# HG changeset patch
# User bgruening
# Date 1450301865 18000
# Node ID af2607db5c8994cc317d67ebc3580beac8277873

planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit e1fd513c18e0d5b53071d99f539ac3509ced01aa-dirty

diff -r 000000000000 -r af2607db5c89 bamCoverage.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/bamCoverage.xml	Wed Dec 16 16:37:45 2015 -0500
@@ -0,0 +1,187 @@
+<tool id="deeptools_bam_coverage" name="bamCoverage" version="@WRAPPER_VERSION@.0">
+    <description>generates a coverage bigWig file from a given BAM file</description>
+    <macros>
+        <token name="@BINARY@">bamCoverage</token>
+        <import>deepTools_macros.xml</import>
+    </macros>
+    <expand macro="requirements" />
+    <command>
+<![CDATA[
+        ln -s '$bamInput' one.bam &&
+        ln -s '${bamInput.metadata.bam_index}' one.bam.bai &&
+
+        @BINARY@
+            @THREADS@
+
+            --bam one.bam
+            --outFileName '$outFileName'
+            --outFileFormat '$outFileFormat'
+
+            --binSize $binSize
+
+            #if $scaling.type=='rpkm':
+                --normalizeUsingRPKM
+            #elif $scaling.type=='1x':
+                #if $scaling.effectiveGenomeSize.effectiveGenomeSize_opt == "specific":
+                    --normalizeTo1x $scaling.effectiveGenomeSize.effectiveGenomeSize
+                #else:
+                    --normalizeTo1x $scaling.effectiveGenomeSize.effectiveGenomeSize_opt
+                #end if
+            #elif $scaling.type=='own':
+                --scaleFactor $scaling.scaleFactor
+            #end if
+
+            #if str($region).strip() != '':
+                --region '$region'
+            #end if
+
+            #if $advancedOpt.showAdvancedOpt == "yes":
+                #if $advancedOpt.smoothLength:
+                    --smoothLength '$advancedOpt.smoothLength'
+                #end if
+
+                @ADVANCED_OPTS_READ_PROCESSING@
+                $advancedOpt.keepNAs
+
+                if str($advancedOpt.ignoreForNormalization).strip() != '':
+                    --ignoreForNormalization $advancedOpt.ignoreForNormalization
+                end if
+            #end if
+]]>
+    </command>
+
+    <inputs>
+        <param name="bamInput" format="bam" type="data" label="BAM file"
+            help="The BAM file must be sorted."/>
+
+        <param name="binSize" type="integer" value="50" min="1" 
+            label="Bin size in bp"
+            help="The genome will be divided in bins (also called tiles) of the specified length. For each bin the overlaping number of fragments (or reads)  will be reported. If only half a fragment overlaps, this fraction will be reported. "/>
+
+        <conditional name="scaling">
+            <param name="type" type="select" label="Scaling/Normalization method" >
+                <option value="1x">Normalize coverage to 1x</option>
+                <option value="rpkm">Normalize to fragments (reads) per kilobase per million (RPKM)</option>
+                <option value="no">Do not normalize or scale</option>
+            </param>
+            <when value="rpkm">
+                <expand macro="scaleFactor" />
+            </when>
+            <when value="no"/>
+            <when value="1x">
+                <expand macro="effectiveGenomeSize" />
+                <expand macro="scaleFactor" />
+            </when>
+        </conditional>
+
+        <param name="outFileFormat" type="select" label="Coverage file format">
+            <option value="bigwig" selected="true">bigwig</option>
+            <option value="bedgraph">bedgraph</option>
+        </param>
+
+        <expand macro="region_limit_operation" />
+
+        <conditional name="advancedOpt">
+            <param name="showAdvancedOpt" type="select" label="Show advanced options" >
+                <option value="no" selected="true">no</option>
+                <option value="yes">yes</option>
+            </param>
+            <when value="no" />
+            <when value="yes">
+                <expand macro="smoothLength" />
+
+                <param argument="ignoreForNormalization" type="text" value=""
+                    label="Regions that should be excluded for normalization"
+                    help="A list of chromosome names separated by spaces
+                        containing those chromosomes that should be excluded
+                        for computing the normalization. This is useful when
+                        considering samples with unequal coverage across
+                        chromosomes like male samples. Example: chrX chrM" />
+
+                <expand macro="keepNAs" />
+                <expand macro="read_processing_options" />
+
+                <param argument="--MNase" type="boolean" truevalue="--MNase" falsevalue=""
+                    label="Determine nucleosome positions from MNase-seq data"
+                    help="Only 3 nucleotides at the center of each fragment are counted. The fragment ends are defined by the two mate reads. *NOTE*: Requires paired-end data." />
+
+            </when>
+        </conditional>
+    </inputs>
+    <outputs>
+        <data format="bigwig" name="outFileName">
+            <change_format>
+                <when input="outFileFormat" value="bigwig" format="bigwig" />
+                <when input="outFileFormat" value="bedgraph" format="bedgraph" />
+            </change_format>
+        </data>
+    </outputs>
+    <tests>
+        <test>
+            <param name="bamInput" value="bowtie2-test1.bam" ftype="bam" />
+            <param name="outFileFormat" value="bigwig" />
+            <param name="showAdvancedOpt" value="no" />
+            <param name="binSize" value="10" />
+            <param name="type" value="no" />
+            <output name="outFileName" file="bamCoverage_result1.bw" ftype="bigwig" />
+        </test>
+        <test>
+            <param name="bamInput" value="bowtie2-test1.bam" ftype="bam" />
+            <param name="outFileFormat" value="bigwig" />
+            <param name="showAdvancedOpt" value="no" />
+            <param name="binSize" value="10" />
+            <output name="outFileName" file="bamCoverage_result2.bw" ftype="bigwig" />
+        </test>
+        <test>
+            <param name="bamInput" value="bowtie2-test1.bam" ftype="bam" />
+            <param name="outFileFormat" value="bedgraph" />
+            <param name="showAdvancedOpt" value="no" />
+            <param name="binSize" value="10" />
+            <output name="outFileName" file="bamCoverage_result3.bg" ftype="bedgraph" />
+        </test>
+        <test>
+            <param name="bamInput" value="phiX.bam" ftype="bam" />
+            <param name="outFileFormat" value="bigwig" />
+            <param name="showAdvancedOpt" value="no" />
+            <param name="binSize" value="10" />
+            <output name="outFileName" file="bamCoverage_result4.bw" ftype="bigwig" />
+        </test>
+        <test>
+            <param name="bamInput" value="phiX.bam" ftype="bam" />
+            <param name="outFileFormat" value="bedgraph" />
+            <param name="showAdvancedOpt" value="no" />
+            <param name="binSize" value="10" />
+            <output name="outFileName" file="bamCoverage_result4.bg" ftype="bedgraph" />
+        </test>
+    </tests>
+    <help>
+<![CDATA[
+**What it does**
+
+Given a BAM file, this tool generates a bigWig or bedGraph file of fragment or
+read coverages. The way the method works is by first calculating all the
+number of reads (either extended to match the fragment length or not) that
+overlap each bin in the genome. The resulting read counts can be normalized
+using either a given scaling factor, the RPKM formula or to get a 1x depth of
+coverage (RPGC). In the case of paired-end mapping each read mate is treated
+independently to avoid a bias when a mixture of concordant and discordant
+pairs is present. This means that *each end* will be extended to match the
+fragment length.
