# HG changeset patch
# User bgruening
# Date 1423556494 18000
# Node ID b2886915ce68b69a8c277dedc3bffc66f0d026dd
Uploaded
diff -r 000000000000 -r b2886915ce68 bamCompare.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/bamCompare.xml Tue Feb 10 03:21:34 2015 -0500
@@ -0,0 +1,221 @@
+
+ normalizes and compares two BAM files to obtain the ratio, log2ratio or difference. (bam2bigwig)
+
+
+
+ bamCompare
+ deepTools_macros.xml
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
diff -r 000000000000 -r b2886915ce68 bamCorrelate.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/bamCorrelate.xml Tue Feb 10 03:21:34 2015 -0500
@@ -0,0 +1,206 @@
+
+ correlates pairs of BAM files
+
+
+
+ bamCorrelate
+ deepTools_macros.xml
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+ ((
+ output['showOutputSettings'] == 'yes' and
+ output['saveRawCounts'] is True
+ ))
+
+
+
+
+ ((
+ output['showOutputSettings'] == 'yes' and
+ output['saveCorMatrix'] is True
+ ))
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
diff -r 000000000000 -r b2886915ce68 bamCoverage.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/bamCoverage.xml Tue Feb 10 03:21:34 2015 -0500
@@ -0,0 +1,198 @@
+
+ generates a coverage bigWig file from a given BAM file. Multiple options are available to count reads and normalize coverage. (bam2bigwig)
+
+
+
+ bamCoverage
+ deepTools_macros.xml
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
diff -r 000000000000 -r b2886915ce68 bamFingerprint.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/bamFingerprint.xml Tue Feb 10 03:21:34 2015 -0500
@@ -0,0 +1,150 @@
+
+ plots profiles of BAM files; useful for assesing ChIP signal strength
+
+
+
+ bamFingerprint
+ deepTools_macros.xml
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+ ((
+ output['showOutputSettings'] == 'yes' and
+ output['saveRawCounts'] is True
+ ))
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
diff -r 000000000000 -r b2886915ce68 bamPEFragmentSize.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/bamPEFragmentSize.xml Tue Feb 10 03:21:34 2015 -0500
@@ -0,0 +1,56 @@
+
+ Given a BAM file it samples several regions to estimate the paird-end fragment length
+
+
+
+ bamPEFragmentSize
+ deepTools_macros.xml
+
+
+ $outfile
+ &&
+ mv ./hist.png $histogram_outfile
+]]>
+
+
+
+
+
+
+
+
+ histogram is True
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
diff -r 000000000000 -r b2886915ce68 bigwigCompare.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/bigwigCompare.xml Tue Feb 10 03:21:34 2015 -0500
@@ -0,0 +1,133 @@
+
+ normalizes and compares two bigWig files to obtain the ratio, log2ratio or difference
+
+
+
+ bigwigCompare
+ deepTools_macros.xml
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
diff -r 000000000000 -r b2886915ce68 computeGCBias.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/computeGCBias.xml Tue Feb 10 03:21:34 2015 -0500
@@ -0,0 +1,167 @@
+
+ to see whether your samples should be normalized for GC bias
+
+
+
+ computeGCBias
+ deepTools_macros.xml
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+ ((
+ image_format != 'none'
+ ))
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+50%)
+
+.. image:: $PATH_TO_IMAGES/QC_GCplots_input.png
+
+
+You can find more details on the computeGCBias wiki page: computeGCBias wiki: https://github.com/fidelram/deepTools/wiki/QC#wiki-computeGCbias
+
+
+**Output files**:
+
+- Diagnostic plot
+
+ - box plot of absolute read numbers per genomic GC bin
+ - x-y plot of observed/expected read ratios per genomic GC content bin
+
+- Data matrix
+
+ - to be used for GC correction with correctGCbias
+
+
+-----
+
+@REFERENCES@
+]]>
+
+
+
diff -r 000000000000 -r b2886915ce68 computeMatrix.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/computeMatrix.xml Tue Feb 10 03:21:34 2015 -0500
@@ -0,0 +1,269 @@
+
+ summarizes and prepares an intermediary file containing scores associated with genomic regions that can be used afterwards to plot a heatmap or a profile
+
+
+
+ computeMatrix
+ deepTools_macros.xml
+
+
+> $temp_input_path;
+ #if str($rf.label.value).strip():
+ echo "\#$rf.label.value" >> $temp_input_path;
+ #else:
+ echo "\#$rf.regionsFile.name" >> $temp_input_path;
+ #end if
+ #end for
+
+ computeMatrix
+
+ $mode.mode_select
+ --regionsFileName '$temp_input_path'
+ --scoreFileName '$scoreFile'
+ --outFileName '$outFileName'
+
+ @THREADS@
+
+ #if $output.showOutputSettings == "yes"
+ #if $output.saveData:
+ --outFileNameData '$outFileNameData'
+ #end if
+ #if $output.saveMatrix:
+ --outFileNameMatrix '$outFileNameMatrix'
+ #end if
+
+ #if $output.saveSortedRegions:
+ --outFileSortedRegions '$outFileSortedRegions'
+ #end if
+ #end if
+
+ #if $mode.mode_select == "reference-point":
+ --referencePoint $mode.referencePoint
+ $mode.nanAfterEnd
+ --beforeRegionStartLength $mode.beforeRegionStartLength
+ --afterRegionStartLength $mode.afterRegionStartLength
+ #else
+ --regionBodyLength $mode.regionBodyLength
+ --startLabel "$mode.startLabel"
+ --endLabel "$mode.endLabel"
+ #if $mode.regionStartLength.regionStartLength_select == "yes":
+ --beforeRegionStartLength $mode.regionStartLength.beforeRegionStartLength
+ --afterRegionStartLength $mode.regionStartLength.afterRegionStartLength
+ #end if
+ #end if
+
+ #if $advancedOpt.showAdvancedOpt == "yes":
+ --sortRegions '$advancedOpt.sortRegions'
