": "UGT1A1", + "chromosome": "chr2", + "position": 233759924, + "dbSnpId": "rs887829", + "call": "C|C", + "alleles": [ + "*80", + "*80+*28", + "*80+*37" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "UGT1A1", + "chromosome": "chr2", + "position": 233760233, + "dbSnpId": "rs3064744", + "call": "CAT|CAT", + "alleles": [ + "*28", + "*36", + "*37", + "*80+*28", + "*80+*37" + ], + "phased": true, + "wildtypeAllele": "CAT", + "mismatch": false + }, + { + "gene": "UGT1A1", + "chromosome": "chr2", + "position": 233760498, + "dbSnpId": "rs4148323", + "call": "G|G", + "alleles": [ + "*6" + ], + "phased": true, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "UGT1A1", + "chromosome": "chr2", + "position": 233760973, + "dbSnpId": "rs35350960", + "call": "C|C", + "alleles": [ + "*27" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "VKORC1", + "chr": "chr16", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [ + { + "rule_name": "VKORC1", + "version": "1", + "matches": { + "gene": "VKORC1", + "hapsCalled": [], + "hapsMissing": [], + "variantsMissing": [], + "variant": "", + "dips": [], + "drugs": [] + }, + "exception_type": "footnote", + "message": "CPIC recommendations for warfarin use only rs9923231; however, other variants in VKORC1 may have functional consequences and may be more common in some populations." + }, + { + "rule_name": "VKORC1 reverse complement footnote", + "version": "1", + "matches": { + "gene": "VKORC1", + "hapsCalled": [], + "hapsMissing": [], + "variantsMissing": [], + "variant": "", + "dips": [], + "drugs": [] + }, + "exception_type": "footnote", + "message": "The VKORC1 gene is on the negative chromosomal strand, all genotype calls for VKORC1 in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases." + } + ], + "relatedDrugs": [], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "VKORC1", + "name": "rs9923231 reference (C)", + "function": null, + "reference": true + }, + "allele2": { + "gene": "VKORC1", + "name": "rs9923231 reference (C)", + "function": null, + "reference": true + }, + "gene": "VKORC1", + "phenotype": null, + "variant": null, + "lookupKey": null, + "label": "rs9923231 reference (C)/rs9923231 reference (C)" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "VKORC1", + "name": "rs9923231 reference (C)", + "function": null, + "reference": true + }, + "allele2": { + "gene": "VKORC1", + "name": "rs9923231 reference (C)", + "function": null, + "reference": true + }, + "gene": "VKORC1", + "phenotype": null, + "variant": null, + "lookupKey": null, + "label": "rs9923231 reference (C)/rs9923231 reference (C)" + } + ], + "variants": [ + { + "gene": "VKORC1", + "chromosome": "chr16", + "position": 31096368, + "dbSnpId": "rs9923231", + "call": "C|C", + "alleles": [ + "rs9923231 variant (T)" + ], + "phased": true, + "wildtypeAllele": "C", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + } +] \ No newline at end of file diff -r 000000000000 -r 28aa54c800c0 test-data/test_4.json --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_4.json Fri Jan 28 21:17:56 2022 +0000 @@ -0,0 +1,6480 @@ +[ + { + "geneSymbol": "CACNA1S", + "chr": "chr1", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [], + "relatedDrugs": [], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "CACNA1S", + "name": "Reference", + "function": "Normal Function", + "reference": true + }, + "allele2": { + "gene": "CACNA1S", + "name": "Reference", + "function": "Normal Function", + "reference": true + }, + "gene": "CACNA1S", + "phenotype": "Uncertain Susceptibility", + "variant": null, + "lookupKey": "Uncertain Susceptibility", + "label": "Reference/Reference" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "CACNA1S", + "name": "Reference", + "function": "Normal Function", + "reference": true + }, + "allele2": { + "gene": "CACNA1S", + "name": "Reference", + "function": "Normal Function", + "reference": true + }, + "gene": "CACNA1S", + "phenotype": "Uncertain Susceptibility", + "variant": null, + "lookupKey": "Uncertain Susceptibility", + "label": "Reference/Reference" + } + ], + "variants": [ + { + "gene": "CACNA1S", + "chromosome": "chr1", + "position": 201060815, + "dbSnpId": "rs1800559", + "call": "C|C", + "alleles": [ + "c.3257G\u003eA" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CACNA1S", + "chromosome": "chr1", + "position": 201091993, + "dbSnpId": "rs772226819", + "call": "G|G", + "alleles": [ + "c.520C\u003eT" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "CFTR", + "chr": "chr7", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [], + "relatedDrugs": [], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "CFTR", + "name": "ivacaftor non-responsive CFTR sequence", + "function": "ivacaftor non-responsive", + "reference": true + }, + "allele2": { + "gene": "CFTR", + "name": "ivacaftor non-responsive CFTR sequence", + "function": "ivacaftor non-responsive", + "reference": true + }, + "gene": "CFTR", + "phenotype": "ivacaftor non-responsive in CF patients", + "variant": null, + "lookupKey": "ivacaftor non-responsive in CF patients", + "label": "No CPIC variants found" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "CFTR", + "name": "ivacaftor non-responsive CFTR sequence", + "function": "ivacaftor non-responsive", + "reference": true + }, + "allele2": { + "gene": "CFTR", + "name": "ivacaftor non-responsive CFTR sequence", + "function": "ivacaftor non-responsive", + "reference": true + }, + "gene": "CFTR", + "phenotype": "ivacaftor non-responsive in CF patients", + "variant": null, + "lookupKey": "ivacaftor non-responsive in CF patients", + "label": "No CPIC variants found" + } + ], + "variants": [ + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117509035, + "dbSnpId": "rs397508256", + "call": "G|G", + "alleles": [ + "E56K" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117509069, + "dbSnpId": "rs368505753", + "call": "C|C", + "alleles": [ + "P67L" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117509089, + "dbSnpId": "rs115545701", + "call": "C|C", + "alleles": [ + "R74W" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117530953, + "dbSnpId": "rs113993958", + "call": "G|G", + "alleles": [ + "D110H" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117530955, + "dbSnpId": "rs397508537", + "call": "C|C", + "alleles": [ + "D110E" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117530974, + "dbSnpId": "rs77834169", + "call": "C|C", + "alleles": [ + "R117C" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117530975, + "dbSnpId": "rs78655421", + "call": "G|G", + "alleles": [ + "R117H" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117534318, + "dbSnpId": "rs80282562", + "call": "G|G", + "alleles": [ + "G178R" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117534363, + "dbSnpId": "rs397508759", + "call": "G|G", + "alleles": [ + "E193K" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117534368, + "dbSnpId": "rs397508761", + "call": "A|A", + "alleles": [ + "711+3A-\u003eG" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117535285, + "dbSnpId": "rs121908752", + "call": "T|T", + "alleles": [ + "L206W" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117540270, + "dbSnpId": "rs77932196", + "call": "G|G", + "alleles": [ + "R347H" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117540285, + "dbSnpId": "rs121908753", + "call": "G|G", + "alleles": [ + "R352Q" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117548795, + "dbSnpId": "rs74551128", + "call": "C|C", + "alleles": [ + "A455E" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117587799, + "dbSnpId": "rs121908757", + "call": "A|A", + "alleles": [ + "S549R(A\u003eC)" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117587800, + "dbSnpId": "rs121908755", + "call": "G|G", + "alleles": [ + "S549N" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117587801, + "dbSnpId": "rs121909005", + "call": "T|T", + "alleles": [ + "S549R(T\u003eG)" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117587805, + "dbSnpId": "rs121909013", + "call": "G|G", + "alleles": [ + "G551S" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117587806, + "dbSnpId": "rs75527207", + "call": "G|G", + "alleles": [ + "G551D" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117590409, + "dbSnpId": "rs397508288", + "call": "A|A", + "alleles": [ + "D579G" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117594930, + "dbSnpId": "rs397508387", + "call": "G|G", + "alleles": [ + "E831X" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117602868, + "dbSnpId": "rs80224560", + "call": "G|G", + "alleles": [ + "2789+5G-\u003eA" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117603708, + "dbSnpId": "rs397508442", + "call": "C|C", + "alleles": [ + "S945L" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117606695, + "dbSnpId": "rs141033578", + "call": "C|C", + "alleles": [ + "S977F" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117611555, + "dbSnpId": "rs76151804", + "call": "A|A", + "alleles": [ + "3272-26A-\u003eG" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117611595, + "dbSnpId": "rs150212784", + "call": "T|T", + "alleles": [ + "F1052V" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117611620, + "dbSnpId": "rs397508513", + "call": "A|A", + "alleles": [ + "K1060T" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117611640, + "dbSnpId": "rs121909020", + "call": "G|G", + "alleles": [ + "A1067T" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117611646, + "dbSnpId": "rs200321110", + "call": "G|G", + "alleles": [ + "G1069R" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117611649, + "dbSnpId": "rs202179988", + "call": "C|C", + "alleles": [ + "R1070W" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117611650, + "dbSnpId": "rs78769542", + "call": "G|G", + "alleles": [ + "R1070Q" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117611663, + "dbSnpId": "rs186045772", + "call": "T|T", + "alleles": [ + "F1074L" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117614699, + "dbSnpId": "rs75541969", + "call": "G|G", + "alleles": [ + "D1152H" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117639961, + "dbSnpId": "rs75039782", + "call": "C|C", + "alleles": [ + "3849+10kbC-\u003eT" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117642451, + "dbSnpId": "rs267606723", + "call": "G|G", + "alleles": [ + "G1244E" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117642472, + "dbSnpId": "rs74503330", + "call": "G|G", + "alleles": [ + "S1251N" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117642483, + "dbSnpId": "rs121909041", + "call": "T|T", + "alleles": [ + "S1255P" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117642528, + "dbSnpId": "rs11971167", + "call": "G|G", + "alleles": [ + "D1270N" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CFTR", + "chromosome": "chr7", + "position": 117664770, + "dbSnpId": "rs193922525", + "call": "G|G", + "alleles": [ + "G1349D" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "CYP2B6", + "chr": "chr19", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [], + "relatedDrugs": [], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "CYP2B6", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "CYP2B6", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "gene": "CYP2B6", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*1/*1" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "CYP2B6", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "CYP2B6", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "gene": "CYP2B6", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*1/*1" + } + ], + "variants": [ + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 40991224, + "dbSnpId": "rs34223104", + "call": "T|T", + "alleles": [ + "*22", + "*34", + "*35", + "*36" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 40991367, + "dbSnpId": "rs34883432", + "call": "A|A", + "alleles": [ + "*10" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 40991369, + "dbSnpId": "rs8192709", + "call": "C|C", + "alleles": [ + "*2", + "*10" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 40991381, + "dbSnpId": "rs33973337", + "call": "A|A", + "alleles": [ + "*17" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 40991388, + "dbSnpId": "rs33980385", + "call": "A|A", + "alleles": [ + "*17" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 40991390, + "dbSnpId": "rs33926104", + "call": "C|C", + "alleles": [ + "*17" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 40991391, + "dbSnpId": "rs34284776", + "call": "G|G", + "alleles": [ + "*17" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 40991441, + "dbSnpId": "rs35303484", + "call": "A|A", + "alleles": [ + "*11" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41004015, + "dbSnpId": "rs281864907", + "call": "T|T", + "alleles": [ + "*38" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41004125, + "dbSnpId": "rs36060847", + "call": "G|G", + "alleles": [ + "*12" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41004158, + "dbSnpId": "rs186335453", + "call": "G|G", + "alleles": [ + "*35" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41004303, + "dbSnpId": "rs139801276", + "call": "T|T", + "alleles": [ + "*35" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41004377, + "dbSnpId": "rs12721655", + "call": "A|A", + "alleles": [ + "*8", + "*13" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41004381, + "dbSnpId": "rs35773040", + "call": "G|G", + "alleles": [ + "*14" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41004406, + "dbSnpId": "rs145884402", + "call": "G|G", + "alleles": [ + "*35" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41006919, + "dbSnpId": "rs3826711", + "call": "C|C", + "alleles": [ + "*26" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41006923, + "dbSnpId": "rs36056539", + "call": "C|C", + "alleles": [ + "*20" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41006936, + "dbSnpId": "rs3745274", + "call": "G|G", + "alleles": [ + "*6", + "*7", + "*9", + "*13", + "*19", + "*20", + "*26", + "*34", + "*36", + "*37", + "*38" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41006968, + "dbSnpId": "rs373489637", + "call": "T|T", + "alleles": [ + "*37" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41007013, + "dbSnpId": "rs36079186", + "call": "T|T", + "alleles": [ + "*27", + "*35" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41009350, + "dbSnpId": "rs45482602", + "call": "C|C", + "alleles": [ + "*3" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41009358, + "dbSnpId": "rs2279343", + "call": "A|A", + "alleles": [ + "*4", + "*6", + "*7", + "*13", + "*18", + "*19", + "*20", + "*26", + "*34", + "*36", + "*37", + "*38" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41010006, + "dbSnpId": "rs139029625", + "call": "G|G", + "alleles": [ + "*35" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41010088, + "dbSnpId": "rs34698757", + "call": "C|C", + "alleles": [ + "*28" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41010108, + "dbSnpId": "rs193922917", + "call": "C|C", + "alleles": [ + "*31" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41012316, + "dbSnpId": "rs28399499", + "call": "T|T", + "alleles": [ + "*18" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41012339, + "dbSnpId": "rs34826503", + "call": "C|C", + "alleles": [ + "*19" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41012465, + "dbSnpId": "rs34097093", + "call": "C|C", + "alleles": [ + "*28" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41012693, + "dbSnpId": "rs35979566", + "call": "T|T", + "alleles": [ + "*15" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41012740, + "dbSnpId": "rs193922918", + "call": "G|G", + "alleles": [ + "*32" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41012803, + "dbSnpId": "rs35010098", + "call": "C|C", + "alleles": [ + "*21" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41016726, + "dbSnpId": "rs3211369", + "call": "A|A", + "alleles": [ + "*23" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41016778, + "dbSnpId": "rs564083989", + "call": "G|G", + "alleles": [ + "*24" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41016805, + "dbSnpId": null, + "call": "A|A", + "alleles": [ + "*25" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2B6", + "chromosome": "chr19", + "position": 41016810, + "dbSnpId": "rs3211371", + "call": "C|C", + "alleles": [ + "*5", + "*7", + "*33", + "*34" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "CYP2C19", + "chr": "chr10", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [], + "relatedDrugs": [], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "CYP2C19", + "name": "*38", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "CYP2C19", + "name": "*38", + "function": "Normal function", + "reference": true + }, + "gene": "CYP2C19", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*38/*38" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "CYP2C19", + "name": "*38", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "CYP2C19", + "name": "*38", + "function": "Normal function", + "reference": true + }, + "gene": "CYP2C19", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*38/*38" + } + ], + "variants": [ + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94761900, + "dbSnpId": "rs12248560", + "call": "C|C", + "alleles": [ + "*4", + "*17" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94762706, + "dbSnpId": "rs28399504", + "call": "A|A", + "alleles": [ + "*4" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94762712, + "dbSnpId": "rs367543002", + "call": "C|C", + "alleles": [ + "*34" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94762715, + "dbSnpId": "rs367543003", + "call": "T|T", + "alleles": [ + "*34" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94762755, + "dbSnpId": "rs55752064", + "call": "T|T", + "alleles": [ + "*14" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94762760, + "dbSnpId": "rs17882687", + "call": "A|A", + "alleles": [ + "*15", + "*28", + "*35", + "*39" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94762788, + "dbSnpId": "rs1564656981", + "call": "A|A", + "alleles": [ + "*29" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94762856, + "dbSnpId": "rs1564657013", + "call": "A|A", + "alleles": [ + "*19" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94775106, + "dbSnpId": "rs145328984", + "call": "C|C", + "alleles": [ + "*30" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94775121, + "dbSnpId": "rs1564660997", + "call": "C|C", + "alleles": [ + "*31" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94775160, + "dbSnpId": "rs118203756", + "call": "G|G", + "alleles": [ + "*23" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94775185, + "dbSnpId": "rs1288601658", + "call": "A|A", + "alleles": [ + "*32" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94775367, + "dbSnpId": "rs12769205", + "call": "A|A", + "alleles": [ + "*2", + "*35" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94775416, + "dbSnpId": "rs41291556", + "call": "T|T", + "alleles": [ + "*8" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94775423, + "dbSnpId": "rs17885179", + "call": "A|A", + "alleles": [ + "*39" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94775453, + "dbSnpId": "rs72552267", + "call": "G|G", + "alleles": [ + "*6" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94775489, + "dbSnpId": "rs17884712", + "call": "G|G", + "alleles": [ + "*9" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94775507, + "dbSnpId": "rs58973490", + "call": "G|G", + "alleles": [ + "*2", + "*11" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94780574, + "dbSnpId": "rs140278421", + "call": "G|G", + "alleles": [ + "*22" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94780579, + "dbSnpId": "rs370803989", + "call": "G|G", + "alleles": [ + "*33" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94780653, + "dbSnpId": "rs4986893", + "call": "G|G", + "alleles": [ + "*3" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94781858, + "dbSnpId": "rs6413438", + "call": "C|C", + "alleles": [ + "*10" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94781859, + "dbSnpId": "rs4244285", + "call": "G|G", + "alleles": [ + "*2" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94781944, + "dbSnpId": "rs375781227", + "call": "G|G", + "alleles": [ + "*26" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94781999, + "dbSnpId": "rs72558186", + "call": "T|T", + "alleles": [ + "*7" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94842861, + "dbSnpId": "rs138142612", + "call": "G|G", + "alleles": [ + "*18" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94842866, + "dbSnpId": "rs3758581", + "call": "A|A", + "alleles": [ + "*2", + "*3", + "*4", + "*5", + "*6", + "*8", + "*9", + "*10", + "*11", + "*12", + "*13", + "*14", + "*15", + "*17", + "*18", + "*19", + "*22", + "*23", + "*24", + "*25", + "*26", + "*28", + "*29", + "*31", + "*32", + "*33", + "*35", + "*39" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94842879, + "dbSnpId": "rs118203757", + "call": "G|G", + "alleles": [ + "*24" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94842995, + "dbSnpId": "rs113934938", + "call": "G|G", + "alleles": [ + "*28" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94849995, + "dbSnpId": "rs17879685", + "call": "C|C", + "alleles": [ + "*13" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94852738, + "dbSnpId": "rs56337013", + "call": "C|C", + "alleles": [ + "*5" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94852765, + "dbSnpId": "rs192154563", + "call": "C|C", + "alleles": [ + "*16" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94852785, + "dbSnpId": "rs118203759", + "call": "C|C", + "alleles": [ + "*25" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C19", + "chromosome": "chr10", + "position": 94852914, + "dbSnpId": "rs55640102", + "call": "A|A", + "alleles": [ + "*12" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "CYP2C9", + "chr": "chr10", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [ + "*72", + "*73", + "*74", + "*75" + ], + "messages": [], + "relatedDrugs": [], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "CYP2C9", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "CYP2C9", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "gene": "CYP2C9", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "2", + "label": "*1/*1" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "CYP2C9", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "CYP2C9", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "gene": "CYP2C9", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "2", + "label": "*1/*1" + } + ], + "variants": [ + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94938683, + "dbSnpId": "rs114071557", + "call": "A|A", + "alleles": [ + "*36" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94938737, + "dbSnpId": "rs67807361", + "call": "C|C", + "alleles": [ + "*7" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94938771, + "dbSnpId": "rs142240658", + "call": "C|C", + "alleles": [ + "*21" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94938803, + "dbSnpId": "rs2031308986", + "call": "A|A", + "alleles": [ + "*22" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94938828, + "dbSnpId": "rs564813580", + "call": "A|A", + "alleles": [ + "*37" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94941897, + "dbSnpId": "rs371055887", + "call": "G|G", + "alleles": [ + "*20" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94941915, + "dbSnpId": null, + "call": "G|G", + "alleles": [ + "*23" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94941958, + "dbSnpId": "rs72558187", + "call": "T|T", + "alleles": [ + "*13" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94941976, + "dbSnpId": null, + "call": "G|G", + "alleles": [ + "*38" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94941982, + "dbSnpId": "rs762239445", + "call": "G|G", + "alleles": [ + "*39" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942018, + "dbSnpId": null, + "call": "T|T", + "alleles": [ + "*40" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942205, + "dbSnpId": "rs1304490498", + "call": "CAATGGAAAGA|CAATGGAAAGA", + "alleles": [ + "*25" + ], + "phased": false, + "wildtypeAllele": "CAATGGAAAGA", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942216, + "dbSnpId": "rs774607211", + "call": "A|A", + "alleles": [ + "*41" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942230, + "dbSnpId": "rs767576260", + "call": "C|C", + "alleles": [ + "*43" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942231, + "dbSnpId": "rs12414460", + "call": "G|G", + "alleles": [ + "*42" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942233, + "dbSnpId": "rs375805362", + "call": "C|C", + "alleles": [ + "*62" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942234, + "dbSnpId": "rs72558189", + "call": "G|G", + "alleles": [ + "*14", + "*35" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942249, + "dbSnpId": "rs200965026", + "call": "C|C", + "alleles": [ + "*26", + "*44" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942254, + "dbSnpId": "rs199523631", + "call": "C|C", + "alleles": [ + "*45" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942255, + "dbSnpId": "rs200183364", + "call": "G|G", + "alleles": [ + "*33" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942290, + "dbSnpId": "rs1799853", + "call": "C|C", + "alleles": [ + "*2", + "*35", + "*61" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942291, + "dbSnpId": "rs141489852", + "call": "G|G", + "alleles": [ + "*63" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942305, + "dbSnpId": "rs754487195", + "call": "G|G", + "alleles": [ + "*46" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942309, + "dbSnpId": "rs7900194", + "call": "G|G", + "alleles": [ + "*8", + "*27" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94947782, + "dbSnpId": "rs72558190", + "call": "C|C", + "alleles": [ + "*15" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94947785, + "dbSnpId": "rs774550549", + "call": "C|C", + "alleles": [ + "*47" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94947869, + "dbSnpId": null, + "call": "A|A", + "alleles": [ + "*69" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94947907, + "dbSnpId": null, + "call": "A|A", + "alleles": [ + "*57" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94947917, + "dbSnpId": "rs1326630788", + "call": "T|T", + "alleles": [ + "*48" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94947938, + "dbSnpId": "rs2031531005", + "call": "A|A", + "alleles": [ + "*28" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94949129, + "dbSnpId": null, + "call": "A|A", + "alleles": [ + "*49" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94949144, + "dbSnpId": null, + "call": "C|C", + "alleles": [ + "*50" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94949217, + "dbSnpId": "rs2256871", + "call": "A|A", + "alleles": [ + "*9" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94949280, + "dbSnpId": "rs9332130", + "call": "A|A", + "alleles": [ + "*10", + "*71" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94949281, + "dbSnpId": "rs9332131", + "call": "GA|GA", + "alleles": [ + "*6" + ], + "phased": false, + "wildtypeAllele": "GA", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94972119, + "dbSnpId": "rs182132442", + "call": "C|C", + "alleles": [ + "*29" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94972123, + "dbSnpId": null, + "call": "C|C", + "alleles": [ + "*64" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94972134, + "dbSnpId": null, + "call": "A|A", + "alleles": [ + "*51" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94972179, + "dbSnpId": "rs72558192", + "call": "A|A", + "alleles": [ + "*16" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94972180, + "dbSnpId": "rs988617574", + "call": "C|C", + "alleles": [ + "*52" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94972233, + "dbSnpId": "rs1237225311", + "call": "C|C", + "alleles": [ + "*53" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981199, + "dbSnpId": null, + "call": "G|G", + "alleles": [ + "*65" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981201, + "dbSnpId": "rs57505750", + "call": "T|T", + "alleles": [ + "*31" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981224, + "dbSnpId": "rs28371685", + "call": "C|C", + "alleles": [ + "*11" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981225, + "dbSnpId": "rs367826293", + "call": "G|G", + "alleles": [ + "*34" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981230, + "dbSnpId": "rs1274535931", + "call": "C|C", + "alleles": [ + "*58" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981250, + "dbSnpId": "rs750820937", + "call": "C|C", + "alleles": [ + "*54" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981281, + "dbSnpId": "rs749060448", + "call": "G|G", + "alleles": [ + "*24" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981296, + "dbSnpId": "rs1057910", + "call": "A|A", + "alleles": [ + "*3", + "*18", + "*68" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981297, + "dbSnpId": "rs56165452", + "call": "T|T", + "alleles": [ + "*4" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981301, + "dbSnpId": "rs28371686", + "call": "C|C", + "alleles": [ + "*5" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981302, + "dbSnpId": "rs1250577724", + "call": "C|C", + "alleles": [ + "*55" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981305, + "dbSnpId": "rs578144976", + "call": "C|C", + "alleles": [ + "*66" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981365, + "dbSnpId": null, + "call": "C|C", + "alleles": [ + "*17" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94981371, + "dbSnpId": "rs542577750", + "call": "G|G", + "alleles": [ + "*68" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94986042, + "dbSnpId": "rs764211126", + "call": "A|A", + "alleles": [ + "*56" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94986073, + "dbSnpId": "rs72558193", + "call": "A|A", + "alleles": [ + "*18" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94988852, + "dbSnpId": "rs776908257", + "call": "C|C", + "alleles": [ + "*67" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94988855, + "dbSnpId": null, + "call": "A|A", + "alleles": [ + "*59" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94988880, + "dbSnpId": null, + "call": "G|G", + "alleles": [ + "*70" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94988917, + "dbSnpId": "rs769942899", + "call": "G|G", + "alleles": [ + "*19" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94988925, + "dbSnpId": "rs202201137", + "call": "A|A", + "alleles": [ + "*61" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94988955, + "dbSnpId": "rs767284820", + "call": "T|T", + "alleles": [ + "*60" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94988984, + "dbSnpId": "rs781583846", + "call": "G|G", + "alleles": [ + "*30" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94989020, + "dbSnpId": "rs9332239", + "call": "C|C", + "alleles": [ + "*12", + "*71" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94989023, + "dbSnpId": "rs868182778", + "call": "G|G", + "alleles": [ + "*32" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942306, + "dbSnpId": "rs1289704600", + "call": null, + "alleles": [ + "*72" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94942308, + "dbSnpId": "rs17847037", + "call": null, + "alleles": [ + "*73" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94947439, + "dbSnpId": null, + "call": null, + "alleles": [ + "*74" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94986136, + "dbSnpId": "rs1254213342", + "call": null, + "alleles": [ + "*75" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + } + ], + "variantsOfInterest": [ + { + "gene": "CYP2C9", + "chromosome": "chr10", + "position": 94645745, + "dbSnpId": "rs12777823", + "call": "G|G", + "alleles": [], + "phased": false, + "wildtypeAllele": null, + "mismatch": false + } + ], + "highlightedVariants": [] + }, + { + "geneSymbol": "CYP3A5", + "chr": "chr7", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [ + { + "rule_name": "CYP3A5 reverse complement footnote", + "version": "1", + "matches": { + "gene": "CYP3A5", + "hapsCalled": [], + "hapsMissing": [], + "variantsMissing": [], + "variant": "", + "dips": [], + "drugs": [] + }, + "exception_type": "footnote", + "message": "The CYP3A5 gene is on the negative chromosomal strand, all genotype calls for CYP3A5 in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases." + } + ], + "relatedDrugs": [], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "CYP3A5", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "CYP3A5", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "gene": "CYP3A5", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*1/*1" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "CYP3A5", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "CYP3A5", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "gene": "CYP3A5", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*1/*1" + } + ], + "variants": [ + { + "gene": "CYP3A5", + "chromosome": "chr7", + "position": 99652613, + "dbSnpId": "rs28365083", + "call": "G|G", + "alleles": [ + "*2", + "*3" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "CYP3A5", + "chromosome": "chr7", + "position": 99652770, + "dbSnpId": "rs41303343", + "call": "T|T", + "alleles": [ + "*7" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP3A5", + "chromosome": "chr7", + "position": 99660516, + "dbSnpId": "rs28383479", + "call": "C|C", + "alleles": [ + "*3", + "*9" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP3A5", + "chromosome": "chr7", + "position": 99665212, + "dbSnpId": "rs10264272", + "call": "C|C", + "alleles": [ + "*6" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP3A5", + "chromosome": "chr7", + "position": 99665237, + "dbSnpId": "rs56411402", + "call": "T|T", + "alleles": [ + "*3", + "*4" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP3A5", + "chromosome": "chr7", + "position": 99666950, + "dbSnpId": "rs55965422", + "call": "A|A", + "alleles": [ + "*3", + "*5" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "CYP3A5", + "chromosome": "chr7", + "position": 99672916, + "dbSnpId": "rs776746", + "call": "T|T", + "alleles": [ + "*3" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "CYP3A5", + "chromosome": "chr7", + "position": 99676198, + "dbSnpId": "rs55817950", + "call": "G|G", + "alleles": [ + "*8" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "CYP4F2", + "chr": "chr19", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [], + "relatedDrugs": [], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "CYP4F2", + "name": "*1", + "function": null, + "reference": true + }, + "allele2": { + "gene": "CYP4F2", + "name": "*1", + "function": null, + "reference": true + }, + "gene": "CYP4F2", + "phenotype": null, + "variant": null, + "lookupKey": null, + "label": "*1/*1" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "CYP4F2", + "name": "*1", + "function": null, + "reference": true + }, + "allele2": { + "gene": "CYP4F2", + "name": "*1", + "function": null, + "reference": true + }, + "gene": "CYP4F2", + "phenotype": null, + "variant": null, + "lookupKey": null, + "label": "*1/*1" + } + ], + "variants": [ + { + "gene": "CYP4F2", + "chromosome": "chr19", + "position": 15879621, + "dbSnpId": "rs2108622", + "call": "C|C", + "alleles": [ + "*3" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "CYP4F2", + "chromosome": "chr19", + "position": 15897578, + "dbSnpId": "rs3093105", + "call": "A|A", + "alleles": [ + "*2" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "DPYD", + "chr": "chr1", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [ + { + "rule_name": "DPYD reverse complement footnote", + "version": "1", + "matches": { + "gene": "DPYD", + "hapsCalled": [], + "hapsMissing": [], + "variantsMissing": [], + "variant": "", + "dips": [], + "drugs": [] + }, + "exception_type": "footnote", + "message": "The DPYD gene is on the negative chromosomal strand, all genotype calls for DPYD in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases." + } + ], + "relatedDrugs": [], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "DPYD", + "name": "Reference", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "DPYD", + "name": "Reference", + "function": "Normal function", + "reference": true + }, + "gene": "DPYD", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "2", + "label": "Reference/Reference" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "DPYD", + "name": "Reference", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "DPYD", + "name": "Reference", + "function": "Normal function", + "reference": true + }, + "gene": "DPYD", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "2", + "label": "Reference/Reference" + } + ], + "variants": [ + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97078987, + "dbSnpId": "rs114096998", + "call": "G|G", + "alleles": [ + "c.3067C\u003eA" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97078993, + "dbSnpId": "rs148799944", + "call": "C|C", + "alleles": [ + "c.3061G\u003eC" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97079005, + "dbSnpId": "rs140114515", + "call": "C|C", + "alleles": [ + "c.3049G\u003eA" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97079071, + "dbSnpId": "rs1801268", + "call": "C|C", + "alleles": [ + "c.2983G\u003eT (*10)" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97079076, + "dbSnpId": "rs139459586", + "call": "A|A", + "alleles": [ + "c.2978T\u003eG" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97079077, + "dbSnpId": "rs202144771", + "call": "G|G", + "alleles": [ + "c.2977C\u003eT" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97079121, + "dbSnpId": "rs72547601", + "call": "T|T", + "alleles": [ + "c.2933A\u003eG" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97079133, + "dbSnpId": "rs72547602", + "call": "T|T", + "alleles": [ + "c.2921A\u003eT" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97079139, + "dbSnpId": "rs145529148", + "call": "T|T", + "alleles": [ + "c.2915A\u003eG" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97082365, + "dbSnpId": "rs141044036", + "call": "T|T", + "alleles": [ + "c.2872A\u003eG" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97082391, + "dbSnpId": "rs67376798", + "call": "T|T", + "alleles": [ + "c.2846A\u003eT" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97098598, + "dbSnpId": "rs1801267", + "call": "C|C", + "alleles": [ + "c.2657G\u003eA (*9B)" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97098599, + "dbSnpId": "rs147545709", + "call": "G|G", + "alleles": [ + "c.2656C\u003eT" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97098616, + "dbSnpId": "rs55674432", + "call": "C|C", + "alleles": [ + "c.2639G\u003eT" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97098632, + "dbSnpId": "rs201035051", + "call": "T|T", + "alleles": [ + "c.2623A\u003eC" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97193109, + "dbSnpId": "rs60139309", + "call": "T|T", + "alleles": [ + "c.2582A\u003eG" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97193209, + "dbSnpId": "rs200687447", + "call": "C|C", + "alleles": [ + "c.2482G\u003eA" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97234958, + "dbSnpId": "rs199634007", + "call": "G|G", + "alleles": [ + "c.2336C\u003eA" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97234991, + "dbSnpId": "rs56005131", + "call": "G|G", + "alleles": [ + "c.2303C\u003eA" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97305279, + "dbSnpId": "rs112766203", + "call": "G|G", + "alleles": [ + "c.2279C\u003eT" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97305363, + "dbSnpId": "rs60511679", + "call": "A|A", + "alleles": [ + "c.2195T\u003eG" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97305364, + "dbSnpId": "rs1801160", + "call": "C|C", + "alleles": [ + "c.2194G\u003eA (*6)" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97305372, + "dbSnpId": "rs146529561", + "call": "G|G", + "alleles": [ + "c.2186C\u003eT" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97306195, + "dbSnpId": "rs145548112", + "call": "C|C", + "alleles": [ + "c.2161G\u003eA" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97373598, + "dbSnpId": "rs137999090", + "call": "C|C", + "alleles": [ + "c.2021G\u003eA" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97373629, + "dbSnpId": "rs138545885", + "call": "C|C", + "alleles": [ + "c.1990G\u003eT" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97382461, + "dbSnpId": "rs55971861", + "call": "T|T", + "alleles": [ + "c.1906A\u003eC" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97450058, + "dbSnpId": "rs3918290", + "call": "C|C", + "alleles": [ + "c.1905+1G\u003eA (*2A)" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97450059, + "dbSnpId": "rs3918289", + "call": "G|G", + "alleles": [ + "c.1905C\u003eG" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97450065, + "dbSnpId": "rs72549303", + "call": "TG|TG", + "alleles": [ + "c.1898delC (*3)" + ], + "phased": false, + "wildtypeAllele": "TG", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97450068, + "dbSnpId": "rs17376848", + "call": "A|A", + "alleles": [ + "c.1896T\u003eC" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97450168, + "dbSnpId": "rs147601618", + "call": "A|A", + "alleles": [ + "c.1796T\u003eC" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97450187, + "dbSnpId": "rs145773863", + "call": "C|C", + "alleles": [ + "c.1777G\u003eA" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97450189, + "dbSnpId": "rs138616379", + "call": "C|C", + "alleles": [ + "c.1775G\u003eA" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97450190, + "dbSnpId": "rs59086055", + "call": "G|G", + "alleles": [ + "c.1774C\u003eT" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97515784, + "dbSnpId": "rs201615754", + "call": "C|C", + "alleles": [ + "c.1682G\u003eT" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97515787, + "dbSnpId": "rs55886062", + "call": "A|A", + "alleles": [ + "c.1679T\u003eG (*13)" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97515839, + "dbSnpId": "rs1801159", + "call": "T|T", + "alleles": [ + "c.1627A\u003eG (*5)" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97515851, + "dbSnpId": "rs142619737", + "call": "C|C", + "alleles": [ + "c.1615G\u003eA" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97515865, + "dbSnpId": "rs1801158", + "call": "C|C", + "alleles": [ + "c.1601G\u003eA (*4)" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97515889, + "dbSnpId": "rs190951787", + "call": "G|G", + "alleles": [ + "c.1577C\u003eG" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97515923, + "dbSnpId": "rs148994843", + "call": "C|C", + "alleles": [ + "c.1543G\u003eA" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97549565, + "dbSnpId": "rs138391898", + "call": "C|C", + "alleles": [ + "c.1519G\u003eA" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97549600, + "dbSnpId": "rs111858276", + "call": "T|T", + "alleles": [ + "c.1484A\u003eG" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97549609, + "dbSnpId": "rs72549304", + "call": "G|G", + "alleles": [ + "c.1475C\u003eT" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97549681, + "dbSnpId": "rs199549923", + "call": "G|G", + "alleles": [ + "c.1403C\u003eA" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97549713, + "dbSnpId": "rs57918000", + "call": "G|G", + "alleles": [ + "c.1371C\u003eT" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97549726, + "dbSnpId": "rs144395748", + "call": "G|G", + "alleles": [ + "c.1358C\u003eG" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97549735, + "dbSnpId": "rs72975710", + "call": "G|G", + "alleles": [ + "c.1349C\u003eT" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97573785, + "dbSnpId": "rs186169810", + "call": "A|A", + "alleles": [ + "c.1314T\u003eG" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97573805, + "dbSnpId": "rs142512579", + "call": "C|C", + "alleles": [ + "c.1294G\u003eA" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97573821, + "dbSnpId": "rs764666241", + "call": "C|C", + "alleles": [ + "c.1278G\u003eT" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97573839, + "dbSnpId": "rs200064537", + "call": "A|A", + "alleles": [ + "c.1260T\u003eA" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97573863, + "dbSnpId": "rs56038477", + "call": "C|C", + "alleles": [ + "c.1129-5923C\u003eG, c.1236G\u003eA (HapB3)" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97573881, + "dbSnpId": "rs61622928", + "call": "C|C", + "alleles": [ + "c.1218G\u003eA" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97573918, + "dbSnpId": "rs143815742", + "call": "C|C", + "alleles": [ + "c.1181G\u003eT" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97573919, + "dbSnpId": "rs140602333", + "call": "G|G", + "alleles": [ + "c.1180C\u003eT" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97573943, + "dbSnpId": "rs78060119", + "call": "C|C", + "alleles": [ + "c.1156G\u003eT (*12)" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97579893, + "dbSnpId": "rs75017182", + "call": "G|G", + "alleles": [ + "c.1129-5923C\u003eG, c.1236G\u003eA (HapB3)" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97593238, + "dbSnpId": "rs72549305", + "call": "T|T", + "alleles": [ + "c.1108A\u003eG" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97593289, + "dbSnpId": "rs143154602", + "call": "G|G", + "alleles": [ + "c.1057C\u003eT" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97593322, + "dbSnpId": "rs183385770", + "call": "C|C", + "alleles": [ + "c.1024G\u003eA" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97593343, + "dbSnpId": "rs72549306", + "call": "C|C", + "alleles": [ + "c.1003G\u003eT (*11)" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97593379, + "dbSnpId": "rs201018345", + "call": "C|C", + "alleles": [ + "c.967G\u003eA" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97595083, + "dbSnpId": "rs145112791", + "call": "G|G", + "alleles": [ + "c.934C\u003eT" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97595088, + "dbSnpId": "rs150437414", + "call": "A|A", + "alleles": [ + "c.929T\u003eC" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97595149, + "dbSnpId": "rs146356975", + "call": "T|T", + "alleles": [ + "c.868A\u003eG" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97679170, + "dbSnpId": "rs45589337", + "call": "T|T", + "alleles": [ + "c.775A\u003eG" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97691776, + "dbSnpId": "rs1801266", + "call": "G|G", + "alleles": [ + "c.703C\u003eT (*8)" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97699399, + "dbSnpId": "rs72549307", + "call": "T|T", + "alleles": [ + "c.632A\u003eG" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97699430, + "dbSnpId": "rs72549308", + "call": "T|T", + "alleles": [ + "c.601A\u003eC" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97699474, + "dbSnpId": "rs115232898", + "call": "T|T", + "alleles": [ + "c.557A\u003eG" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97699506, + "dbSnpId": "rs6670886", + "call": "C|C", + "alleles": [ + "c.525G\u003eA" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97699533, + "dbSnpId": "rs139834141", + "call": "C|C", + "alleles": [ + "c.498G\u003eA" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97699535, + "dbSnpId": "rs2297595", + "call": "T|T", + "alleles": [ + "c.496A\u003eG" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97721542, + "dbSnpId": "rs200562975", + "call": "T|T", + "alleles": [ + "c.451A\u003eG" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97721650, + "dbSnpId": "rs141462178", + "call": "T|T", + "alleles": [ + "c.343A\u003eG" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97740400, + "dbSnpId": "rs150385342", + "call": "C|C", + "alleles": [ + "c.313G\u003eA" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97740410, + "dbSnpId": "rs72549309", + "call": "GATGA|GATGA", + "alleles": [ + "c.295_298delTCAT (*7)" + ], + "phased": false, + "wildtypeAllele": "GATGA", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97883329, + "dbSnpId": "rs1801265", + "call": "A|A", + "alleles": [ + "c.85T\u003eC (*9A)" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97883352, + "dbSnpId": "rs80081766", + "call": "C|C", + "alleles": [ + "c.62G\u003eA" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97883353, + "dbSnpId": "rs72549310", + "call": "G|G", + "alleles": [ + "c.61C\u003eT" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "DPYD", + "chromosome": "chr1", + "position": 97883368, + "dbSnpId": "rs150036960", + "call": "G|G", + "alleles": [ + "c.46C\u003eG" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "IFNL3", + "chr": "chr19", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [ + { + "rule_name": "IFNL3 reverse complement footnote", + "version": "1", + "matches": { + "gene": "IFNL3", + "hapsCalled": [], + "hapsMissing": [], + "variantsMissing": [], + "variant": "", + "dips": [], + "drugs": [] + }, + "exception_type": "footnote", + "message": "The IFNL3 gene is on the negative chromosomal strand, all genotype calls for IFNL3 in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases." + } + ], + "relatedDrugs": [], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "IFNL3", + "name": "rs12979860 reference (C)", + "function": null, + "reference": true + }, + "allele2": { + "gene": "IFNL3", + "name": "rs12979860 reference (C)", + "function": null, + "reference": true + }, + "gene": "IFNL3", + "phenotype": null, + "variant": null, + "lookupKey": null, + "label": "rs12979860 reference (C)/rs12979860 reference (C)" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "IFNL3", + "name": "rs12979860 reference (C)", + "function": null, + "reference": true + }, + "allele2": { + "gene": "IFNL3", + "name": "rs12979860 reference (C)", + "function": null, + "reference": true + }, + "gene": "IFNL3", + "phenotype": null, + "variant": null, + "lookupKey": null, + "label": "rs12979860 reference (C)/rs12979860 reference (C)" + } + ], + "variants": [ + { + "gene": "IFNL3", + "chromosome": "chr19", + "position": 39248147, + "dbSnpId": "rs12979860", + "call": "C|C", + "alleles": [ + "rs12979860 variant (T)" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "NUDT15", + "chr": "chr13", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [], + "relatedDrugs": [], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "NUDT15", + "name": "*1", + "function": "Normal Function", + "reference": true + }, + "allele2": { + "gene": "NUDT15", + "name": "*1", + "function": "Normal Function", + "reference": true + }, + "gene": "NUDT15", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*1/*1" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "NUDT15", + "name": "*1", + "function": "Normal Function", + "reference": true + }, + "allele2": { + "gene": "NUDT15", + "name": "*1", + "function": "Normal Function", + "reference": true + }, + "gene": "NUDT15", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*1/*1" + } + ], + "variants": [ + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48037748, + "dbSnpId": "rs769369441", + "call": "T|T", + "alleles": [ + "*10" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48037749, + "dbSnpId": null, + "call": "G|G", + "alleles": [ + "*19" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48037782, + "dbSnpId": "rs746071566", + "call": "AGGAGTC|AGGAGTC", + "alleles": [ + "*2", + "*6", + "*9" + ], + "phased": false, + "wildtypeAllele": "AGGAGTC", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48037798, + "dbSnpId": "rs186364861", + "call": "G|G", + "alleles": [ + "*5" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48037825, + "dbSnpId": "rs777311140", + "call": "C|C", + "alleles": [ + "*14" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48037834, + "dbSnpId": "rs1202487323", + "call": "C|C", + "alleles": [ + "*16" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48037847, + "dbSnpId": "rs766023281", + "call": "G|G", + "alleles": [ + "*7" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48037849, + "dbSnpId": null, + "call": "A|A", + "alleles": [ + "*8" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48037885, + "dbSnpId": "rs1950545307", + "call": "G|G", + "alleles": [ + "*11" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48037902, + "dbSnpId": "rs149436418", + "call": "C|C", + "alleles": [ + "*12" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48040977, + "dbSnpId": "rs1457579126", + "call": "GA|GA", + "alleles": [ + "*18" + ], + "phased": false, + "wildtypeAllele": "GA", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48041103, + "dbSnpId": "rs761191455", + "call": "T|T", + "alleles": [ + "*13" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48041113, + "dbSnpId": "rs1368252918", + "call": "G|G", + "alleles": [ + "*17" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48045690, + "dbSnpId": "rs768324690", + "call": "C|C", + "alleles": [ + "*20" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48045719, + "dbSnpId": "rs116855232", + "call": "C|C", + "alleles": [ + "*2", + "*3" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48045720, + "dbSnpId": "rs147390019", + "call": "G|G", + "alleles": [ + "*4" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "NUDT15", + "chromosome": "chr13", + "position": 48045771, + "dbSnpId": "rs139551410", + "call": "T|T", + "alleles": [ + "*15" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "RYR1", + "chr": "chr19", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [], + "relatedDrugs": [], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "RYR1", + "name": "Reference", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "RYR1", + "name": "Reference", + "function": "Normal function", + "reference": true + }, + "gene": "RYR1", + "phenotype": "Uncertain Susceptibility", + "variant": null, + "lookupKey": "Uncertain Susceptibility", + "label": "Reference/Reference" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "RYR1", + "name": "Reference", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "RYR1", + "name": "Reference", + "function": "Normal function", + "reference": true + }, + "gene": "RYR1", + "phenotype": "Uncertain Susceptibility", + "variant": null, + "lookupKey": "Uncertain Susceptibility", + "label": "Reference/Reference" + } + ], + "variants": [ + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38440802, + "dbSnpId": "rs193922747", + "call": "T|T", + "alleles": [ + "c.103T\u003eC" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38440829, + "dbSnpId": "rs193922748", + "call": "C|C", + "alleles": [ + "c.130C\u003eT" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38444211, + "dbSnpId": "rs118192161", + "call": "C|C", + "alleles": [ + "c.487C\u003eT" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38444212, + "dbSnpId": "rs193922753", + "call": "G|G", + "alleles": [ + "c.488G\u003eT" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38446710, + "dbSnpId": "rs1801086", + "call": "G|G", + "alleles": [ + "c.742G\u003eA", + "c.742G\u003eC" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38448673, + "dbSnpId": "rs193922762", + "call": "C|C", + "alleles": [ + "c.982C\u003eT" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38448712, + "dbSnpId": "rs121918592", + "call": "G|G", + "alleles": [ + "c.1021G\u003eA", + "c.1021G\u003eC" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38451842, + "dbSnpId": "rs193922764", + "call": "C|C", + "alleles": [ + "c.1201C\u003eT" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38451850, + "dbSnpId": "rs118192116", + "call": "C|C", + "alleles": [ + "c.1209C\u003eG" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38455359, + "dbSnpId": "rs118192162", + "call": "A|A", + "alleles": [ + "c.1565A\u003eC" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38455463, + "dbSnpId": "rs111888148", + "call": "G|G", + "alleles": [ + "c.1589G\u003eA" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38455471, + "dbSnpId": "rs193922768", + "call": "C|C", + "alleles": [ + "c.1597C\u003eT" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38455472, + "dbSnpId": "rs144336148", + "call": "G|G", + "alleles": [ + "c.1598G\u003eA" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38455528, + "dbSnpId": "rs193922770", + "call": "C|C", + "alleles": [ + "c.1654C\u003eT" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38457545, + "dbSnpId": "rs118192172", + "call": "C|C", + "alleles": [ + "c.1840C\u003eT" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38457546, + "dbSnpId": "rs193922772", + "call": "G|G", + "alleles": [ + "c.1841G\u003eT" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38494564, + "dbSnpId": "rs118192175", + "call": "C|C", + "alleles": [ + "c.6487C\u003eT" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38494565, + "dbSnpId": "rs118192163", + "call": "G|G", + "alleles": [ + "c.6488G\u003eA" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38494579, + "dbSnpId": "rs118192176", + "call": "G|G", + "alleles": [ + "c.6502G\u003eA" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38496283, + "dbSnpId": "rs118192177", + "call": "C|C", + "alleles": [ + "c.6617C\u003eG", + "c.6617C\u003eT" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38499223, + "dbSnpId": "rs112563513", + "call": "G|G", + "alleles": [ + "c.7007G\u003eA" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38499644, + "dbSnpId": "rs121918596", + "call": "TGGA|TGGA", + "alleles": [ + "c.7042_7044delGAG" + ], + "phased": false, + "wildtypeAllele": "TGGA", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38499655, + "dbSnpId": "rs193922802", + "call": "G|G", + "alleles": [ + "c.7048G\u003eA" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38499670, + "dbSnpId": "rs193922803", + "call": "C|C", + "alleles": [ + "c.7063C\u003eT" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38499731, + "dbSnpId": "rs193922807", + "call": "G|G", + "alleles": [ + "c.7124G\u003eC" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38499975, + "dbSnpId": "rs193922809", + "call": "G|G", + "alleles": [ + "c.7282G\u003eA" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38499993, + "dbSnpId": "rs121918593", + "call": "G|G", + "alleles": [ + "c.7300G\u003eA" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38499997, + "dbSnpId": "rs28933396", + "call": "G|G", + "alleles": [ + "c.7304G\u003eA" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38500636, + "dbSnpId": "rs118192124", + "call": "C|C", + "alleles": [ + "c.7354C\u003eT" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38500642, + "dbSnpId": "rs193922816", + "call": "C|C", + "alleles": [ + "c.7360C\u003eT" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38500643, + "dbSnpId": "rs118192122", + "call": "G|G", + "alleles": [ + "c.7361G\u003eA" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38500654, + "dbSnpId": "rs28933397", + "call": "C|C", + "alleles": [ + "c.7372C\u003eT" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38500655, + "dbSnpId": "rs121918594", + "call": "G|G", + "alleles": [ + "c.7373G\u003eA" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38500898, + "dbSnpId": "rs118192178", + "call": "C|C", + "alleles": [ + "c.7522C\u003eG", + "c.7522C\u003eT" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38500899, + "dbSnpId": "rs193922818", + "call": "G|G", + "alleles": [ + "c.7523G\u003eA" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38512321, + "dbSnpId": "rs193922832", + "call": "G|G", + "alleles": [ + "c.9310G\u003eA" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38543832, + "dbSnpId": "rs193922843", + "call": "G|G", + "alleles": [ + "c.11969G\u003eT" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38580004, + "dbSnpId": "rs118192167", + "call": "A|A", + "alleles": [ + "c.14387A\u003eG" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38580094, + "dbSnpId": "rs121918595", + "call": "C|C", + "alleles": [ + "c.14477C\u003eT" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38580114, + "dbSnpId": "rs193922876", + "call": "C|C", + "alleles": [ + "c.14497C\u003eT" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38580370, + "dbSnpId": "rs193922878", + "call": "C|C", + "alleles": [ + "c.14512C\u003eG" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38580403, + "dbSnpId": "rs118192168", + "call": "G|G", + "alleles": [ + "c.14545G\u003eA" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38580440, + "dbSnpId": "rs63749869", + "call": "G|G", + "alleles": [ + "c.14582G\u003eA" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "RYR1", + "chromosome": "chr19", + "position": 38584989, + "dbSnpId": "rs118192170", + "call": "T|T", + "alleles": [ + "c.14693T\u003eC" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "SLCO1B1", + "chr": "chr12", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [ + "*38", + "*41", + "*45" + ], + "messages": [], + "relatedDrugs": [], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "SLCO1B1", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "SLCO1B1", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "gene": "SLCO1B1", + "phenotype": "Normal function", + "variant": null, + "lookupKey": "Normal function", + "label": "*1/*1" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "SLCO1B1", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "SLCO1B1", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "gene": "SLCO1B1", + "phenotype": "Normal function", + "variant": null, + "lookupKey": "Normal function", + "label": "*1/*1" + } + ], + "variants": [ + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21172734, + "dbSnpId": "rs139257324", + "call": "C|C", + "alleles": [ + "*33" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21172776, + "dbSnpId": "rs373327528", + "call": "G|G", + "alleles": [ + "*23" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21172782, + "dbSnpId": "rs56101265", + "call": "T|T", + "alleles": [ + "*2", + "*12" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21174595, + "dbSnpId": "rs56061388", + "call": "T|T", + "alleles": [ + "*3", + "*13" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21176804, + "dbSnpId": "rs2306283", + "call": "A|A", + "alleles": [ + "*14", + "*15", + "*20", + "*24", + "*25", + "*27", + "*28", + "*29", + "*30", + "*31", + "*32", + "*33", + "*37", + "*39", + "*42", + "*43", + "*44", + "*46", + "*47" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21176868, + "dbSnpId": "rs2306282", + "call": "A|A", + "alleles": [ + "*16" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21176879, + "dbSnpId": "rs11045819", + "call": "C|C", + "alleles": [ + "*4", + "*14", + "*25", + "*32", + "*43" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21176883, + "dbSnpId": "rs72559745", + "call": "A|A", + "alleles": [ + "*3", + "*13" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21178615, + "dbSnpId": "rs4149056", + "call": "T|T", + "alleles": [ + "*5", + "*15", + "*40", + "*46", + "*47" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21178957, + "dbSnpId": "rs79135870", + "call": "A|A", + "alleles": [ + "*30" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21196951, + "dbSnpId": "rs11045852", + "call": "A|A", + "alleles": [ + "*24", + "*25", + "*28", + "*32", + "*33", + "*43", + "*44" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21196976, + "dbSnpId": "rs11045853", + "call": "G|G", + "alleles": [ + "*25", + "*28", + "*33" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21200595, + "dbSnpId": "rs55901008", + "call": "T|T", + "alleles": [ + "*6" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21202553, + "dbSnpId": "rs1228465562", + "call": "T|T", + "alleles": [ + "*36" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21202555, + "dbSnpId": "rs59113707", + "call": "C|C", + "alleles": [ + "*27" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21202649, + "dbSnpId": "rs56387224", + "call": "A|A", + "alleles": [ + "*7" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21202664, + "dbSnpId": "rs142965323", + "call": "G|G", + "alleles": [ + "*26" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21205921, + "dbSnpId": "rs72559748", + "call": "A|A", + "alleles": [ + "*8" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21205999, + "dbSnpId": "rs59502379", + "call": "G|G", + "alleles": [ + "*9", + "*31" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21239042, + "dbSnpId": "rs34671512", + "call": "A|A", + "alleles": [ + "*19", + "*20", + "*40" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21239077, + "dbSnpId": "rs56199088", + "call": "A|A", + "alleles": [ + "*10", + "*12" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21239113, + "dbSnpId": "rs55737008", + "call": "A|A", + "alleles": [ + "*11", + "*13" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21239145, + "dbSnpId": "rs200995543", + "call": "C|C", + "alleles": [ + "*34" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21239158, + "dbSnpId": "rs140790673", + "call": "C|C", + "alleles": [ + "*29" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21176871, + "dbSnpId": null, + "call": null, + "alleles": [ + "*38" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21176898, + "dbSnpId": "rs77271279", + "call": null, + "alleles": [ + "*41" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21178612, + "dbSnpId": "rs141467543", + "call": null, + "alleles": [ + "*42" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21196975, + "dbSnpId": "rs183501729", + "call": null, + "alleles": [ + "*39" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21200544, + "dbSnpId": "rs72559747", + "call": null, + "alleles": [ + "*47" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21206031, + "dbSnpId": "rs74064213", + "call": null, + "alleles": [ + "*43", + "*44" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "SLCO1B1", + "chromosome": "chr12", + "position": 21222355, + "dbSnpId": "rs71581941", + "call": null, + "alleles": [ + "*45", + "*46" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [ + "rs4149056T/rs4149056T" + ] + }, + { + "geneSymbol": "TPMT", + "chr": "chr6", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [ + { + "rule_name": "TPMT reverse complement footnote", + "version": "1", + "matches": { + "gene": "TPMT", + "hapsCalled": [], + "hapsMissing": [], + "variantsMissing": [], + "variant": "", + "dips": [], + "drugs": [] + }, + "exception_type": "footnote", + "message": "The TPMT gene is on the negative chromosomal strand, all genotype calls for TPMT in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases." + } + ], + "relatedDrugs": [], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "TPMT", + "name": "*1", + "function": "Normal Function", + "reference": true + }, + "allele2": { + "gene": "TPMT", + "name": "*1", + "function": "Normal Function", + "reference": true + }, + "gene": "TPMT", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*1/*1" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "TPMT", + "name": "*1", + "function": "Normal Function", + "reference": true + }, + "allele2": { + "gene": "TPMT", + "name": "*1", + "function": "Normal Function", + "reference": true + }, + "gene": "TPMT", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*1/*1" + } + ], + "variants": [ + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18130687, + "dbSnpId": "rs1142345", + "call": "T|T", + "alleles": [ + "*3A", + "*3C", + "*41" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18130694, + "dbSnpId": "rs150900439", + "call": "T|T", + "alleles": [ + "*20" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18130725, + "dbSnpId": "rs72552736", + "call": "A|A", + "alleles": [ + "*7" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18130729, + "dbSnpId": "rs139392616", + "call": "C|C", + "alleles": [ + "*40" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18130758, + "dbSnpId": "rs398122996", + "call": "A|A", + "alleles": [ + "*37" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18130762, + "dbSnpId": "rs56161402", + "call": "C|C", + "alleles": [ + "*8" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18130772, + "dbSnpId": "rs377085266", + "call": "A|A", + "alleles": [ + "*25" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18130781, + "dbSnpId": "rs1800584", + "call": "C|C", + "alleles": [ + "*4" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18132136, + "dbSnpId": "rs72556347", + "call": "A|A", + "alleles": [ + "*26" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18132147, + "dbSnpId": "rs79901429", + "call": "A|A", + "alleles": [ + "*31" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18132163, + "dbSnpId": null, + "call": "C|C", + "alleles": [ + "*36" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18133845, + "dbSnpId": "rs75543815", + "call": "T|T", + "alleles": [ + "*6" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18133847, + "dbSnpId": "rs6921269", + "call": "C|C", + "alleles": [ + "*24" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18133870, + "dbSnpId": "rs772832951", + "call": "A|A", + "alleles": [ + "*38" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18133884, + "dbSnpId": "rs74423290", + "call": "G|G", + "alleles": [ + "*23" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18133887, + "dbSnpId": "rs201695576", + "call": "T|T", + "alleles": [ + "*44" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18133890, + "dbSnpId": "rs9333570", + "call": "C|C", + "alleles": [ + "*15" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18138969, + "dbSnpId": "rs144041067", + "call": "C|C", + "alleles": [ + "*16", + "*22" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18138970, + "dbSnpId": "rs112339338", + "call": "G|G", + "alleles": [ + "*33" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18138997, + "dbSnpId": "rs1800460", + "call": "C|C", + "alleles": [ + "*3A", + "*3B" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18139027, + "dbSnpId": "rs72552737", + "call": "C|C", + "alleles": [ + "*10" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18139689, + "dbSnpId": "rs72552738", + "call": "C|C", + "alleles": [ + "*11" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18139710, + "dbSnpId": "rs200220210", + "call": "G|G", + "alleles": [ + "*12" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18143597, + "dbSnpId": null, + "call": "T|T", + "alleles": [ + "*19" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18143606, + "dbSnpId": "rs151149760", + "call": "T|T", + "alleles": [ + "*9" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18143613, + "dbSnpId": null, + "call": "C|C", + "alleles": [ + "*28" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18143622, + "dbSnpId": "rs115106679", + "call": "C|C", + "alleles": [ + "*32" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18143643, + "dbSnpId": null, + "call": "A|A", + "alleles": [ + "*27" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18143700, + "dbSnpId": "rs753545734", + "call": "C|C", + "alleles": [ + "*43" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18143718, + "dbSnpId": "rs111901354", + "call": "G|G", + "alleles": [ + "*34" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18143724, + "dbSnpId": "rs1800462", + "call": "C|C", + "alleles": [ + "*2" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18143728, + "dbSnpId": "rs1256618794", + "call": "C|C", + "alleles": [ + "*43" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18147838, + "dbSnpId": "rs281874771", + "call": "G|G", + "alleles": [ + "*39" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18147845, + "dbSnpId": "rs777686348", + "call": "C|C", + "alleles": [ + "*18" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18147851, + "dbSnpId": "rs200591577", + "call": "G|G", + "alleles": [ + "*21" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18147856, + "dbSnpId": null, + "call": "A|A", + "alleles": [ + "*35" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18147910, + "dbSnpId": "rs72552740", + "call": "A|A", + "alleles": [ + "*5" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18149004, + "dbSnpId": null, + "call": "G|G", + "alleles": [ + "*17" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18149022, + "dbSnpId": "rs750424422", + "call": "C|C", + "alleles": [ + "*30" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18149032, + "dbSnpId": "rs759836180", + "call": "C|C", + "alleles": [ + "*42" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18149045, + "dbSnpId": "rs72552742", + "call": "T|T", + "alleles": [ + "*13" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18149126, + "dbSnpId": "rs267607275", + "call": "A|A", + "alleles": [ + "*29" + ], + "phased": false, + "wildtypeAllele": "A", + "mismatch": false + }, + { + "gene": "TPMT", + "chromosome": "chr6", + "position": 18149127, + "dbSnpId": "rs9333569", + "call": "T|T", + "alleles": [ + "*14" + ], + "phased": false, + "wildtypeAllele": "T", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "UGT1A1", + "chr": "chr2", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [ + { + "rule_name": "UGT1A1 repeat warning", + "version": "1", + "matches": { + "gene": "UGT1A1", + "hapsCalled": [], + "hapsMissing": [], + "variantsMissing": [], + "variant": "", + "dips": [], + "drugs": [] + }, + "exception_type": "footnote", + "message": "Some alleles in UGT1A1 are distinguished by a repeat sequence; some genotyping technologies may not accurately call the repeat." + } + ], + "relatedDrugs": [], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "UGT1A1", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "UGT1A1", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "gene": "UGT1A1", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*1/*1" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "UGT1A1", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "allele2": { + "gene": "UGT1A1", + "name": "*1", + "function": "Normal function", + "reference": true + }, + "gene": "UGT1A1", + "phenotype": "Normal Metabolizer", + "variant": null, + "lookupKey": "Normal Metabolizer", + "label": "*1/*1" + } + ], + "variants": [ + { + "gene": "UGT1A1", + "chromosome": "chr2", + "position": 233759924, + "dbSnpId": "rs887829", + "call": "C|C", + "alleles": [ + "*80", + "*80+*28", + "*80+*37" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + }, + { + "gene": "UGT1A1", + "chromosome": "chr2", + "position": 233760233, + "dbSnpId": "rs3064744", + "call": "CAT|CAT", + "alleles": [ + "*28", + "*36", + "*37", + "*80+*28", + "*80+*37" + ], + "phased": false, + "wildtypeAllele": "CAT", + "mismatch": false + }, + { + "gene": "UGT1A1", + "chromosome": "chr2", + "position": 233760498, + "dbSnpId": "rs4148323", + "call": "G|G", + "alleles": [ + "*6" + ], + "phased": false, + "wildtypeAllele": "G", + "mismatch": false + }, + { + "gene": "UGT1A1", + "chromosome": "chr2", + "position": 233760973, + "dbSnpId": "rs35350960", + "call": "C|C", + "alleles": [ + "*27" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + }, + { + "geneSymbol": "VKORC1", + "chr": "chr16", + "phased": true, + "callSource": "MATCHER", + "uncalledHaplotypes": [], + "messages": [ + { + "rule_name": "VKORC1", + "version": "1", + "matches": { + "gene": "VKORC1", + "hapsCalled": [], + "hapsMissing": [], + "variantsMissing": [], + "variant": "", + "dips": [], + "drugs": [] + }, + "exception_type": "footnote", + "message": "CPIC recommendations for warfarin use only rs9923231; however, other variants in VKORC1 may have functional consequences and may be more common in some populations." + }, + { + "rule_name": "VKORC1 reverse complement footnote", + "version": "1", + "matches": { + "gene": "VKORC1", + "hapsCalled": [], + "hapsMissing": [], + "variantsMissing": [], + "variant": "", + "dips": [], + "drugs": [] + }, + "exception_type": "footnote", + "message": "The VKORC1 gene is on the negative chromosomal strand, all genotype calls for VKORC1 in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases." + } + ], + "relatedDrugs": [], + "matcherDiplotypes": [ + { + "allele1": { + "gene": "VKORC1", + "name": "rs9923231 reference (C)", + "function": null, + "reference": true + }, + "allele2": { + "gene": "VKORC1", + "name": "rs9923231 reference (C)", + "function": null, + "reference": true + }, + "gene": "VKORC1", + "phenotype": null, + "variant": null, + "lookupKey": null, + "label": "rs9923231 reference (C)/rs9923231 reference (C)" + } + ], + "diplotypes": [ + { + "allele1": { + "gene": "VKORC1", + "name": "rs9923231 reference (C)", + "function": null, + "reference": true + }, + "allele2": { + "gene": "VKORC1", + "name": "rs9923231 reference (C)", + "function": null, + "reference": true + }, + "gene": "VKORC1", + "phenotype": null, + "variant": null, + "lookupKey": null, + "label": "rs9923231 reference (C)/rs9923231 reference (C)" + } + ], + "variants": [ + { + "gene": "VKORC1", + "chromosome": "chr16", + "position": 31096368, + "dbSnpId": "rs9923231", + "call": "C|C", + "alleles": [ + "rs9923231 variant (T)" + ], + "phased": false, + "wildtypeAllele": "C", + "mismatch": false + } + ], + "variantsOfInterest": [], + "highlightedVariants": [] + } +] \ No newline at end of file