diff glimmer_build_icm.xml @ 0:0a40ed165499 draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
author bgruening
date Tue, 28 Nov 2017 10:14:11 -0500
parents
children 3c1a601f11fa
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/glimmer_build_icm.xml	Tue Nov 28 10:14:11 2017 -0500
@@ -0,0 +1,122 @@
+<tool id="glimmer_build_icm" name="Glimmer ICM builder" version="@WRAPPER_VERSION@">
+    <description></description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements"/>
+    <command><![CDATA[
+        build-icm
+            --depth $depth
+            $no_stops
+            --period $period
+            --width $width
+
+            #if $stop_codon_opts.stop_codon_opts_selector == "gb":
+                --trans_table '${stop_codon_opts.genbank_gencode}'
+            #else:
+                --stop_codons '${stop_codon_opts.stop_codons}'
+            #end if
+
+            '$outfile' < '$infile' 2>&1;
+]]></command>
+    <inputs>
+        <param name="infile" type="data" format="fasta" label="Trainings Dataset" help="A set of known genes in FASTA format." />
+        <param name="depth" type="integer" value="7" label="Set the depth of the ICM" help="The depth is the maximum number of positions in the context window that will be used to determine the probability of the predicted position." />
+        <param name="period" type="integer" value="3" label="Set the period of the ICM" help="The period is the number of different submodels for different positions in the text in a cyclic pattern. E.g., if the period is 3, the first submodel will determine positions 1, 4, 7, ..." />
+        <param name="width" type="integer" value="12" label="Set the width of the ICM" help="The width includes the predicted position." />
+        <param name="no_stops" type="boolean" truevalue="--no_stops" falsevalue="" checked="false" label="Do not use any input strings with in-frame stop codons" />
+
+        <conditional name="stop_codon_opts">
+            <param name="stop_codon_opts_selector" type="select" label="Specify start codons as">
+              <option value="gb" selected="True">Genbank translation table entry</option>
+              <option value="free_form">Comma-separated list</option>
+            </param>
+            <when value="gb">
+                <param name="genbank_gencode" type="select" label="Use Genbank translation table to specify stop codons">
+                    <option value="1" selected="True">1. Standard</option>
+                    <option value="2">2. Vertebrate Mitochondrial</option>
+                    <option value="3">3. Yeast Mitochondrial</option>
+                    <option value="4">4. Mold, Protozoan, and Coelenterate Mitochondrial Code and the Mycoplasma/Spiroplasma Code</option>
+                    <option value="5">5. Invertebrate Mitochondrial</option>
+                    <option value="6">6. Ciliate, Dasycladacean and Hexamita Nuclear Code</option>
+                    <option value="9">9. Echinoderm Mitochondrial</option>
+                    <option value="10">10. Euplotid Nuclear</option>
+                    <option value="11">11. Bacteria and Archaea</option>
+                    <option value="12">12. Alternative Yeast Nuclear</option>
+                    <option value="13">13. Ascidian Mitochondrial</option>
+                    <option value="14">14. Flatworm Mitochondrial</option>
+                    <option value="15">15. Blepharisma Macronuclear</option>
+                    <option value="16">16. Chlorophycean Mitochondrial</option>
+                    <option value="21">21. Trematode Mitochondrial</option>
+                    <option value="22">22. Scenedesmus obliquus mitochondrial</option>
+                    <option value="23">23. Thraustochytrium Mitochondrial</option>
+                    <option value="24">24. Pterobranchia mitochondrial</option>
+                </param>
+            </when>
+            <when value="free_form">
+                <param name="stop_codons" type="text" value="tag,tga,taa" label="Specify stop codons as a comma-separated list" />
+            </when>
+        </conditional>
+    </inputs>
+    <outputs>
+        <data format="data" name="outfile" />
+    </outputs>
+    <tests>
+        <test>
+            <param name="infile" value='streptomyces_Tu6071_plasmid_genes.fasta' />
+            <param name="depth" value="7" />
+            <param name="period" value="3" />
+            <param name="width" value="12" />
+            <param name="no_stops" value="" />
+            <param name="genbank_gencode" value="11" />
+            <!-- compare files sizes, because the output is a binary -->
+            <output name="outfile" file='streptomyces_Tu6071_plasmid_genes.icm' compare="sim_size" delta="1000" ftype="data" />
+        </test>
+    </tests>
+
+    <help>
+<![CDATA[
+
+**What it does**
+
+This program constructs an interpolated context model (ICM) from an input set of sequences.
+
+This model can be used by Glimmer3 to predict genes.
+
+**TIP** To extract CDS from a GenBank file use the tool *Extract ORF from a GenBank file*.
+
+-----
+
+**Example**
+
+*Input*::
+
+	- Genome Sequence
+
+		>CELF22B7  C.aenorhabditis elegans (Bristol N2) cosmid F22B7
+		GATCCTTGTAGATTTTGAATTTGAAGTTTTTTCTCATTCCAAAACTCTGT
+		GATCTGAAATAAAATGTCTCAAAAAAATAGAAGAAAACATTGCTTTATAT
+		TTATCAGTTATGGTTTTCAAAATTTTCTGACATACCGTTTTGCTTCTTTT
+		TTTCTCATCTTCTTCAAATATCAATTGTGATAATCTGACTCCTAACAATC
+		GAATTTCTTTTCCTTTTTCTTTTTCCAACAACTCCAGTGAGAACTTTTGA
+		ATATCTTCAAGTGACTTCACCACATCAGAAGGTGTCAACGATCTTGTGAG
+		AACATCGAATGAAGATAATTTTAATTTTAGAGTTACAGTTTTTCCTCCGA
+		CAATTCCTGATTTACGAACATCTTCTTCAAGCATTCTACAGATTTCTTGA
+		TGCTCTTCTAGGAGGATGTTGAAATCCGAAGTTGGAGAAAAAGTTCTCTC
+		AACTGAAATGCTTTTTCTTCGTGGATCCGATTCAGATGGACGACCTGGCA
+		GTCCGAGAGCCGTTCGAAGGAAAGATTCTTGTGAGAGAGGCGTGAAACAC
+		AAAGGGTATAGGTTCTTCTTCAGATTCATATCACCAACAGTTTGAATATC
+		CATTGCTTTCAGTTGAGCTTCGCATACACGACCAATTCCTCCAACCTAAA
+		AAATTATCTAGGTAAAACTAGAAGGTTATGCTTTAATAGTCTCACCTTAC
+		GAATCGGTAAATCCTTCAAAAACTCCATAATCGCGTTTTTATCATTTTCT
+		.....
+
+*Output*::
+	interpolated context model (ICM)
+
+
+
+]]>
+    </help>
+    <expand macro="citation" />
+</tool>