+ --sortUsing '$advancedOpt.sortUsing'
+ --averageTypeBins '$advancedOpt.averageTypeBins'
+ $advancedOpt.missingDataAsZero
+ $advancedOpt.skipZeros
+ --binSize $advancedOpt.binSize
+
+ #if $advancedOpt.minThreshold:
+ --minThreshold $advancedOpt.minThreshold
+ #end if
+ #if $advancedOpt.maxThreshold:
+ --maxThreshold $advancedOpt.maxThreshold
+ #end if
+ #if $advancedOpt.scale:
+ --scale $advancedOpt.scale
+ #end if
+
+ #end if
+ ; rm $temp_input_path
+]]>
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
diff -r 000000000000 -r b2886915ce68 correctGCBias.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/correctGCBias.xml Tue Feb 10 03:21:34 2015 -0500
@@ -0,0 +1,76 @@
+
+ uses the output from computeGCBias to generate corrected BAM files
+
+
+
+ correctGCBias
+ deepTools_macros.xml
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
diff -r 000000000000 -r b2886915ce68 deepTools_macros.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/deepTools_macros.xml Tue Feb 10 03:21:34 2015 -0500
@@ -0,0 +1,480 @@
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+ --numberOfProcessors "\${GALAXY_SLOTS:-4}"
+ 1.5.9.1
+
+
+ @BINARY@
+ samtools
+ deepTools
+ ucsc_tools
+ python
+ deepTools
+ ucsc_tools
+ numpy
+ pysam
+ scipy
+ matplotlib
+ samtools
+ bx-python
+
+
+ @BINARY@ --version
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+ #if $advancedOpt.used_multiple_regions.used_multiple_regions_options == 'no':
+ #if $advancedOpt.used_multiple_regions.clustering.clustering_options == 'kmeans':
+ #if int($advancedOpt.used_multiple_regions.clustering.k_kmeans) > 0:
+ --kmeans $advancedOpt.used_multiple_regions.clustering.k_kmeans
+ #end if
+ #end if
+ #end if
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+.. class:: infomark
+
+For more information on the tools, please visit our `help site`_.
+
+If you would like to give us feedback or you run into any trouble, please send an email to deeptools@googlegroups.com
+
+This tool is developed by the `Bioinformatics and Deep-Sequencing Unit`_ at the `Max Planck Institute for Immunobiology and Epigenetics`_.
+
+.. _Bioinformatics and Deep-Sequencing Unit: http://www3.ie-freiburg.mpg.de/facilities/research-facilities/bioinformatics-and-deep-sequencing-unit/
+.. _Max Planck Institute for Immunobiology and Epigenetics: http://www3.ie-freiburg.mpg.de
+.. _help site: https://github.com/fidelram/deepTools/wiki/
+
+**References**
+
+If you use this Galaxy tool in work leading to a scientific publication please
+cite the following paper:
+
+
+
+
+ 10.1093/nar/gku365
+
+
+
+
+
+
+
+
+
+
+
+
+ #import tempfile
+ #set $temp_dir = os.path.abspath(tempfile.mkdtemp())
+ #set files=[]
+ #set labels=[]
+ #for $i in $input_files:
+ #set $temp_input_handle = tempfile.NamedTemporaryFile( dir=$temp_dir )
+ #set $temp_input_path = $temp_input_handle.name
+ #silent $temp_input_handle.close()
+ #silent os.system("ln -s %s %s.bam" % (str($i.bamfile), $temp_input_path))
+ #silent os.system("ln -s %s %s.bam.bai" % (str($i.bamfile.metadata.bam_index), $temp_input_path))
+ #silent $files.append('%s.bam' % $temp_input_path)
+
+ ##set $files += [str($i.bamfile)]
+ #if str($i.label.value) != "":
+ #set $labels += ["\"%s\"" % ($i.label.value)]
+ #else
+ #set $labels += ["\"%s\"" % ($i.bamfile.name)]
+ #end if
+ #end for
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+ #if $source.ref_source=="history":
+ --genome $source.input1
+ #else:
+ --genome "${source.input1_2bit.fields.path}"
+ #end if
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+ ((
+ output['showOutputSettings'] == 'yes' and
+ output['saveMatrix'] is True
+ ))
+
+
+
+
+
+
+
+ ((
+ output['showOutputSettings'] == 'yes' and
+ output['saveData'] is True
+ ))
+
+
+
+
+ ((
+ output['showOutputSettings'] == 'yes' and
+ output['saveSortedRegions'] is True
+ ))
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
diff -r 000000000000 -r b2886915ce68 heatmapper.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/heatmapper.xml Tue Feb 10 03:21:34 2015 -0500
@@ -0,0 +1,228 @@
+
+ creates a heatmap for a score associated to genomic regions
+
+
+
+ heatmapper
+ deepTools_macros.xml
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
diff -r 000000000000 -r b2886915ce68 plotCorrelation.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/plotCorrelation.xml Tue Feb 10 03:21:34 2015 -0500
@@ -0,0 +1,197 @@
+
+ creates a heatmap for a score associated to genomic regions
+
+
+
+ heatmapper
+ deepTools_macros.xml
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
diff -r 000000000000 -r b2886915ce68 profiler.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/profiler.xml Tue Feb 10 03:21:34 2015 -0500
@@ -0,0 +1,183 @@
+
+
+ creates a profile plot for a score associated to genomic regions
+
+
+
+
+ profiler
+ deepTools_macros.xml
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+ all(c in ' #abcdefghijklmnopqrstuvwxyz0123456789' for c in value)
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
diff -r 000000000000 -r b2886915ce68 readme.rst
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/readme.rst Tue Feb 10 03:21:34 2015 -0500
@@ -0,0 +1,74 @@
+========================
+Galaxy deeptools wrapper
+========================
+
+deepTools are user-friendly tools for the normalization and visualization of
+deep-sequencing data.
