Mercurial > repos > bgruening > glimmer_hmm
diff glimmerHMM/glimmerhmm_predict.xml @ 0:e9ed61e74837 draft default tip
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/glimmer_hmm commit 0dc67759bcbdf5a8a285ded9ba751340d741fe63
author | bgruening |
---|---|
date | Wed, 13 Jul 2016 10:56:32 -0400 |
parents | |
children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/glimmerHMM/glimmerhmm_predict.xml Wed Jul 13 10:56:32 2016 -0400 @@ -0,0 +1,66 @@ +<tool id="glimmerhmm_predict" name="GlimmerHMM" version="2.0"> + <description>Predict ORFs in eukaryotic genomes</description> + <command detect_errors="exit_code"><![CDATA[ + glimmerhmm + $input $trained_specie.fields.path + -o $output + -g + $svm_splice_prediction + $partial_gene + #if str($top_n_predictions) != "-1": + -n $top_n_predictions + #end if + ]]></command> + <inputs> + <param name="input" type="data" format="fasta" label="Genome Sequence"/> + <param name="trained_specie" type="select" label="Select a specie"> + <options from_data_table="glimmer_hmm_trained_dir"> + <filter type="sort_by" column="2"/> + <validator type="no_options" message="No indexes are available"/> + </options> + </param> + <param name="partial_gene" type="boolean" label="Don't make partial gene predictions" truevalue="-f" falsevalue="" checked="false" /> + <param name="svm_splice_prediction" type="boolean" label="Don't use svm splice site predictions" truevalue="-v" falsevalue="" checked="false" /> + <param name="top_n_predictions" type="integer" label="top n best predictions, -1 means infinite" value="-1"/> + </inputs> + <outputs> + <data format="gff3" name="output" /> + </outputs> + <help> + + **What it does** + + GlimmerHMM is a new gene finder based on a Generalized Hidden Markov Model (GHMM). + Although the gene finder conforms to the overall mathematical framework of a GHMM, + additionally it incorporates splice site models adapted from the GeneSplicer program and a + decision tree adapted from GlimmerM. It also utilizes Interpolated Markov Models for the + coding and noncoding models . Currently, GlimmerHMM's GHMM structure includes introns of each phase, + intergenic regions, and four types of exons (initial, internal, final, and single). + A basic user manual can be consulted here. + + ----- + + **Example** + + Suppose you have the following DNA formatted sequences:: + + >SQ Sequence 8667507 BP; 1203558 A; 3121252 C; 3129638 G; 1213059 T; 0 other; + cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg + ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag + cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc + cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc + ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg + + Running this tool will produce this:: + + ##gff-version 3 + ##sequence-region ConsensusfromCH236920mapping 1 4148552 + ConsensusfromCH236920mapping GlimmerHMM mRNA 1 122 . + . ID=ConsensusfromCH236920mapping.path1.gene1;Name=ConsensusfromCH236920mapping.path1.gene1 + ConsensusfromCH236920mapping GlimmerHMM CDS 1 122 . + 0 ID=ConsensusfromCH236920mapping.cds1.1; + ConsensusfromCH236920mapping GlimmerHMM mRNA 14066 15205 . - . ID=ConsensusfromCH236920mapping.path1.gene2;Name=ConsensusfromCH236920mapping.path1.gene2 + ConsensusfromCH236920mapping GlimmerHMM CDS 14066 15034 . - 0 ID=ConsensusfromCH236920mapping.cds2.1; + ConsensusfromCH236920mapping GlimmerHMM CDS 15137 15205 . - 0 ID=ConsensusfromCH236920mapping.cds2.2; + ConsensusfromCH236920mapping GlimmerHMM mRNA 19910 24210 . - . ID=ConsensusfromCH236920mapping.path1.gene3;Name=ConsensusfromCH236920mapping.path1.gene3 + + </help> +</tool>