+
+.. image:: $PATH_TO_IMAGES/norm_IGVsnapshot_indFiles.png
+
+
+You can find more details on the bamCoverage wiki page: https://github.com/fidelram/deepTools/wiki/Normalizations#wiki-bamCoverage
+
+
+**Output files**:
+
+- coverage file either in bigWig or bedGraph format
+
+-----
+
+@REFERENCES@
+]]>
+    </help>
+    <expand macro="citations" />
+</tool>
diff -r 000000000000 -r af2607db5c89 datatypes_conf.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/datatypes_conf.xml	Wed Dec 16 16:37:45 2015 -0500
@@ -0,0 +1,7 @@
+<?xml version="1.0"?>
+<datatypes>
+    <registration>
+        <datatype extension="deeptools_compute_matrix_archive" type="galaxy.datatypes.binary:CompressedArchive" subclass="True" display_in_upload="True"/>
+        <datatype extension="deeptools_coverage_matrix" type="galaxy.datatypes.binary:CompressedArchive" subclass="True" display_in_upload="True"/>
+    </registration>
+</datatypes>
diff -r 000000000000 -r af2607db5c89 deepTools_macros.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/deepTools_macros.xml	Wed Dec 16 16:37:45 2015 -0500
@@ -0,0 +1,644 @@
+<macros>
+
+    <xml name="advancedOpt_scaffold">
+        <conditional name="advancedOpt">
+            <param name="showAdvancedOpt" type="select" label="Show advanced options" >
+                <option value="no" selected="true">no</option>
+                <option value="yes">yes</option>
+            </param>
+            <when value="no" />
+            <when value="yes">
+                <yield/>
+            </when>
+        </conditional>
+    </xml>
+
+    <token name="@ADVANCED_OPTS_READ_PROCESSING@">
+        --extendReads $advancedOpt.extendReads
+        $advancedOpt.ignoreDuplicates
+        $advancedOpt.centerReads
+        #if $advancedOpt.minMappingQuality:
+            --minMappingQuality '$advancedOpt.minMappingQuality'
+        #end if
+        #if $advancedOpt.samFlagInclude:
+            --samFlagInclude $advancedOpt.samFlagInclude
+        #end if
+        #if $advancedOpt.samFlagExclude:
+            --samFlagExclude $advancedOpt.samFlagExclude
+        #end if
+    </token>
+
+    <xml name="heatmap_options">
+        <expand macro="zMin_zMax" />
+        <expand macro="colorMap" />
+        <expand macro="plotTitle" />
+        <expand macro="plotNumbers" />
+    </xml>
+
+    <token name="@HEATMAP_OPTIONS@">
+        #if $zMin:
+            --zMin $zMin
+        #end if
+        #if $zMax:
+            --zMax $zMax
+        #end if
+            --colorMap '$colorMap'
+        $plotNumbers
+    </token>
+
+        <expand macro="plotTitle" />
+        <expand macro="plotNumbers" />
+        <conditional name="output">
+            <param name="showOutputSettings" type="select" label="Show advanced output settings" >
+                <option value="no" selected="true">no</option>
+                <option value="yes">yes</option>
+            </param>
+            <when value="no" />
+            <when value="yes">
+                <expand macro="input_image_file_format"/>
+                <param name="saveRawCounts" type="boolean" label="Save the bin counts"/>
+                <param name="saveCorMatrix" type="boolean" label="Save the correlation matrix"/>
+            </when>
+        </conditional>
+
+<!--
+            $mode.advancedOpt.includeZeros
+
+
+        #if $plotTitle and str($plotTitle).strip() != "":
+            - -plotTitle '$plotTitle'
+        #end if
+
+
+-->
+
+    <xml name="bigwigCorrelate_mode_actions">
+        <expand macro="region_limit_operation" />
+
+        <conditional name="advancedOpt">
+            <param name="showAdvancedOpt" type="select" label="Show advanced options" >
+                <option value="no" selected="true">no</option>
+                <option value="yes">yes</option>
+            </param>
+            <when value="no" />
+            <when value="yes">
+                <expand macro="includeZeros" />
+                <expand macro="zMin_zMax" />
+                <expand macro="colorMap" />
+                <expand macro="plotTitle" />
+                <expand macro="plotNumbers" />
+            </when>
+        </conditional>
+    </xml>
+
+    <xml name="includeZeros">
+        <param argument="--includeZeros" type="boolean" truevalue="--includeZeros" falsevalue=""
+            label="Include zeros"
+            help="If set, then regions with zero counts for *all* BAM files given are included. The default behavior is to ignore those cases." />
+    </xml>
+
+    <xml name="zMin_zMax">
+        <param argument="--zMin" type="integer" value="" optional="true" label="Minimum value for the heatmap intensities"
+            help="If not specified the value is set automatically."/>
+        <param argument="--zMax" type="integer" value="" optional="true" label="Maximum value for the heatmap intensities"
+            help="If not specified the value is set automatically."/>
+    </xml>
+
+    <xml name="region_limit_operation">
+        <param argument="--region" type="text" value=""
+            label="Region of the genome to limit the operation to"
+            help="This is useful when testing parameters to reduce the computing time. The format is chr:start:end, for example &quot;chr10&quot; or &quot;chr10:456700:891000&quot;." />
+    </xml>
+
+    <token name="@THREADS@">--numberOfProcessors "\${GALAXY_SLOTS:-4}"</token>
+    <token name="@WRAPPER_VERSION@">1.5.11</token>
+    <xml name="requirements">
+        <requirements>
+            <requirement type="package" version="2.7.10">python</requirement>
+            <requirement type="binary">@BINARY@</requirement>
+            <requirement type="package" version="2.0">deepTools</requirement>
+            <yield />
+        </requirements>
+        <expand macro="stdio" />
+        <version_command>@BINARY@ --version</version_command>
+    </xml>
+
+    <xml name="smoothLength">
+        <param argument="--smoothLength" type="integer" value="" optional="True" min="1"
+            label="Smooth values using the following length (in bp)"
+            help ="The smooth length defines a window, larger than the bin size, to average the number of reads. For example, if the bin size is set to 20 bp and the smooth length is set to 60 bp, then, for each bin size the average of it and its left and right neighbors is considered. Any value smaller than the bin size will be ignored and no smoothing will be applied."/>
+    </xml>
+
+
+    <xml name="kmeans_clustering">
+        <conditional name="used_multiple_regions">
+            <param name="used_multiple_regions_options" type="select" 
+                label="Did you compute the matrix with more than one groups of regions?"
+                help="Would you like to cluster the regions according to the similarity of the signal distribution? This is only possible if you used computeMatrix on only one group of regions.">
+                <option value="yes">Yes, I used multiple groups of regions</option>
+                <option value="no">No, I used only one group</option>
+            </param>
+            <when value="no">
+                <conditional name="clustering">
+                    <param name="clustering_options" type="select" label="Clustering algorithm">
+                        <option value="none">No clustering</option>
+                        <option value="kmeans">Kmeans clustering</option>
+                    </param>
+                    <when value="kmeans">
+                        <param name="k_kmeans" type="integer" value="0" label="Number of clusters to compute" 
+                            help="When this option is set, then the matrix is split into clusters using the kmeans algorithm. Only works for data that is not grouped, otherwise only the first group will be clustered. If more specific clustering methods are required it is advisable to save the underlying matrix and run the clustering using other software. The plotting of the clustering may fail (Error: Segmentation fault) if a cluster has very few members compared to the total number or regions. (default: None)."/>
+                    </when>
+                    <when value="none" />
+                </conditional>
+            </when>
+            <when value="yes" />
+        </conditional>
+    </xml>
+
+    <token name="@KMEANS_CLUSTERING@">
+        #if $advancedOpt.used_multiple_regions.used_multiple_regions_options == 'no':
+            #if $advancedOpt.used_multiple_regions.clustering.clustering_options == 'kmeans':
+                #if int($advancedOpt.used_multiple_regions.clustering.k_kmeans) > 0:
+                    --kmeans $advancedOpt.used_multiple_regions.clustering.k_kmeans
+                #end if
+            #end if
+        #end if
+    </token>
+
+    <xml name="samFlags">
+        <param argument="--samFlagInclude" type="integer" optional="True" value=""
+            label="Include reads based on the SAM flag"
+            help= "For example, to get only reads that are the first mate use a flag of 64. This is useful to count properly paired reads only once, otherwise the second mate will be also considered for the coverage."/>
+        <param argument="--samFlagExclude" type="integer" optional="True" value=""
+            label="Exclude reads based on the SAM flag"
+            help= "For example, to get only reads that map to the forward strand, use --samFlagExclude 16, where 16 is the SAM flag for reads that map to the reverse strand."/>
+    </xml>
+
+    <xml name="read_processing_options">
+        <expand macro="extendReads" />
+        <expand macro="ignoreDuplicates" />
+        <expand macro="centerReads" />
+        <expand macro="minMappingQuality" />
+        <expand macro="samFlags" />
+    </xml>
+
+    <xml name="plotNumbers">
+        <param argument="--plotNumbers" type="boolean" truevalue="--plotNumbers" falsevalue=""
+            label="Plot the correlation value" 
+            help="If set, then the correlation number is plotted on top of the heatmap."/>
+    </xml>
+
+    <xml name="extendReads">
+        <param argument="--extendReads" type="integer" value="" optional="True"
+            label="Extend reads to the given average fragment size"
+            help="(1) Single-end reads and singletons are extended to match this length. (2) Paired-end reads are extended to match the fragment size, regardless of what is set here.
+                    By default *each* read mate is extended.
+                    This can be modified using the SAM flags (see --samFlagInclude and --samFlagExclude options) to keep only the first or the second mate.
+                    Unmated reads, mate reads that map on different chromosomes or too far apart are extended to the given value.