+They address the challenge of visualizing the large amounts of data that are now
+routinely generated from sequencing centers in a meaningful way.
+To do so, deepTools contain useful routines to process the mapped reads data
+through removal of duplicates and different filtering options to create coverage
+files in standard bedGraph and bigWig file formats. deepTools allow the creation
+of normalized coverage files or the comparison between two files
+(for example, treatment and control). Finally, using such normalized and
+standardized files, multiple visualizations can be created to identify
+enrichments with functional annotations of the genome.
+For a gallery of images that can be produced and a description
+of the tools see our poster_.
+
+.. _poster: http://f1000.com/posters/browse/summary/1094053
+
+deeptools is developed under here:
+
+ https://github.com/fidelram/deepTools
+
+For support, questions, or feature requests contact: deeptools@googlegroups.com
+
+
+============
+Installation
+============
+
+Requirements: python-2.7
+
+Galaxy should be able to automatically install all other dependencies, such as numpy or scipy.
+
+For the best performance we recommend to install blas/lapack/atlas in your environment before
+installing deepTools from the Tool Shed.
+
+
+========
+Citation
+========
+
+deeptools are currently under review. In the meantime please refere to https://github.com/fidelram/deepTools.
+
+
+=======
+History
+=======
+
+ * v1.0: Initial public release
+ * v1.5.8.2: Include new citation tag, update version to 1.5.8.2 and change wrapper version
+
+
+Licence (MIT)
+=============
+
+Permission is hereby granted, free of charge, to any person obtaining a copy
+of this software and associated documentation files (the "Software"), to deal
+in the Software without restriction, including without limitation the rights
+to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
+copies of the Software, and to permit persons to whom the Software is
+furnished to do so, subject to the following conditions:
+
+The above copyright notice and this permission notice shall be included in
+all copies or substantial portions of the Software.
+
+THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
+OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
+THE SOFTWARE.
diff -r 000000000000 -r b2886915ce68 static/images/QC_GCplots_input.png
Binary file static/images/QC_GCplots_input.png has changed
diff -r 000000000000 -r b2886915ce68 static/images/QC_bamCorrelate_humanSamples.png
Binary file static/images/QC_bamCorrelate_humanSamples.png has changed
diff -r 000000000000 -r b2886915ce68 static/images/QC_fingerprint.png
Binary file static/images/QC_fingerprint.png has changed
diff -r 000000000000 -r b2886915ce68 static/images/flowChart_computeMatrixetc.png
Binary file static/images/flowChart_computeMatrixetc.png has changed
diff -r 000000000000 -r b2886915ce68 static/images/norm_IGVsnapshot_indFiles.png
Binary file static/images/norm_IGVsnapshot_indFiles.png has changed
diff -r 000000000000 -r b2886915ce68 static/images/visual_hm_DmelPolII.png
Binary file static/images/visual_hm_DmelPolII.png has changed
diff -r 000000000000 -r b2886915ce68 static/images/visual_profiler_DmelPolII.png
Binary file static/images/visual_profiler_DmelPolII.png has changed
diff -r 000000000000 -r b2886915ce68 test-data/1.bigwig
Binary file test-data/1.bigwig has changed
diff -r 000000000000 -r b2886915ce68 test-data/_1.bigwig
Binary file test-data/_1.bigwig has changed
diff -r 000000000000 -r b2886915ce68 test-data/_2.bigwig
Binary file test-data/_2.bigwig has changed
diff -r 000000000000 -r b2886915ce68 test-data/_3.bigwig
Binary file test-data/_3.bigwig has changed
diff -r 000000000000 -r b2886915ce68 test-data/bamCompare_result1.bg
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bamCompare_result1.bg Tue Feb 10 03:21:34 2015 -0500
@@ -0,0 +1,1 @@
+chrM 0 16569 1.0
diff -r 000000000000 -r b2886915ce68 test-data/bamCorrelate_result1.png
Binary file test-data/bamCorrelate_result1.png has changed
diff -r 000000000000 -r b2886915ce68 test-data/bamCoverage_result1.bw
Binary file test-data/bamCoverage_result1.bw has changed
diff -r 000000000000 -r b2886915ce68 test-data/bamCoverage_result2.bw
Binary file test-data/bamCoverage_result2.bw has changed
diff -r 000000000000 -r b2886915ce68 test-data/bamCoverage_result3.bg
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bamCoverage_result3.bg Tue Feb 10 03:21:34 2015 -0500
@@ -0,0 +1,12 @@
+chrM 0 210 8173200.00
+chrM 210 220 7999302.13
+chrM 220 230 7129812.77
+chrM 230 240 5564731.91
+chrM 240 250 4173548.94
+chrM 250 260 2434570.21
+chrM 260 300 1912876.60
+chrM 300 16310 1738978.72
+chrM 16310 16320 1565080.85
+chrM 16320 16330 869489.36
+chrM 16330 16340 695591.49
+chrM 16340 16350 347795.74
diff -r 000000000000 -r b2886915ce68 test-data/bamCoverage_result4.bg
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bamCoverage_result4.bg Tue Feb 10 03:21:34 2015 -0500
@@ -0,0 +1,456 @@
+phiX174 0 10 3742.31
+phiX174 10 20 18711.54
+phiX174 20 70 63619.23
+phiX174 70 90 82330.77
+phiX174 90 100 101042.31
+phiX174 100 120 104784.62
+phiX174 120 140 119753.85
+phiX174 140 160 138465.38
+phiX174 160 170 153434.62
+phiX174 170 180 183373.08
+phiX174 180 200 202084.62
+phiX174 200 210 205826.92
+phiX174 210 220 224538.46
+phiX174 220 230 265703.85
+phiX174 230 240 295642.31
+phiX174 240 250 303126.92
+phiX174 250 260 318096.15
+phiX174 260 270 366746.15
+phiX174 270 280 404169.23
+phiX174 280 290 419138.46
+phiX174 290 310 437850.00
+phiX174 310 320 456561.54
+phiX174 320 330 479015.38
+phiX174 330 350 497726.92
+phiX174 350 360 505211.54
+phiX174 360 370 508953.85
+phiX174 370 380 523923.08
+phiX174 380 400 550119.23
+phiX174 400 410 553861.54
+phiX174 410 420 550119.23
+phiX174 420 430 565088.46
+phiX174 430 440 583800.00
+phiX174 440 450 595026.92
+phiX174 450 460 609996.15
+phiX174 460 480 643676.92
+phiX174 480 490 658646.15
+phiX174 490 500 669873.08
+phiX174 500 510 673615.38
+phiX174 510 520 669873.08
+phiX174 520 530 684842.31
+phiX174 530 540 677357.69
+phiX174 540 550 707296.15
+phiX174 550 560 684842.31
+phiX174 560 570 711038.46
+phiX174 570 580 707296.15
+phiX174 580 600 699811.54
+phiX174 600 610 673615.38
+phiX174 610 620 722265.38
+phiX174 620 630 740976.92
+phiX174 630 640 722265.38
+phiX174 640 660 718523.08
+phiX174 660 670 711038.46
+phiX174 670 680 692326.92
+phiX174 680 690 733492.31
+phiX174 690 700 752203.85
+phiX174 700 710 737234.62
+phiX174 710 720 740976.92
+phiX174 720 730 759688.46
+phiX174 730 740 748461.54
+phiX174 740 750 759688.46
+phiX174 750 760 733492.31
+phiX174 760 770 714780.77
+phiX174 770 800 755946.15
+phiX174 800 810 744719.23
+phiX174 810 820 740976.92
+phiX174 820 830 726007.69
+phiX174 830 850 711038.46
+phiX174 850 860 729750.00
+phiX174 860 870 733492.31
+phiX174 870 880 722265.38
+phiX174 880 890 740976.92
+phiX174 890 900 748461.54
+phiX174 900 910 767173.08
+phiX174 910 920 759688.46
+phiX174 920 930 774657.69
+phiX174 930 940 770915.38
+phiX174 940 960 744719.23
+phiX174 960 970 714780.77
+phiX174 970 980 684842.31
+phiX174 980 990 692326.92
+phiX174 990 1000 677357.69
+phiX174 1000 1010 681100.00
+phiX174 1010 1020 722265.38
+phiX174 1020 1030 699811.54
+phiX174 1030 1040 744719.23
+phiX174 1040 1050 759688.46
+phiX174 1050 1060 763430.77
+phiX174 1060 1080 793369.23
+phiX174 1080 1100 785884.62
+phiX174 1100 1110 770915.38
+phiX174 1110 1130 767173.08
+phiX174 1130 1140 763430.77
+phiX174 1140 1160 797111.54
+phiX174 1160 1170 793369.23
+phiX174 1170 1190 804596.15
+phiX174 1190 1200 789626.92
+phiX174 1200 1210 782142.31
+phiX174 1210 1220 812080.77
+phiX174 1220 1230 797111.54
+phiX174 1230 1240 778400.00
+phiX174 1240 1250 748461.54
+phiX174 1250 1260 740976.92
+phiX174 1260 1270 759688.46
+phiX174 1270 1280 748461.54
+phiX174 1280 1290 763430.77
+phiX174 1290 1300 755946.15
+phiX174 1300 1310 737234.62
+phiX174 1310 1320 767173.08
+phiX174 1320 1330 755946.15
+phiX174 1330 1340 770915.38
+phiX174 1340 1350 778400.00
+phiX174 1350 1360 789626.92
+phiX174 1360 1370 812080.77
+phiX174 1370 1380 819565.38
+phiX174 1380 1390 778400.00
+phiX174 1390 1400 740976.92
+phiX174 1400 1410 770915.38
+phiX174 1410 1430 778400.00
+phiX174 1430 1440 793369.23
+phiX174 1440 1450 808338.46
+phiX174 1450 1460 830792.31
+phiX174 1460 1470 819565.38
+phiX174 1470 1480 804596.15
+phiX174 1480 1490 800853.85
+phiX174 1490 1500 785884.62
+phiX174 1500 1510 770915.38
+phiX174 1510 1520 759688.46
+phiX174 1520 1530 755946.15
+phiX174 1530 1540 770915.38
+phiX174 1540 1550 755946.15
+phiX174 1550 1560 778400.00
+phiX174 1560 1580 782142.31
+phiX174 1580 1590 718523.08
+phiX174 1590 1600 692326.92
+phiX174 1600 1620 651161.54
+phiX174 1620 1630 647419.23
+phiX174 1630 1640 684842.31
+phiX174 1640 1650 688584.62
+phiX174 1650 1660 692326.92
+phiX174 1660 1670 699811.54
+phiX174 1670 1680 714780.77
+phiX174 1680 1690 696069.23
+phiX174 1690 1710 707296.15
+phiX174 1710 1720 733492.31
+phiX174 1720 1730 740976.92
+phiX174 1730 1740 744719.23
+phiX174 1740 1750 729750.00
+phiX174 1750 1760 703553.85
+phiX174 1760 1770 696069.23
+phiX174 1770 1780 677357.69
+phiX174 1780 1790 666130.77
+phiX174 1790 1800 669873.08
+phiX174 1800 1810 677357.69
+phiX174 1810 1820 658646.15
+phiX174 1820 1830 707296.15
+phiX174 1830 1840 800853.85
+phiX174 1840 1850 819565.38
+phiX174 1850 1860 812080.77
+phiX174 1860 1870 830792.31
+phiX174 1870 1890 827050.00
+phiX174 1890 1900 830792.31
+phiX174 1900 1910 823307.69
+phiX174 1910 1920 812080.77
+phiX174 1920 1930 856988.46
+phiX174 1930 1940 875700.00
+phiX174 1940 1950 838276.92
+phiX174 1950 1960 853246.15
+phiX174 1960 1970 860730.77
+phiX174 1970 1980 886926.92
+phiX174 1980 2000 856988.46
+phiX174 2000 2010 886926.92
+phiX174 2010 2020 871957.69
+phiX174 2020 2030 875700.00
+phiX174 2030 2040 879442.31
+phiX174 2040 2050 883184.62
+phiX174 2050 2060 808338.46
+phiX174 2060 2070 804596.15
+phiX174 2070 2080 785884.62
+phiX174 2080 2090 819565.38
+phiX174 2090 2100 815823.08
+phiX174 2100 2110 819565.38
+phiX174 2110 2120 782142.31
+phiX174 2120 2130 800853.85
+phiX174 2130 2140 785884.62
+phiX174 2140 2160 770915.38
+phiX174 2160 2170 755946.15
+phiX174 2170 2180 737234.62
+phiX174 2180 2190 729750.00
+phiX174 2190 2200 711038.46