+                    Reads are only extended if --extendReads is set to a value greater than the read length. *NOTE*: For spliced-read data, this option is not
+                    recommended as it will extend reads over skipped regions, e.g. introns in RNA-seq data."/>
+    </xml>
+
+    <xml name="corMethod">
+        <param argument="--corMethod" type="select" label="Correlation method">
+            <option value="spearman" selected="True">Spearman</option>
+            <option value="pearson">Pearson</option>
+        </param>
+    </xml>
+
+    <xml name="distanceBetweenBins">
+        <param argument="--distanceBetweenBins" type="integer" value="0" min="0"
+            label="Distance between bins"
+            help="By default, bamCorrelate considers consecutive bins of
+                the specified 'Bin size'. However, to reduce the
+                computation time, a larger distance between bins can
+                by given. Larger distances result in less bins being
+                considered."/>
+    </xml>
+
+    <xml name="centerReads">
+        <param argument="--centerReads" type="boolean" truevalue="--centerReads" falsevalue=""
+            label="Center regions with respect to the fragment length"
+            help="For paired-end data, the read is centered at the fragment length defined by the two ends of the fragment. For single-end data, the given fragment length is used. This option is useful to get a sharper signal around enriched regions. "/>
+    </xml>
+
+    <xml name="ignoreDuplicates">
+        <param argument="--ignoreDuplicates" type="boolean" truevalue="--ignoreDuplicates" falsevalue=""
+            label="Ignore duplicates"
+            help="If set, reads that have the same orientation and start position will be considered only once. If reads are paired, the mate position also has to coincide to ignore a read." />
+    </xml>
+
+    <xml name="sortUsing">
+        <param argument="--sortUsing" type="select" label="Method used for sorting"
+            help="For each row the method is computed.">
+            <option value="mean" selected="true">mean</option>
+            <option value="median">median</option>
+            <option value="min">min</option>
+            <option value="max">max</option>
+            <option value="sum">sum</option>
+            <option value="region_length">region length</option>
+        </param>
+    </xml>
+
+    <xml name="sortRegions">
+        <param argument="--sortRegions" type="select" label="Sort regions"
+            help="Whether the heatmap should present the regions sorted. The default is to sort in descending order based on the mean value per region.">
+            <option value="no">no ordering</option>
+            <option value="descend" selected="true">descending order</option>
+            <option value="ascend">ascending order</option>
+        </param>
+    </xml>
+
+    <xml name="minMappingQuality">
+        <param argument="--minMappingQuality" type="integer" optional="true" value="1" min="1"
+            label="Minimum mapping quality"
+            help= "If set, only reads that have a mapping quality score higher than the given value are considered. *Note* Bowtie's Mapping quality is related to uniqueness: the higher the score, the more unique is a read. A mapping quality defined by Bowtie of 10 or less indicates that there is at least a 1 in 10 chance that the read truly originated elsewhere."/>
+    </xml>
+
+    <xml name="skipZeros">
+        <param argument="--skipZeros" type="boolean" truevalue="--skipZeros" falsevalue=""
+            label ="Skip zeros"
+            help ="If set, then zero counts that happen for *all* BAM files given are ignored. This might have the effect that fewer regions are considered than indicated in the option where the number of samples is defined." />
+    </xml>
+
+    <xml name="fragmentLength">
+        <param argument="--fragmentLength" type="integer" value="300" min="1"
+            label="Fragment length used for the sequencing"
+            help ="If paired-end reads are used, the fragment length is computed from the BAM file."/>
+    </xml>
+
+    <xml name="scaleFactor">
+        <param argument="--scaleFactor" type="float" value="1" label="Scaling factor"
+            help="When used in combination with --normalizeTo1x or
+                --normalizeUsingRPKM, the computed scaling factor will
+                be multiplied by the given scale factor." />
+    </xml>
+
+    <xml name="scaleFactors">
+        <param name="scaleFactor1" type="float" value="1" label="Scale factor for treatment" help="(--scaleFactors)"/>
+        <param name="scaleFactor2" type="float" value="1" label="Scale factor for input" help="(--scaleFactors)"/>
+    </xml>
+
+    <xml name="stdio">
+        <stdio>
+            <exit_code range="1:" />
+            <exit_code range=":-1" />
+            <regex match="Error:" />
+            <regex match="Exception:" />
+            <regex match="EXception:" />
+            <regex match="Traceback" />
+        </stdio>
+    </xml>
+
+    <xml name="pseudocount">
+        <param argument="--pseudocount" type="float" value="1" label="Pseudocount" help="Small number to avoid dividing by zero."/>
+    </xml>
+
+    <token name="@REFERENCES@">
+
+.. class:: infomark
+
+For more information on the tools, please visit our `help site`_.
+
+If you would like to give us feedback or you run into any trouble, please send an email to deeptools@googlegroups.com
+
+This tool is developed by the `Bioinformatics and Deep-Sequencing Unit`_ at the `Max Planck Institute for Immunobiology and Epigenetics`_.
+
+.. _Bioinformatics and Deep-Sequencing Unit: http://www3.ie-freiburg.mpg.de/facilities/research-facilities/bioinformatics-and-deep-sequencing-unit/
+.. _Max Planck Institute for Immunobiology and Epigenetics: http://www3.ie-freiburg.mpg.de
+.. _help site: https://github.com/fidelram/deepTools/wiki/
+
+    </token>
+    <xml name="citations">
+        <citations>
+            <citation type="doi">10.1093/nar/gku365</citation>
+            <yield />
+        </citations>
+    </xml>
+
+    <xml name="multiple_input_bams">
+        <param argument="--bamfiles" type="data" format="bam"
+            label="Bam file" multiple="true"
+            help="The BAM file must be sorted."/>
+    </xml>
+
+    <xml name="multiple_input_bigwigs">
+        <param argument="--bigwigfiles" type="data" format="bigwig" multiple="True"
+            label="Bigwig file" 
+            help="The Bigwig file must be sorted."/>
+    </xml>
+
+    <xml name="plotTitle">
+        <param argument="--plotTitle" type="text" value="" size="30" optional="True"
+            label="Title of the plot"
+            help="Title of the plot, to be printed on top of the generated image." />
+    </xml>
+
+    <token name="@multiple_input_bams@">
+<![CDATA[
+        #set files=[]
+        #set labels=[]
+        #for $counter, $bamfile in enumerate($bamfiles):
+            ln -s "${bamfile}" "./${counter}.bam" &&
+            ln -s "${bamfile.metadata.bam_index}" "./${counter}.bam.bai" &&
+            #silent $files.append('%s.bam' % $counter)
+            #silent $labels.append('%s' % ($bamfile.display_name))
+        #end for
+]]>
+    </token>
+
+    <token name="@multiple_input_bigwigs@">
+<![CDATA[
+        #set files=[]
+        #set labels=[]
+        #for $counter, $bigwig in enumerate($bigwigfiles):
+            ln -s "${bigwig}" "${counter}.bw" &&
+            #silent $files.append('%s.bw' % $counter)
+            #silent $labels.append('%s' % ($bigwig.display_name))
+        #end for
+]]>
+    </token>
+
+    <xml name="reference_genome_source">
+        <conditional name="source">
+            <param name="ref_source" type="select" label="Reference genome">
+                <option value="cached">locally cached</option>
+                <option value="history">in your history</option>
+            </param>
+            <when value="cached">
+                <param name="input1_2bit" type="select" label="Using reference genome" help="If your genome of interest is not listed, contact the Galaxy team">
+                    <options from_data_table="lastz_seqs">
+                        <filter type="sort_by" column="1" />
+                        <validator type="no_options" message="No indexes are available." />
+                    </options>
+                </param>
+            </when>
+            <when value="history">
+                <param name="input1" type="data" format="twobit" label="Select a reference dataset in 2bit format" />
+            </when>
+        </conditional>
+    </xml>
+
+    <token name="@reference_genome_source@">
+    #if $source.ref_source=="history":
+        --genome $source.input1
+    #else:
+        --genome "${source.input1_2bit.fields.path}"
+    #end if
+    </token>
+
+    <xml name="effectiveGenomeSize">
+        <conditional name="effectiveGenomeSize">
+            <param name="effectiveGenomeSize_opt" type="select" label="Effective genome size"
+                help="The effective genome size is the portion of the genome that is mappable. Large fractions of the genome are stretches of NNNN that should be discarded. 
+                    Also, if repetitive regions were not included in the mapping of reads, the effective genome size needs to be adjusted accordingly. 
+                    See Table 2 of http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0030377 or http://www.nature.com/nbt/journal/v27/n1/fig_tab/nbt.1518_T1.html for several effective genome sizes.">
+                <option value="93260000">ce10 (93260000)</option>
+                <option value="121400000">dm3 (121400000)</option>
+                <option value="2451960000" selected="true">hg19 (2451960000)</option>
+                <option value="2150570000">mm9 (2150570000)</option>
+                <option value="specific">user specified</option>
+            </param>
+            <when value="specific">
+                <param argument="--effectiveGenomeSize" type="integer" value="" label="Effective genome size" help="e.g. ce10: 93260000, dm3: 121400000, hg19: 2451960000, mm9: 2150570000"/>
+            </when>
+            <when value="2150570000" />
+            <when value="2451960000" />
+            <when value="121400000" />
+            <when value="93260000" />
+        </conditional>
+    </xml>
+
+    <xml name="image_file_format">
+        <param argument="--outFileFormat" type="select" label="Image file format">
+            <option value="png" selected="true">png</option>
+            <option value="pdf">pdf</option>
+            <option value="svg">svg</option>
+            <option value="eps">eps</option>
+        </param>
+    </xml>
+
+    <xml name="keepNAs">
+        <param argument="--keepNAs" type="boolean" truevalue="--keepNAs" falsevalue="" checked="False"
+            label="Treat missing data as zero"
+            help="If set, missing data (NAs) will be treated as zeros.