+phiX174 2200 2210 722265.38
+phiX174 2210 2220 718523.08
+phiX174 2220 2230 763430.77
+phiX174 2230 2250 770915.38
+phiX174 2250 2260 774657.69
+phiX174 2260 2280 744719.23
+phiX174 2280 2290 748461.54
+phiX174 2290 2300 752203.85
+phiX174 2300 2310 812080.77
+phiX174 2310 2320 842019.23
+phiX174 2320 2330 860730.77
+phiX174 2330 2340 845761.54
+phiX174 2340 2350 853246.15
+phiX174 2350 2360 849503.85
+phiX174 2360 2370 871957.69
+phiX174 2370 2380 860730.77
+phiX174 2380 2390 842019.23
+phiX174 2390 2400 860730.77
+phiX174 2400 2410 815823.08
+phiX174 2410 2420 819565.38
+phiX174 2420 2440 789626.92
+phiX174 2440 2450 785884.62
+phiX174 2450 2460 853246.15
+phiX174 2460 2470 883184.62
+phiX174 2470 2510 928092.31
+phiX174 2510 2520 871957.69
+phiX174 2520 2530 886926.92
+phiX174 2530 2540 916865.38
+phiX174 2540 2560 879442.31
+phiX174 2560 2570 875700.00
+phiX174 2570 2580 916865.38
+phiX174 2580 2590 924350.00
+phiX174 2590 2600 928092.31
+phiX174 2600 2610 909380.77
+phiX174 2610 2620 905638.46
+phiX174 2620 2630 901896.15
+phiX174 2630 2640 946803.85
+phiX174 2640 2650 935576.92
+phiX174 2650 2660 939319.23
+phiX174 2660 2670 943061.54
+phiX174 2670 2680 961773.08
+phiX174 2680 2690 943061.54
+phiX174 2690 2700 928092.31
+phiX174 2700 2710 920607.69
+phiX174 2710 2720 950546.15
+phiX174 2720 2730 969257.69
+phiX174 2730 2740 984226.92
+phiX174 2740 2760 1025392.31
+phiX174 2760 2770 999196.15
+phiX174 2770 2780 987969.23
+phiX174 2780 2790 1006680.77
+phiX174 2790 2810 991711.54
+phiX174 2810 2820 961773.08
+phiX174 2820 2830 931834.62
+phiX174 2830 2840 939319.23
+phiX174 2840 2850 909380.77
+phiX174 2850 2860 894411.54
+phiX174 2860 2870 909380.77
+phiX174 2870 2880 928092.31
+phiX174 2880 2890 913123.08
+phiX174 2890 2900 886926.92
+phiX174 2900 2910 894411.54
+phiX174 2910 2920 868215.38
+phiX174 2920 2930 853246.15
+phiX174 2930 2940 815823.08
+phiX174 2940 2950 864473.08
+phiX174 2950 2960 860730.77
+phiX174 2960 2970 864473.08
+phiX174 2970 2980 875700.00
+phiX174 2980 2990 856988.46
+phiX174 2990 3000 871957.69
+phiX174 3000 3010 901896.15
+phiX174 3010 3020 871957.69
+phiX174 3020 3030 883184.62
+phiX174 3030 3040 864473.08
+phiX174 3040 3050 834534.62
+phiX174 3050 3060 879442.31
+phiX174 3060 3070 890669.23
+phiX174 3070 3090 886926.92
+phiX174 3090 3100 871957.69
+phiX174 3100 3110 916865.38
+phiX174 3110 3120 901896.15
+phiX174 3120 3140 886926.92
+phiX174 3140 3160 898153.85
+phiX174 3160 3170 909380.77
+phiX174 3170 3190 913123.08
+phiX174 3190 3200 898153.85
+phiX174 3200 3220 879442.31
+phiX174 3220 3230 868215.38
+phiX174 3230 3240 886926.92
+phiX174 3240 3250 864473.08
+phiX174 3250 3260 845761.54
+phiX174 3260 3270 875700.00
+phiX174 3270 3280 890669.23
+phiX174 3280 3290 879442.31
+phiX174 3290 3300 853246.15
+phiX174 3300 3310 871957.69
+phiX174 3310 3320 856988.46
+phiX174 3320 3330 901896.15
+phiX174 3330 3340 909380.77
+phiX174 3340 3350 920607.69
+phiX174 3350 3360 935576.92
+phiX174 3360 3370 920607.69
+phiX174 3370 3380 935576.92
+phiX174 3380 3390 950546.15
+phiX174 3390 3410 905638.46
+phiX174 3410 3430 894411.54
+phiX174 3430 3440 909380.77
+phiX174 3440 3460 946803.85
+phiX174 3460 3470 976742.31
+phiX174 3470 3480 946803.85
+phiX174 3480 3490 961773.08
+phiX174 3490 3500 1006680.77
+phiX174 3500 3510 999196.15
+phiX174 3510 3530 1032876.92
+phiX174 3530 3540 991711.54
+phiX174 3540 3550 1010423.08
+phiX174 3550 3560 980484.62
+phiX174 3560 3570 965515.38
+phiX174 3570 3580 939319.23
+phiX174 3580 3600 935576.92
+phiX174 3600 3610 946803.85
+phiX174 3610 3630 916865.38
+phiX174 3630 3640 886926.92
+phiX174 3640 3650 879442.31
+phiX174 3650 3670 894411.54
+phiX174 3670 3690 898153.85
+phiX174 3690 3700 856988.46
+phiX174 3700 3710 868215.38
+phiX174 3710 3720 864473.08
+phiX174 3720 3730 875700.00
+phiX174 3730 3750 856988.46
+phiX174 3750 3760 849503.85
+phiX174 3760 3780 834534.62
+phiX174 3780 3790 808338.46
+phiX174 3790 3800 755946.15
+phiX174 3800 3810 711038.46
+phiX174 3810 3820 707296.15
+phiX174 3820 3830 658646.15
+phiX174 3830 3840 677357.69
+phiX174 3840 3850 692326.92
+phiX174 3850 3860 718523.08
+phiX174 3860 3870 722265.38
+phiX174 3870 3890 707296.15
+phiX174 3890 3900 692326.92
+phiX174 3900 3910 666130.77
+phiX174 3910 3920 636192.31
+phiX174 3920 3930 602511.54
+phiX174 3930 3940 591284.62
+phiX174 3940 3960 606253.85
+phiX174 3960 3970 621223.08
+phiX174 3970 3980 636192.31
+phiX174 3980 3990 617480.77
+phiX174 3990 4020 632450.00
+phiX174 4020 4030 666130.77
+phiX174 4030 4040 669873.08
+phiX174 4040 4050 636192.31
+phiX174 4050 4070 606253.85
+phiX174 4070 4080 602511.54
+phiX174 4080 4090 621223.08
+phiX174 4090 4100 647419.23
+phiX174 4100 4110 632450.00
+phiX174 4110 4120 636192.31
+phiX174 4120 4130 606253.85
+phiX174 4130 4140 624965.38
+phiX174 4140 4160 636192.31
+phiX174 4160 4170 654903.85
+phiX174 4170 4180 636192.31
+phiX174 4180 4190 658646.15
+phiX174 4190 4200 669873.08
+phiX174 4200 4210 707296.15
+phiX174 4210 4230 692326.92
+phiX174 4230 4240 688584.62
+phiX174 4240 4250 726007.69
+phiX174 4250 4260 711038.46
+phiX174 4260 4270 740976.92
+phiX174 4270 4290 744719.23
+phiX174 4290 4310 752203.85
+phiX174 4310 4320 767173.08
+phiX174 4320 4330 770915.38
+phiX174 4330 4340 737234.62
+phiX174 4340 4350 703553.85
+phiX174 4350 4360 711038.46
+phiX174 4360 4380 714780.77
+phiX174 4380 4390 707296.15
+phiX174 4390 4400 673615.38
+phiX174 4400 4410 703553.85
+phiX174 4410 4430 748461.54
+phiX174 4430 4440 759688.46
+phiX174 4440 4450 774657.69
+phiX174 4450 4470 778400.00
+phiX174 4470 4480 759688.46
+phiX174 4480 4490 767173.08
+phiX174 4490 4500 759688.46
+phiX174 4500 4510 729750.00
+phiX174 4510 4520 707296.15
+phiX174 4520 4530 688584.62
+phiX174 4530 4540 692326.92
+phiX174 4540 4550 733492.31
+phiX174 4550 4560 711038.46
+phiX174 4560 4580 703553.85
+phiX174 4580 4590 669873.08
+phiX174 4590 4600 684842.31
+phiX174 4600 4610 707296.15
+phiX174 4610 4620 692326.92
+phiX174 4620 4630 737234.62
+phiX174 4630 4640 733492.31
+phiX174 4640 4650 778400.00
+phiX174 4650 4660 752203.85
+phiX174 4660 4670 748461.54
+phiX174 4670 4680 744719.23
+phiX174 4680 4690 729750.00
+phiX174 4690 4700 770915.38
+phiX174 4700 4710 744719.23
+phiX174 4710 4720 729750.00
+phiX174 4720 4730 733492.31
+phiX174 4730 4740 774657.69
+phiX174 4740 4750 804596.15
+phiX174 4750 4760 800853.85
+phiX174 4760 4770 815823.08
+phiX174 4770 4780 860730.77
+phiX174 4780 4810 868215.38
+phiX174 4810 4830 886926.92
+phiX174 4830 4840 905638.46
+phiX174 4840 4850 931834.62
+phiX174 4850 4860 939319.23
+phiX174 4860 4870 924350.00
+phiX174 4870 4880 905638.46
+phiX174 4880 4890 890669.23
+phiX174 4890 4900 860730.77
+phiX174 4900 4910 845761.54
+phiX174 4910 4930 830792.31
+phiX174 4930 4950 815823.08
+phiX174 4950 4960 789626.92
+phiX174 4960 4970 740976.92
+phiX174 4970 4980 726007.69
+phiX174 4980 4990 699811.54
+phiX174 4990 5000 703553.85
+phiX174 5000 5010 688584.62
+phiX174 5010 5030 669873.08
+phiX174 5030 5050 666130.77
+phiX174 5050 5060 621223.08
+phiX174 5060 5070 606253.85
+phiX174 5070 5080 572573.08
+phiX174 5080 5090 557603.85
+phiX174 5090 5100 542634.62
+phiX174 5100 5120 512696.15
+phiX174 5120 5130 493984.62
+phiX174 5130 5140 479015.38
+phiX174 5140 5150 475273.08
+phiX174 5150 5160 460303.85
+phiX174 5160 5180 426623.08
+phiX174 5180 5190 422880.77
+phiX174 5190 5200 407911.54
+phiX174 5200 5210 348034.62
+phiX174 5210 5220 303126.92
+phiX174 5220 5230 258219.23
+phiX174 5230 5240 243250.00
+phiX174 5240 5250 209569.23
+phiX174 5250 5260 164661.54
+phiX174 5260 5280 160919.23
+phiX174 5280 5290 130980.77
+phiX174 5290 5300 97300.00
+phiX174 5300 5310 78588.46
+phiX174 5310 5340 44907.69
+phiX174 5340 5350 29938.46
+phiX174 5350 5386 14969.2
diff -r 000000000000 -r b2886915ce68 test-data/bamCoverage_result4.bw
Binary file test-data/bamCoverage_result4.bw has changed
diff -r 000000000000 -r b2886915ce68 test-data/bamFingerprint_result1.png
Binary file test-data/bamFingerprint_result1.png has changed
diff -r 000000000000 -r b2886915ce68 test-data/bamPEFragmentSize_histogram_result1.png
Binary file test-data/bamPEFragmentSize_histogram_result1.png has changed
diff -r 000000000000 -r b2886915ce68 test-data/bamPEFragmentSize_result1.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bamPEFragmentSize_result1.txt Tue Feb 10 03:21:34 2015 -0500
@@ -0,0 +1,9 @@
+Sample size: 3
+
+Min.: 241.0
+1st Qu.: 241.5
+Mean: 244.666666667
+Median: 242.0
+3rd Qu.: 246.5
+Max.: 251.0
+Std: 4.49691252108
diff -r 000000000000 -r b2886915ce68 test-data/bigwigCompare_result1.bw
Binary file test-data/bigwigCompare_result1.bw has changed
diff -r 000000000000 -r b2886915ce68 test-data/bigwigCompare_result2.bg
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bigwigCompare_result2.bg Tue Feb 10 03:21:34 2015 -0500
@@ -0,0 +1,5 @@
+chr21 0 10000000 1.0
+chr21 10000000 20000000 1.0
+chr21 20000000 30000000 1.0
+chr21 30000000 40000000 1.0
+chr21 40000000 48129895 1.0
diff -r 000000000000 -r b2886915ce68 test-data/bowtie2-test1.bam
Binary file test-data/bowtie2-test1.bam has changed
diff -r 000000000000 -r b2886915ce68 test-data/computeGCBias_result1.png
Binary file test-data/computeGCBias_result1.png has changed
diff -r 000000000000 -r b2886915ce68 test-data/computeGCBias_result1.tabular
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/computeGCBias_result1.tabular Tue Feb 10 03:21:34 2015 -0500
@@ -0,0 +1,101 @@
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 2.900000000000000000e+01 1.000000000000000000e+00
+2.000000000000000000e+00 2.900000000000000000e+01 4.068965517241379004e+00
+1.000000000000000000e+00 5.900000000000000000e+01 1.000000000000000000e+00
+3.000000000000000000e+00 9.600000000000000000e+01 1.843750000000000000e+00
+2.000000000000000000e+00 1.570000000000000000e+02 7.515923566878981443e-01
+5.000000000000000000e+00 1.740000000000000000e+02 1.695402298850574585e+00
+5.000000000000000000e+00 2.340000000000000000e+02 1.260683760683760646e+00
+7.000000000000000000e+00 3.590000000000000000e+02 1.150417827298050089e+00
+4.000000000000000000e+00 3.690000000000000000e+02 6.395663956639566772e-01
+7.000000000000000000e+00 4.310000000000000000e+02 9.582366589327145912e-01
+8.000000000000000000e+00 4.820000000000000000e+02 9.792531120331949834e-01