+                The default is to ignore missing data and not included
+                in the output file. Missing data is defined as those
+                bins for which no overlapping reads are found." />
+    </xml>
+
+    <xml name="input_save_matrix_values">
+        <param argument="--saveMatrix" type="boolean" label="Save the matrix of values underlying the heatmap"/>
+    </xml>
+
+    <xml name="input_graphic_output_settings">
+        <conditional name="output" >
+            <param name="showOutputSettings" type="select" label="Show advanced output settings" >
+                <option value="no" selected="true">no</option>
+                <option value="yes">yes</option>
+            </param>
+            <when value="no" />
+            <when value="yes">
+                <yield />
+                <param name="saveData" type="boolean" label="Save the data underlying the average profile"/>
+                <param name="saveSortedRegions" type="boolean" label="Save the regions after skipping zeros or min/max threshold values" help="The order of the regions in the file follows the sorting order selected. This is useful, for example, to generate other heatmaps keeping the sorting of the first heatmap."/>
+            </when>
+        </conditional>
+    </xml>
+
+    <xml name="input_image_file_format">
+        <param name="outFileFormat" type="select" label="Image file format">
+            <option value="png" selected="true">png</option>
+            <option value="pdf">pdf</option>
+            <option value="svg">svg</option>
+            <option value="eps">eps</option>
+            <option value="emf">emf</option>
+        </param>
+    </xml>
+
+    <xml name="output_image_file_format">
+        <data format="png" name="outFileName" label="${tool.name} image">
+            <change_format>
+                <when input="output.outFileFormat" value="pdf" format="pdf" />
+                <when input="output.outFileFormat" value="svg" format="svg" />
+                <when input="output.outFileFormat" value="eps" format="eps" />
+                <when input="output.outFileFormat" value="emf" format="emf" />
+            </change_format>
+        </data>
+    </xml>
+
+    <xml name="output_save_matrix_values">
+        <data format="tabular" name="outFileNameMatrix" label="${tool.name} on ${on_string}: Heatmap values">
+            <filter>
+            ((
+                output['showOutputSettings'] == 'yes' and 
+                output['saveMatrix'] is True
+            ))
+            </filter>
+        </data>
+    </xml>
+
+    <xml name="output_graphic_outputs">
+        <data format="tabular" name="outFileNameData" label="${tool.name} on ${on_string}: averages per matrix column">
+            <filter>
+            ((
+                output['showOutputSettings'] == 'yes' and 
+                output['saveData'] is True
+            ))
+            </filter>
+        </data>
+        <data format="bed" name="outFileSortedRegions" label="${tool.name} on ${on_string}: sorted/filtered regions">
+            <filter>
+            ((
+                output['showOutputSettings'] == 'yes' and 
+                output['saveSortedRegions'] is True
+            ))
+            </filter>
+        </data>
+    </xml>
+
+    <xml name="colorMap">
+        <param name="colorMap" type="select" label="Color map to use for the heatmap" help=" Available color map names can be found here: http://www.astro.lsa.umich.edu/~msshin/science/code/matplotlib_cm/">
+            <option value="RdYlBu" selected="true">RdYlBu</option>
+            <option value="Accent">Accent</option>
+            <option value="Spectral">Spectral</option>
+            <option value="Set1">Set1</option>
+            <option value="Set2">Set2</option>
+            <option value="Set3">Set3</option>
+            <option value="Dark2">Dark2</option>
+            <option value="Reds">Reds</option>
+            <option value="Oranges">Oranges</option>
+            <option value="Greens">Greens</option>
+            <option value="Blues">Blues</option>
+            <option value="Greys">Greys</option>
+            <option value="Purples">Purples</option>
+            <option value="Paired">Paired</option>
+            <option value="Pastel1">Pastel1</option>
+            <option value="Pastel2">Pastel2</option>
+            <option value="spring">spring</option>
+            <option value="summer">summer</option>
+            <option value="autumn">autumn</option>
+            <option value="winter">winter</option>
+            <option value="hot">hot</option>
+            <option value="coolwarm">coolwarm</option>
+            <option value="cool">cool</option>
+            <option value="seismic">seismic</option>
+            <option value="terrain">terrain</option>
+            <option value="ocean">ocean</option>
+            <option value="rainbow">rainbow</option>
+            <option value="bone">bone</option>
+            <option value="flag">flag</option>
+            <option value="prism">prism</option>
+            <option value="cubehelix">cubehelix</option>
+            <option value="binary">binary</option>
+            <option value="pink">pink</option>
+            <option value="gray">gray</option>
+            <option value="copper">copper</option>
+            <option value="BrBG">BrBG</option>
+            <option value="BuGn">BuGn</option>
+            <option value="BuPu">BuPu</option>
+            <option value="GnBu">GnBu</option>
+            <option value="OrRd">OrRd</option>
+            <option value="PiYG">PiYG</option>
+            <option value="PRGn">PRGn</option>
+            <option value="PuOr">PuOr</option>
+            <option value="PuRd">PuRd</option>
+            <option value="PuBu">PuBu</option>
+            <option value="RdBu">RdBu</option>
+            <option value="RdGy">RdGy</option>
+            <option value="RdPu">RdPu</option>
+            <option value="YlGn">YlGn</option>
+            <option value="PuBuGn">PuBuGn</option>
+            <option value="RdYlGn">RdYlGn</option>
+            <option value="YlGnBu">YlGnBu</option>
+            <option value="YlOrBr">YlOrBr</option>
+            <option value="YlOrRd">YlOrRd</option>
+            <option value="gist_gray">gist_gray</option>
+            <option value="gist_stern">gist_stern</option>
+            <option value="gist_earth">gist_earth</option>
+            <option value="gist_yarg">gist_yarg</option>
+            <option value="gist_ncar">gist_ncar</option>
+            <option value="gist_rainbow">gist_rainbow</option>
+            <option value="gist_heat">gist_heat</option>
+            <option value="gnuplot">gnuplot</option>
+            <option value="gnuplot2">gnuplot2</option>
+            <option value="CMRmap">CMRmap</option>
+            <option value="bwr">bwr</option>
+            <option value="hsv">hsv</option>
+            <option value="brg">brg</option>
+            <option value="jet">jet</option>
+            <option value="afmhot">afmhot</option>
+            <option value="Accent_r">Accent reversed</option>
+            <option value="Spectral_r">Spectral reversed</option>
+            <option value="Set1_r">Set1 reversed</option>
+            <option value="Set2_r">Set2 reversed</option>
+            <option value="Set3_r">Set3 reversed</option>
+            <option value="Dark2_r">Dark2 reversed</option>
+            <option value="Reds_r">Reds reversed</option>
+            <option value="Oranges_r">Oranges reversed</option>
+            <option value="Greens_r">Greens reversed</option>
+            <option value="Blues_r">Blues reversed</option>
+            <option value="Greys_r">Greys reversed</option>
+            <option value="Purples_r">Purples reversed</option>
+            <option value="Paired_r">Paired reversed</option>
+            <option value="Pastel1_r">Pastel1 reversed</option>
+            <option value="Pastel2_r">Pastel2 reversed</option>
+            <option value="spring_r">spring reversed</option>
+            <option value="summer_r">summer reversed</option>
+            <option value="autumn_r">autumn reversed</option>
+            <option value="winter_r">winter reversed</option>
+            <option value="hot_r">hot reversed</option>
+            <option value="coolwarm_r">coolwarm reversed</option>
+            <option value="cool_r">cool reversed</option>
+            <option value="seismic_r">seismic reversed</option>
+            <option value="terrain_r">terrain reversed</option>
+            <option value="ocean_r">ocean reversed</option>
+            <option value="rainbow_r">rainbow reversed</option>
+            <option value="bone_r">bone reversed</option>
+            <option value="flag_r">flag reversed</option>
+            <option value="prism_r">prism reversed</option>
+            <option value="cubehelix_r">cubehelix reversed</option>
+            <option value="binary_r">binary reversed</option>
+            <option value="pink_r">pink reversed</option>
+            <option value="gray_r">gray reversed</option>
+            <option value="copper_r">copper reversed</option>
+            <option value="BrBG_r">BrBG reversed</option>
+            <option value="BuGn_r">BuGn reversed</option>
+            <option value="BuPu_r">BuPu reversed</option>
+            <option value="GnBu_r">GnBu reversed</option>
+            <option value="OrRd_r">OrRd reversed</option>
+            <option value="PiYG_r">PiYG reversed</option>
+            <option value="PRGn_r">PRGn reversed</option>
+            <option value="PuOr_r">PuOr reversed</option>
+            <option value="PuRd_r">PuRd reversed</option>
+            <option value="PuBu_r">PuBu reversed</option>
+            <option value="RdBu_r">RdBu reversed</option>
+            <option value="RdGy_r">RdGy reversed</option>
+            <option value="RdPu_r">RdPu reversed</option>
+            <option value="YlGn_r">YlGn reversed</option>
+            <option value="PuBuGn_r">PuBuGn reversed</option>
+            <option value="RdYlBu_r">RdYlBu reversed</option>
+            <option value="RdYlGn_r">RdYlGn reversed</option>
+            <option value="YlGnBu_r">YlGnBu reversed</option>
+            <option value="YlOrBr_r">YlOrBr reversed</option>
+            <option value="YlOrRd_r">YlOrRd reversed</option>
+            <option value="gist_gray_r">gist_gray reversed</option>
+            <option value="gist_stern_r">gist_stern reversed</option>
+            <option value="gist_earth_r">gist_earth reversed</option>
+            <option value="gist_yarg_r">gist_yarg reversed</option>
+            <option value="gist_ncar_r">gist_ncar reversed</option>
+            <option value="gist_rainbow_r">gist_rainbow reversed</option>
+            <option value="gist_heat_r">gist_heat reversed</option>
+            <option value="gnuplot_r">gnuplot reversed</option>
+            <option value="gnuplot2_r">gnuplot2 reversed</option>
+            <option value="CMRmap_r">CMRmap reversed</option>
+            <option value="bwr_r">bwr reversed</option>
+            <option value="hsv_r">hsv reversed</option>
+            <option value="brg_r">brg reversed</option>
+            <option value="jet_r">jet reversed</option>
+            <option value="afmhot_r">afmhot reversed</option>
+        </param>
+
+    </xml>
+
+</macros>
diff -r 000000000000 -r af2607db5c89 readme.rst
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/readme.rst	Wed Dec 16 16:37:45 2015 -0500
@@ -0,0 +1,74 @@
+========================
+Galaxy deeptools wrapper
+========================
+
+deepTools are user-friendly tools for the normalization and visualization of 
+deep-sequencing data.
+They address the challenge of visualizing the large amounts of data that are now
+routinely generated from sequencing centers in a meaningful way. 
+To do so, deepTools contain useful routines to process the mapped reads data 
+through removal of duplicates and different filtering options to create coverage
+files in standard bedGraph and bigWig file formats. deepTools allow the creation
+of normalized coverage files or the comparison between two files 
+(for example, treatment and control). Finally, using such normalized and 
+standardized files, multiple visualizations can be created to identify 
+enrichments with functional annotations of the genome. 
+For a gallery of images that can be produced and a description 
+of the tools see our poster_.
+
+.. _poster: http://f1000.com/posters/browse/summary/1094053
+
+deeptools is developed under here:
+
+    https://github.com/fidelram/deepTools
+
+For support, questions, or feature requests contact: deeptools@googlegroups.com
+
+
+============
+Installation
+============
+
+Requirements: python-2.7
+
+Galaxy should be able to automatically install all other dependencies, such as numpy or scipy.
+
+For the best performance we recommend to install blas/lapack/atlas in your environment before
+installing deepTools from the Tool Shed.
+
+
+========
+Citation
+========
+
+deeptools are currently under review. In the meantime please refere to https://github.com/fidelram/deepTools.
+
+
+=======
+History
+=======
+
+ * v1.0:        Initial public release
+ * v1.5.8.2:    Include new citation tag, update version to 1.5.8.2 and change wrapper version
+
+
+Licence (MIT)
+=============
+
+Permission is hereby granted, free of charge, to any person obtaining a copy
+of this software and associated documentation files (the "Software"), to deal
+in the Software without restriction, including without limitation the rights
+to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
+copies of the Software, and to permit persons to whom the Software is
+furnished to do so, subject to the following conditions:
+
+The above copyright notice and this permission notice shall be included in
+all copies or substantial portions of the Software.
+
+THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
+OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
+THE SOFTWARE.
diff -r 000000000000 -r af2607db5c89 repository_dependencies.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/repository_dependencies.xml	Wed Dec 16 16:37:45 2015 -0500
@@ -0,0 +1,4 @@
+<?xml version="1.0"?>
+<repositories>
+    <repository changeset_revision="26e3ae5f74ed" name="data_manager_twobit_builder" owner="devteam" toolshed="https://testtoolshed.g2.bx.psu.edu" />
+</repositories>
diff -r 000000000000 -r af2607db5c89 static/images/QC_GCplots_input.png
Binary file static/images/QC_GCplots_input.png has changed
diff -r 000000000000 -r af2607db5c89 static/images/QC_bamCorrelate_humanSamples.png
Binary file static/images/QC_bamCorrelate_humanSamples.png has changed
diff -r 000000000000 -r af2607db5c89 static/images/QC_fingerprint.png
Binary file static/images/QC_fingerprint.png has changed
diff -r 000000000000 -r af2607db5c89 static/images/flowChart_computeMatrixetc.png
Binary file static/images/flowChart_computeMatrixetc.png has changed
diff -r 000000000000 -r af2607db5c89 static/images/norm_IGVsnapshot_indFiles.png
Binary file static/images/norm_IGVsnapshot_indFiles.png has changed
diff -r 000000000000 -r af2607db5c89 static/images/visual_hm_DmelPolII.png
Binary file static/images/visual_hm_DmelPolII.png has changed
diff -r 000000000000 -r af2607db5c89 static/images/visual_profiler_DmelPolII.png
Binary file static/images/visual_profiler_DmelPolII.png has changed
diff -r 000000000000 -r af2607db5c89 test-data/bamCompare_result1.bg
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bamCompare_result1.bg	Wed Dec 16 16:37:45 2015 -0500
@@ -0,0 +1,1 @@
+chrM	0	16569	1.0
diff -r 000000000000 -r af2607db5c89 test-data/bamCompare_result2.bw
Binary file test-data/bamCompare_result2.bw has changed
diff -r 000000000000 -r af2607db5c89 test-data/bamCorrelate_regions.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bamCorrelate_regions.bed	Wed Dec 16 16:37:45 2015 -0500
@@ -0,0 +1,3 @@
+chrM	1	10
+chrM	5	15
+chrM	10	20
diff -r 000000000000 -r af2607db5c89 test-data/bamCorrelate_result1.npz
Binary file test-data/bamCorrelate_result1.npz has changed
diff -r 000000000000 -r af2607db5c89 test-data/bamCorrelate_result2.npz
Binary file test-data/bamCorrelate_result2.npz has changed
diff -r 000000000000 -r af2607db5c89 test-data/bamCoverage_result1.bw
Binary file test-data/bamCoverage_result1.bw has changed
diff -r 000000000000 -r af2607db5c89 test-data/bamCoverage_result2.bw
Binary file test-data/bamCoverage_result2.bw has changed
diff -r 000000000000 -r af2607db5c89 test-data/bamCoverage_result3.bg
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bamCoverage_result3.bg	Wed Dec 16 16:37:45 2015 -0500
@@ -0,0 +1,8 @@
+chrM	0	10	18498299.57
+chrM	10	200	9768764.94
+chrM	200	210	10184457.07
+chrM	210	220	9976611.00
+chrM	220	230	7690304.31
+chrM	230	240	6027535.81
+chrM	240	250	3325537.00
+chrM	250	16569	623538.2
diff -r 000000000000 -r af2607db5c89 test-data/bamCoverage_result4.bg
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bamCoverage_result4.bg	Wed Dec 16 16:37:45 2015 -0500
@@ -0,0 +1,472 @@
+phiX174	0	10	16038.46
+phiX174	10	20	48115.38
+phiX174	20	70	144346.15
+phiX174	70	80	192461.54
+phiX174	80	90	176423.08
+phiX174	90	100	160384.62
+phiX174	100	120	112269.23
+phiX174	120	140	144346.15
+phiX174	140	150	160384.62
+phiX174	150	160	128307.69
+phiX174	160	170	160384.62
+phiX174	170	180	176423.08
+phiX174	180	200	208500.00
+phiX174	200	210	192461.54
+phiX174	210	220	240576.92
+phiX174	220	230	272653.85
+phiX174	230	240	336807.69
+phiX174	240	250	320769.23
+phiX174	250	260	288692.31
+phiX174	260	270	336807.69
+phiX174	270	280	400961.54
+phiX174	280	300	417000.00
+phiX174	300	310	352846.15
+phiX174	310	320	320769.23
+phiX174	320	330	368884.62
+phiX174	330	340	352846.15
+phiX174	340	350	288692.31
+phiX174	350	360	256615.38
+phiX174	360	370	224538.46
+phiX174	370	380	240576.92
+phiX174	380	390	304730.77
+phiX174	390	400	256615.38
+phiX174	400	410	240576.92
+phiX174	410	420	224538.46
+phiX174	420	450	288692.31
+phiX174	450	460	304730.77
+phiX174	460	470	336807.69
+phiX174	470	490	417000.00
+phiX174	490	510	497192.31
+phiX174	510	520	465115.38
+phiX174	520	530	561346.15
+phiX174	530	540	497192.31
+phiX174	540	550	529269.23
+phiX174	550	560	545307.69
+phiX174	560	570	641538.46
+phiX174	570	580	625500.00
+phiX174	580	590	561346.15
+phiX174	590	600	609461.54
+phiX174	600	610	545307.69
+phiX174	610	630	625500.00
+phiX174	630	640	577384.62
+phiX174	640	650	513230.77
+phiX174	650	660	545307.69
+phiX174	660	670	561346.15
+phiX174	670	680	593423.08
+phiX174	680	690	657576.92
+phiX174	690	700	641538.46
+phiX174	700	710	561346.15
+phiX174	710	730	593423.08
+phiX174	730	740	513230.77
+phiX174	740	760	593423.08
+phiX174	760	770	497192.31
+phiX174	770	780	513230.77
+phiX174	780	790	529269.23
+phiX174	790	800	545307.69
+phiX174	800	810	449076.92
+phiX174	810	820	433038.46
+phiX174	820	830	368884.62
+phiX174	830	840	320769.23
+phiX174	840	850	352846.15
+phiX174	850	860	304730.77
+phiX174	860	870	336807.69
+phiX174	870	880	256615.38
+phiX174	880	890	352846.15
+phiX174	890	900	384923.08
+phiX174	900	910	465115.38
+phiX174	910	920	545307.69
+phiX174	920	930	561346.15
+phiX174	930	940	545307.69
+phiX174	940	950	577384.62
+phiX174	950	960	593423.08
+phiX174	960	970	513230.77
+phiX174	970	980	481153.85
+phiX174	980	990	433038.46
+phiX174	990	1000	417000.00
+phiX174	1000	1010	449076.92
+phiX174	1010	1030	577384.62
+phiX174	1030	1040	753807.69
+phiX174	1040	1050	785884.62
+phiX174	1050	1060	817961.54
+phiX174	1060	1070	866076.92
+phiX174	1070	1080	834000.00
+phiX174	1080	1090	866076.92
+phiX174	1090	1100	769846.15
+phiX174	1100	1110	737769.23