+1.100000000000000000e+01 5.490000000000000000e+02 1.182149362477231236e+00
+8.000000000000000000e+00 5.220000000000000000e+02 9.042145593869731490e-01
+8.000000000000000000e+00 5.670000000000000000e+02 8.324514991181657386e-01
+2.000000000000000000e+00 3.760000000000000000e+02 3.138297872340425343e-01
+6.000000000000000000e+00 2.650000000000000000e+02 1.335849056603773510e+00
+1.000000000000000000e+00 1.840000000000000000e+02 3.206521739130434590e-01
+0.000000000000000000e+00 1.160000000000000000e+02 1.000000000000000000e+00
+4.000000000000000000e+00 8.400000000000000000e+01 2.809523809523809312e+00
+2.000000000000000000e+00 8.300000000000000000e+01 1.421686746987951944e+00
+3.000000000000000000e+00 6.600000000000000000e+01 2.681818181818182101e+00
+0.000000000000000000e+00 3.900000000000000000e+01 1.000000000000000000e+00
+0.000000000000000000e+00 1.600000000000000000e+01 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
diff -r 000000000000 -r b2886915ce68 test-data/computeMatrix1.bed
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/computeMatrix1.bed Tue Feb 10 03:21:34 2015 -0500
@@ -0,0 +1,8 @@
+phiX174 1000 1500 CG11023 0 +
+phiX174 150 1750 cda5 0 -
+phiX174 150 177 cda8 0 -
+phiX174 75 1500 cda9 0 +
+phiX174 101 175 C11023 0 +
+phiX174 125 150 ca5 0 -
+phiX174 450 1750 ca8 0 +
+phiX174 80 1500 cda9 0 +
diff -r 000000000000 -r b2886915ce68 test-data/computeMatrix2.bed
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/computeMatrix2.bed Tue Feb 10 03:21:34 2015 -0500
@@ -0,0 +1,6 @@
+ch1 100 150 CG11023 0 +
+ch2 150 175 cda5 0 -
+ch3 100 125 cda8 0 +
+ch1 75 125 C11023 0 +
+ch2 125 150 ca5 0 -
+ch3 75 100 ca8 0 +
diff -r 000000000000 -r b2886915ce68 test-data/computeMatrix2.bw
Binary file test-data/computeMatrix2.bw has changed
diff -r 000000000000 -r b2886915ce68 test-data/computeMatrix_result1.gz
Binary file test-data/computeMatrix_result1.gz has changed
diff -r 000000000000 -r b2886915ce68 test-data/computeMatrix_result2.gz
Binary file test-data/computeMatrix_result2.gz has changed
diff -r 000000000000 -r b2886915ce68 test-data/correctGCBias_result1.bam
diff -r 000000000000 -r b2886915ce68 test-data/phiX.2bit
Binary file test-data/phiX.2bit has changed
diff -r 000000000000 -r b2886915ce68 test-data/phiX.bam
Binary file test-data/phiX.bam has changed
diff -r 000000000000 -r b2886915ce68 test-data/phiX.bam.bai
Binary file test-data/phiX.bam.bai has changed
diff -r 000000000000 -r b2886915ce68 test-data/phiX.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/phiX.fasta Tue Feb 10 03:21:34 2015 -0500
@@ -0,0 +1,79 @@
+>phiX174
+GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT
+GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA
+ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG
+TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA
+GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC
+TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT
+TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT
+CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT
+TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG
+TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC
+GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA
+CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG
+TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT
+AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC
+CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA
+TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC
+TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA
+CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA
+GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT
+GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA
+ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC
+TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT
+TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC
+ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC
+CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT
+GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC
+CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC
+TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG
+TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT
+TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA
+AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT
+TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT
+ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC
+GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC
+TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT
+TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA
+TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG
+TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC
+CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG
+AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC
+CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT
+TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG
+CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA
+AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT
+GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG
+GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA
+TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT
+CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG
+TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA
+GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC
+CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA
+TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA
+AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC
+TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT
+CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA
+TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG
+TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT
+CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT
+TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC
+ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG
+TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA
+ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG
+GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC
+CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT
+GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG
+GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT
+ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG
+CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC
+CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC
+GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT
+CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG
+CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA
+TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT
+TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG
+TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC
+AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC
+TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA
+
diff -r 000000000000 -r b2886915ce68 tool-data/deepTools_seqs.loc.sample
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/deepTools_seqs.loc.sample Tue Feb 10 03:21:34 2015 -0500
@@ -0,0 +1,27 @@
+#This is a sample file distributed with Galaxy that enables tools
+#to use a directory of 2bit genome files for use with deepTools. You will
+#need to supply these files and then create a deepTools_seqs.loc file
+#similar to this one (store it in this directory) that points to
+#the directories in which those files are stored. The deepTools_seqs.loc
+#file has this format:
+#
+#
+#
+#So, for example, if your deepTools_seqs.loc began like this:
+#
+#hg18 Human (Homo sapiens): hg18 /depot/data2/galaxy/twobit/hg18.2bit
+#hg19 Human (Homo sapiens): hg19 /depot/data2/galaxy/twobit/hg19.2bit
+#mm9 Mouse (Mus musculus): mm9 /depot/data2/galaxy/twobit/mm9.2bit
+#
+#then your /depot/data2/galaxy/twobit/ directory
+#would need to contain the following 2bit files:
+#
+#-rw-r--r-- 1 james universe 830134 2005-09-13 10:12 hg18.2bit
+#-rw-r--r-- 1 james universe 527388 2005-09-13 10:12 hg19.2bit
+#-rw-r--r-- 1 james universe 269808 2005-09-13 10:12 mm9.2bit
+#
+#Your deepTools_seqs.loc file should include an entry per line for
+#each file you have stored that you want to be available. Note that
+#your files should all have the extension '2bit'.
+#
+#Please note that the is also used as "Species name abbreviation".
diff -r 000000000000 -r b2886915ce68 tool_data_table_conf.xml.sample
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml.sample Tue Feb 10 03:21:34 2015 -0500
@@ -0,0 +1,7 @@
+
+
+
+
diff -r 000000000000 -r b2886915ce68 tool_dependencies.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_dependencies.xml Tue Feb 10 03:21:34 2015 -0500
@@ -0,0 +1,103 @@
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+ http://hgdownload.cse.ucsc.edu/admin/exe/linux.x86_64/bedGraphToBigWig
+ http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.i386/bedGraphToBigWig
+ http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.i386/bedGraphToBigWig
+ http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.x86_64/bedGraphToBigWig
+
+
+ $INSTALL_DIR/bedGraphToBigWig
+
+
+ http://hgdownload.cse.ucsc.edu/admin/exe/linux.x86_64/bigWigInfo
+ http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.i386/bigWigInfo
+ http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.i386/bigWigInfo
+ http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.x86_64/bigWigInfo
+
+
+ $INSTALL_DIR/bigWigInfo
+
+
+ http://hgdownload.cse.ucsc.edu/admin/exe/linux.x86_64/bigWigToBedGraph
+ http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.i386/bigWigToBedGraph
+ http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.i386/bigWigToBedGraph
+ http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.x86_64/bigWigToBedGraph
+
+
+ $INSTALL_DIR/bigWigToBedGraph
+
+
+ $INSTALL_DIR
+
+
+
+ The tools downloaded by this dependency definition are free for academic use. TODO: UCSC tools are only available with their latest version. That is not good for reproducibility.
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+ https://pypi.python.org/packages/source/d/deepTools/deepTools-1.5.9.1.tar.gz
+
+
+
+ $INSTALL_DIR/bin
+ $INSTALL_DIR
+
+ TRUE
+
+
+
+
+ Installation of deepTools from Fidel Ramirez.
+ https://github.com/fidelram/deepTools
+
+
+