+phiX174	1110	1120	657576.92
+phiX174	1120	1130	641538.46
+phiX174	1130	1140	625500.00
+phiX174	1140	1150	673615.38
+phiX174	1150	1160	625500.00
+phiX174	1160	1170	593423.08
+phiX174	1170	1180	609461.54
+phiX174	1180	1190	577384.62
+phiX174	1190	1200	513230.77
+phiX174	1200	1210	481153.85
+phiX174	1210	1220	561346.15
+phiX174	1220	1230	481153.85
+phiX174	1230	1240	449076.92
+phiX174	1240	1250	352846.15
+phiX174	1250	1260	336807.69
+phiX174	1260	1270	400961.54
+phiX174	1270	1280	352846.15
+phiX174	1280	1290	368884.62
+phiX174	1290	1300	320769.23
+phiX174	1300	1310	384923.08
+phiX174	1310	1320	513230.77
+phiX174	1320	1330	497192.31
+phiX174	1330	1340	513230.77
+phiX174	1340	1350	481153.85
+phiX174	1350	1370	497192.31
+phiX174	1370	1390	465115.38
+phiX174	1390	1400	352846.15
+phiX174	1400	1410	449076.92
+phiX174	1410	1430	481153.85
+phiX174	1430	1450	545307.69
+phiX174	1450	1460	561346.15
+phiX174	1460	1470	577384.62
+phiX174	1470	1480	609461.54
+phiX174	1480	1490	593423.08
+phiX174	1490	1500	545307.69
+phiX174	1500	1510	657576.92
+phiX174	1510	1520	625500.00
+phiX174	1520	1540	785884.62
+phiX174	1540	1550	721730.77
+phiX174	1550	1570	753807.69
+phiX174	1570	1580	769846.15
+phiX174	1580	1590	673615.38
+phiX174	1590	1600	625500.00
+phiX174	1600	1610	561346.15
+phiX174	1610	1620	529269.23
+phiX174	1620	1630	497192.31
+phiX174	1630	1640	465115.38
+phiX174	1640	1650	481153.85
+phiX174	1650	1660	497192.31
+phiX174	1660	1670	529269.23
+phiX174	1670	1680	593423.08
+phiX174	1680	1690	513230.77
+phiX174	1690	1700	529269.23
+phiX174	1700	1710	593423.08
+phiX174	1710	1720	545307.69
+phiX174	1720	1730	529269.23
+phiX174	1730	1740	577384.62
+phiX174	1740	1750	529269.23
+phiX174	1750	1760	433038.46
+phiX174	1760	1770	417000.00
+phiX174	1770	1780	368884.62
+phiX174	1780	1790	352846.15
+phiX174	1790	1810	336807.69
+phiX174	1810	1820	320769.23
+phiX174	1820	1830	465115.38
+phiX174	1830	1860	705692.31
+phiX174	1860	1870	801923.08
+phiX174	1870	1880	737769.23
+phiX174	1880	1890	673615.38
+phiX174	1890	1900	705692.31
+phiX174	1900	1910	609461.54
+phiX174	1910	1920	400961.54
+phiX174	1920	1930	465115.38
+phiX174	1930	1940	545307.69
+phiX174	1940	1950	449076.92
+phiX174	1950	1960	481153.85
+phiX174	1960	1970	529269.23
+phiX174	1970	1980	673615.38
+phiX174	1980	1990	641538.46
+phiX174	1990	2000	657576.92
+phiX174	2000	2010	673615.38
+phiX174	2010	2020	641538.46
+phiX174	2020	2030	657576.92
+phiX174	2030	2050	673615.38
+phiX174	2050	2060	481153.85
+phiX174	2060	2070	513230.77
+phiX174	2070	2080	481153.85
+phiX174	2080	2100	513230.77
+phiX174	2100	2110	529269.23
+phiX174	2110	2120	513230.77
+phiX174	2120	2130	529269.23
+phiX174	2130	2140	545307.69
+phiX174	2140	2150	513230.77
+phiX174	2150	2160	545307.69
+phiX174	2160	2170	417000.00
+phiX174	2170	2180	352846.15
+phiX174	2180	2190	433038.46
+phiX174	2190	2200	449076.92
+phiX174	2200	2210	433038.46
+phiX174	2210	2220	481153.85
+phiX174	2220	2230	545307.69
+phiX174	2230	2240	593423.08
+phiX174	2240	2250	625500.00
+phiX174	2250	2260	721730.77
+phiX174	2260	2270	625500.00
+phiX174	2270	2290	593423.08
+phiX174	2290	2300	609461.54
+phiX174	2300	2310	737769.23
+phiX174	2310	2320	769846.15
+phiX174	2320	2330	866076.92
+phiX174	2330	2340	850038.46
+phiX174	2340	2350	898153.85
+phiX174	2350	2360	801923.08
+phiX174	2360	2370	914192.31
+phiX174	2370	2380	801923.08
+phiX174	2380	2390	641538.46
+phiX174	2390	2400	593423.08
+phiX174	2400	2410	417000.00
+phiX174	2410	2420	400961.54
+phiX174	2420	2430	352846.15
+phiX174	2430	2440	481153.85
+phiX174	2440	2450	449076.92
+phiX174	2450	2460	609461.54
+phiX174	2460	2470	673615.38
+phiX174	2470	2480	737769.23
+phiX174	2480	2490	753807.69
+phiX174	2490	2500	769846.15
+phiX174	2500	2510	785884.62
+phiX174	2510	2520	641538.46
+phiX174	2520	2530	657576.92
+phiX174	2530	2540	529269.23
+phiX174	2540	2550	465115.38
+phiX174	2550	2560	384923.08
+phiX174	2560	2570	433038.46
+phiX174	2570	2590	465115.38
+phiX174	2590	2600	449076.92
+phiX174	2600	2620	529269.23
+phiX174	2620	2630	545307.69
+phiX174	2630	2640	689653.85
+phiX174	2640	2650	625500.00
+phiX174	2650	2660	561346.15
+phiX174	2660	2670	545307.69
+phiX174	2670	2680	609461.54
+phiX174	2680	2700	657576.92
+phiX174	2700	2710	625500.00
+phiX174	2710	2720	593423.08
+phiX174	2720	2740	657576.92
+phiX174	2740	2750	817961.54
+phiX174	2750	2760	866076.92
+phiX174	2760	2770	850038.46
+phiX174	2770	2780	882115.38
+phiX174	2780	2790	962307.69
+phiX174	2790	2800	817961.54
+phiX174	2800	2810	834000.00
+phiX174	2810	2820	801923.08
+phiX174	2820	2830	673615.38
+phiX174	2830	2840	705692.31
+phiX174	2840	2860	625500.00
+phiX174	2860	2870	609461.54
+phiX174	2870	2880	705692.31
+phiX174	2880	2890	657576.92
+phiX174	2890	2900	609461.54
+phiX174	2900	2910	657576.92
+phiX174	2910	2930	561346.15
+phiX174	2930	2940	513230.77
+phiX174	2940	2950	561346.15
+phiX174	2950	2960	497192.31
+phiX174	2960	2970	577384.62
+phiX174	2970	2980	593423.08
+phiX174	2980	2990	513230.77
+phiX174	2990	3000	529269.23
+phiX174	3000	3010	561346.15
+phiX174	3010	3020	513230.77
+phiX174	3020	3030	465115.38
+phiX174	3030	3040	433038.46
+phiX174	3040	3050	417000.00
+phiX174	3050	3060	545307.69
+phiX174	3060	3070	561346.15
+phiX174	3070	3080	625500.00
+phiX174	3080	3100	577384.62
+phiX174	3100	3110	721730.77
+phiX174	3110	3120	673615.38
+phiX174	3120	3130	641538.46
+phiX174	3130	3140	609461.54
+phiX174	3140	3160	673615.38
+phiX174	3160	3180	769846.15
+phiX174	3180	3190	705692.31
+phiX174	3190	3200	657576.92
+phiX174	3200	3210	673615.38
+phiX174	3210	3220	737769.23
+phiX174	3220	3230	657576.92
+phiX174	3230	3240	705692.31
+phiX174	3240	3250	625500.00
+phiX174	3250	3260	545307.69
+phiX174	3260	3270	593423.08
+phiX174	3270	3280	625500.00
+phiX174	3280	3290	577384.62
+phiX174	3290	3300	529269.23
+phiX174	3300	3310	513230.77
+phiX174	3310	3320	529269.23
+phiX174	3320	3330	609461.54
+phiX174	3330	3340	657576.92
+phiX174	3340	3370	641538.46
+phiX174	3370	3390	657576.92
+phiX174	3390	3400	577384.62
+phiX174	3400	3430	481153.85
+phiX174	3430	3440	513230.77
+phiX174	3440	3450	609461.54
+phiX174	3450	3460	577384.62
+phiX174	3460	3480	673615.38
+phiX174	3480	3490	721730.77
+phiX174	3490	3500	834000.00
+phiX174	3500	3510	801923.08
+phiX174	3510	3520	898153.85
+phiX174	3520	3530	769846.15
+phiX174	3530	3540	753807.69
+phiX174	3540	3550	785884.62
+phiX174	3550	3560	753807.69
+phiX174	3560	3570	689653.85
+phiX174	3570	3580	497192.31
+phiX174	3580	3590	465115.38
+phiX174	3590	3610	433038.46
+phiX174	3610	3620	417000.00
+phiX174	3620	3630	400961.54
+phiX174	3630	3640	384923.08
+phiX174	3640	3650	352846.15
+phiX174	3650	3660	433038.46
+phiX174	3660	3680	400961.54
+phiX174	3680	3690	417000.00
+phiX174	3690	3700	336807.69
+phiX174	3700	3710	384923.08
+phiX174	3710	3720	433038.46
+phiX174	3720	3730	625500.00
+phiX174	3730	3740	593423.08
+phiX174	3740	3750	705692.31
+phiX174	3750	3760	673615.38
+phiX174	3760	3780	657576.92
+phiX174	3780	3790	625500.00
+phiX174	3790	3800	497192.31
+phiX174	3800	3810	417000.00
+phiX174	3810	3820	449076.92
+phiX174	3820	3830	433038.46
+phiX174	3830	3840	545307.69
+phiX174	3840	3850	625500.00
+phiX174	3850	3860	769846.15
+phiX174	3860	3870	801923.08
+phiX174	3870	3880	769846.15
+phiX174	3880	3890	721730.77
+phiX174	3890	3900	673615.38
+phiX174	3900	3910	641538.46
+phiX174	3910	3920	593423.08
+phiX174	3920	3930	449076.92
+phiX174	3930	3950	400961.54
+phiX174	3950	3960	433038.46
+phiX174	3960	3970	529269.23
+phiX174	3970	3980	593423.08
+phiX174	3980	3990	561346.15
+phiX174	3990	4000	641538.46
+phiX174	4000	4010	625500.00
+phiX174	4010	4020	609461.54
+phiX174	4020	4030	641538.46
+phiX174	4030	4040	657576.92
+phiX174	4040	4050	545307.69
+phiX174	4050	4060	481153.85
+phiX174	4060	4070	449076.92
+phiX174	4070	4080	400961.54
+phiX174	4080	4090	433038.46
+phiX174	4090	4100	529269.23
+phiX174	4100	4110	400961.54
+phiX174	4110	4120	368884.62
+phiX174	4120	4130	304730.77
+phiX174	4130	4150	368884.62
+phiX174	4150	4160	336807.69
+phiX174	4160	4170	384923.08
+phiX174	4170	4180	272653.85
+phiX174	4180	4190	336807.69
+phiX174	4190	4200	352846.15
+phiX174	4200	4210	368884.62
+phiX174	4210	4230	320769.23
+phiX174	4230	4250	336807.69
+phiX174	4250	4260	384923.08
+phiX174	4260	4280	481153.85
+phiX174	4280	4290	449076.92
+phiX174	4290	4300	465115.38
+phiX174	4300	4310	529269.23
+phiX174	4310	4320	609461.54
+phiX174	4320	4330	577384.62
+phiX174	4330	4340	465115.38
+phiX174	4340	4350	417000.00
+phiX174	4350	4360	433038.46
+phiX174	4360	4380	513230.77
+phiX174	4380	4390	481153.85
+phiX174	4390	4400	449076.92
+phiX174	4400	4410	529269.23
+phiX174	4410	4420	657576.92
+phiX174	4420	4430	705692.31
+phiX174	4430	4440	785884.62
+phiX174	4440	4450	817961.54
+phiX174	4450	4460	801923.08
+phiX174	4460	4470	769846.15
+phiX174	4470	4480	882115.38
+phiX174	4480	4490	689653.85
+phiX174	4490	4500	625500.00
+phiX174	4500	4510	609461.54
+phiX174	4510	4520	465115.38
+phiX174	4520	4540	433038.46
+phiX174	4540	4550	497192.31
+phiX174	4550	4560	481153.85
+phiX174	4560	4570	433038.46
+phiX174	4570	4580	465115.38
+phiX174	4580	4590	417000.00
+phiX174	4590	4600	433038.46
+phiX174	4600	4610	529269.23
+phiX174	4610	4620	513230.77
+phiX174	4620	4630	577384.62
+phiX174	4630	4640	609461.54
+phiX174	4640	4660	689653.85
+phiX174	4660	4670	721730.77
+phiX174	4670	4680	673615.38
+phiX174	4680	4690	609461.54
+phiX174	4690	4700	689653.85
+phiX174	4700	4720	481153.85
+phiX174	4720	4730	400961.54
+phiX174	4730	4740	465115.38
+phiX174	4740	4760	561346.15
+phiX174	4760	4780	593423.08
+phiX174	4780	4790	609461.54
+phiX174	4790	4800	689653.85
+phiX174	4800	4810	673615.38
+phiX174	4810	4820	657576.92
+phiX174	4820	4830	593423.08
+phiX174	4830	4850	625500.00
+phiX174	4850	4860	577384.62
+phiX174	4860	4870	513230.77
+phiX174	4870	4880	497192.31
+phiX174	4880	4890	593423.08
+phiX174	4890	4900	513230.77
+phiX174	4900	4910	481153.85
+phiX174	4910	4920	417000.00
+phiX174	4920	4930	384923.08
+phiX174	4930	4950	352846.15
+phiX174	4950	4960	272653.85
+phiX174	4960	4970	176423.08
+phiX174	4970	4980	240576.92
+phiX174	4980	4990	208500.00
+phiX174	4990	5020	288692.31
+phiX174	5020	5030	352846.15
+phiX174	5030	5040	336807.69
+phiX174	5040	5050	368884.62
+phiX174	5050	5060	304730.77
+phiX174	5060	5070	288692.31
+phiX174	5070	5080	240576.92
+phiX174	5080	5090	304730.77
+phiX174	5090	5100	272653.85
+phiX174	5100	5110	224538.46
+phiX174	5110	5120	256615.38
+phiX174	5120	5130	320769.23
+phiX174	5130	5140	417000.00
+phiX174	5140	5160	497192.31
+phiX174	5160	5170	481153.85
+phiX174	5170	5180	577384.62
+phiX174	5180	5190	561346.15
+phiX174	5190	5200	529269.23
+phiX174	5200	5210	465115.38
+phiX174	5210	5220	449076.92
+phiX174	5220	5230	400961.54
+phiX174	5230	5240	449076.92
+phiX174	5240	5250	368884.62
+phiX174	5250	5260	272653.85
+phiX174	5260	5270	304730.77
+phiX174	5270	5280	336807.69
+phiX174	5280	5290	272653.85
+phiX174	5290	5300	192461.54
+phiX174	5300	5310	144346.15
+phiX174	5310	5340	96230.77
+phiX174	5340	5350	64153.85
+phiX174	5350	5386	32076.9
diff -r 000000000000 -r af2607db5c89 test-data/bamCoverage_result4.bw
Binary file test-data/bamCoverage_result4.bw has changed
diff -r 000000000000 -r af2607db5c89 test-data/bamFingerprint_result1.png
Binary file test-data/bamFingerprint_result1.png has changed
diff -r 000000000000 -r af2607db5c89 test-data/bamFingerprint_result2.png
Binary file test-data/bamFingerprint_result2.png has changed
diff -r 000000000000 -r af2607db5c89 test-data/bamFingerprint_result2.tabular
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bamFingerprint_result2.tabular	Wed Dec 16 16:37:45 2015 -0500
@@ -0,0 +1,16071 @@
+'bowtie2-test1.bam'	'bowtie2-test1.bam'
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+35	35
+33	33
+33	33
+33	33
+33	33
+33	33
+33	33
+33	33
+33	33
+33	33
+33	33
+33	33
+33	33
+27	27
+25	25
+24	24
+21	21
+20	20
+19	19
+19	19
+19	19
+17	17
+17	17
+15	15
+15	15
+15	15
+10	10
+6	6
+5	5
+5	5
+5	5
+5	5
+5	5
+5	5
+5	5
+3	3
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
+0	0
diff -r 000000000000 -r af2607db5c89 test-data/bamPEFragmentSize_histogram_result1.png
Binary file test-data/bamPEFragmentSize_histogram_result1.png has changed
diff -r 000000000000 -r af2607db5c89 test-data/bamPEFragmentSize_result1.txt
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bamPEFragmentSize_result1.txt	Wed Dec 16 16:37:45 2015 -0500
@@ -0,0 +1,20 @@
+Sample size: 3
+
+
+Fragment lengths:
+Min.: 241
+1st Qu.: 241.5
+Mean: 244.666666667
+Median: 242.0
+3rd Qu.: 246.5
+Max.: 251
+Std: 4.49691252108
+
+Read lengths:
+Min.: 251
+1st Qu.: 251.0
+Mean: 251.0
+Median: 251.0
+3rd Qu.: 251.0
+Max.: 251
+Std: 0.0
diff -r 000000000000 -r af2607db5c89 test-data/bigwigCompare_result1.bw
Binary file test-data/bigwigCompare_result1.bw has changed
diff -r 000000000000 -r af2607db5c89 test-data/bigwigCompare_result2.bg
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bigwigCompare_result2.bg	Wed Dec 16 16:37:45 2015 -0500
@@ -0,0 +1,3 @@
+ch1	0	400	1.0
+ch2	0	400	1.0
+ch3	0	400	1.0
diff -r 000000000000 -r af2607db5c89 test-data/bigwigCorrelate_result1.npz
Binary file test-data/bigwigCorrelate_result1.npz has changed
diff -r 000000000000 -r af2607db5c89 test-data/bigwigCorrelate_result1.png
Binary file test-data/bigwigCorrelate_result1.png has changed
diff -r 000000000000 -r af2607db5c89 test-data/bowtie2-test1.bam
Binary file test-data/bowtie2-test1.bam has changed
diff -r 000000000000 -r af2607db5c89 test-data/computeGCBias_result1.png
Binary file test-data/computeGCBias_result1.png has changed
diff -r 000000000000 -r af2607db5c89 test-data/computeGCBias_result1.tabular
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/computeGCBias_result1.tabular	Wed Dec 16 16:37:45 2015 -0500
@@ -0,0 +1,301 @@
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
diff -r 000000000000 -r af2607db5c89 test-data/computeMatrix1.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/computeMatrix1.bed	Wed Dec 16 16:37:45 2015 -0500
@@ -0,0 +1,8 @@
+phiX174	1000	1500	CG11023	0	+
+phiX174	150	1750	cda5	0	-
+phiX174	150	177	cda8	0	-
+phiX174	75	1500	cda9	0	+
+phiX174	101	175	C11023	0	+
+phiX174	125	150	ca5	0	-
+phiX174	450	1750	ca8	0	+
+phiX174	80	1500	cda9	0	+
diff -r 000000000000 -r af2607db5c89 test-data/computeMatrix2.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/computeMatrix2.bed	Wed Dec 16 16:37:45 2015 -0500
@@ -0,0 +1,6 @@
+ch1	100	150	CG11023	0	+
+ch2	150	175	cda5	0	-
+ch3	100	125	cda8	0	+
+ch1	75	125	C11023	0	+
+ch2	125	150	ca5	0	-
+ch3	75	100	ca8	0	+
diff -r 000000000000 -r af2607db5c89 test-data/computeMatrix2.bw
Binary file test-data/computeMatrix2.bw has changed
diff -r 000000000000 -r af2607db5c89 test-data/computeMatrix_result1.gz
Binary file test-data/computeMatrix_result1.gz has changed
diff -r 000000000000 -r af2607db5c89 test-data/computeMatrix_result2.gz
Binary file test-data/computeMatrix_result2.gz has changed
diff -r 000000000000 -r af2607db5c89 test-data/computeMatrix_result3.gz
Binary file test-data/computeMatrix_result3.gz has changed
diff -r 000000000000 -r af2607db5c89 test-data/correctGCBias_result1.bam
Binary file test-data/correctGCBias_result1.bam has changed
diff -r 000000000000 -r af2607db5c89 test-data/heatmapper_result1.png
Binary file test-data/heatmapper_result1.png has changed
diff -r 000000000000 -r af2607db5c89 test-data/heatmapper_result2.png
Binary file test-data/heatmapper_result2.png has changed
diff -r 000000000000 -r af2607db5c89 test-data/paired_chr2L.bam
Binary file test-data/paired_chr2L.bam has changed
diff -r 000000000000 -r af2607db5c89 test-data/phiX.2bit
Binary file test-data/phiX.2bit has changed
diff -r 000000000000 -r af2607db5c89 test-data/phiX.bam
Binary file test-data/phiX.bam has changed
diff -r 000000000000 -r af2607db5c89 test-data/phiX.bam.bai
Binary file test-data/phiX.bam.bai has changed
diff -r 000000000000 -r af2607db5c89 test-data/phiX.fasta
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/phiX.fasta	Wed Dec 16 16:37:45 2015 -0500
@@ -0,0 +1,79 @@
+>phiX174
+GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT
+GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA
+ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG
+TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA
+GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC
+TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT
+TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT
+CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT
+TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG
+TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC
+GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA
+CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG
+TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT
+AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC
+CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA
+TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC
+TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA
+CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA
+GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT
+GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA
+ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC
+TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT
+TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC
+ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC
+CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT
+GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC
+CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC
+TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG
+TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT
+TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA
+AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT
+TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT
+ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC
+GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC
+TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT
+TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA
+TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG
+TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC
+CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG
+AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC
+CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT
+TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG
+CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA
+AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT
+GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG
+GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA
+TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT
+CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG
+TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA
+GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC
+CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA
+TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA
+AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC
+TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT
+CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA
+TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG
+TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT
+CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT
+TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC
+ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG
+TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA
+ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG
+GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC
+CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT
+GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG
+GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT
+ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG
+CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC
+CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC
+GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT
+CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG
+CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA
+TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT
+TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG
+TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC
+AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC
+TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA
+
diff -r 000000000000 -r af2607db5c89 test-data/plotCorrelation_result1.png
Binary file test-data/plotCorrelation_result1.png has changed
diff -r 000000000000 -r af2607db5c89 test-data/plotCorrelation_result1.tabular
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/plotCorrelation_result1.tabular	Wed Dec 16 16:37:45 2015 -0500
@@ -0,0 +1,3 @@
+	'bowtie2-test1.bam'	'bowtie2-test1.bam'
+'bowtie2-test1.bam'	1.0000	1.0000
+'bowtie2-test1.bam'	1.0000	1.0000
diff -r 000000000000 -r af2607db5c89 test-data/plotCorrelation_result2.png
Binary file test-data/plotCorrelation_result2.png has changed
diff -r 000000000000 -r af2607db5c89 test-data/plotPCA_result1.png
Binary file test-data/plotPCA_result1.png has changed
diff -r 000000000000 -r af2607db5c89 test-data/profiler_result1.png
Binary file test-data/profiler_result1.png has changed
diff -r 000000000000 -r af2607db5c89 test-data/profiler_result2.png
Binary file test-data/profiler_result2.png has changed
diff -r 000000000000 -r af2607db5c89 test-data/sequence.2bit
Binary file test-data/sequence.2bit has changed
diff -r 000000000000 -r af2607db5c89 test-data/test.bw
Binary file test-data/test.bw has changed
diff -r 000000000000 -r af2607db5c89 tool-data/deepTools_seqs.loc.sample
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/deepTools_seqs.loc.sample	Wed Dec 16 16:37:45 2015 -0500
@@ -0,0 +1,27 @@
+#This is a sample file distributed with Galaxy that enables tools
+#to use a directory of 2bit genome files for use with deepTools. You will
+#need to supply these files and then create a deepTools_seqs.loc file
+#similar to this one (store it in this directory) that points to
+#the directories in which those files are stored. The deepTools_seqs.loc
+#file has this format:
+#
+#<unique_build_id>	<display_name>	<file_path>
+#
+#So, for example, if your deepTools_seqs.loc began like this:
+#
+#hg18	Human (Homo sapiens): hg18	/depot/data2/galaxy/twobit/hg18.2bit
+#hg19	Human (Homo sapiens): hg19	/depot/data2/galaxy/twobit/hg19.2bit
+#mm9	Mouse (Mus musculus): mm9	/depot/data2/galaxy/twobit/mm9.2bit
+#
+#then your /depot/data2/galaxy/twobit/ directory
+#would need to contain the following 2bit files:
+#
+#-rw-r--r--  1 james    universe 830134 2005-09-13 10:12 hg18.2bit
+#-rw-r--r--  1 james    universe 527388 2005-09-13 10:12 hg19.2bit
+#-rw-r--r--  1 james    universe 269808 2005-09-13 10:12 mm9.2bit
+#
+#Your deepTools_seqs.loc file should include an entry per line for 
+#each file you have stored that you want to be available. Note that 
+#your files should all have the extension '2bit'.
+#
+#Please note that the <unique_build_id> is also used as "Species name abbreviation".
diff -r 000000000000 -r af2607db5c89 tool-data/lastz_seqs.loc.sample
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/lastz_seqs.loc.sample	Wed Dec 16 16:37:45 2015 -0500
@@ -0,0 +1,29 @@
+#This is a sample file distributed with Galaxy that enables tools
+#to use a directory of 2bit genome files for use with deepTools. 
+#This file is named lastz_seqs.loc file to make use of an already existing loc
+#file from the lastz tool that is created by the twobit data-manager.
+#You will need to supply these files and then create a lastz_seqs.loc file
+#similar to this one (store it in this directory) that points to
+#the directories in which those files are stored. The lastz_seqs.loc
+#file has this format:
+#
+#<unique_build_id>	<display_name>	<file_path>
+#
+#So, for example, if your lastz_seqs.loc began like this:
+#
+#hg18	Human (Homo sapiens): hg18	/depot/data2/galaxy/twobit/hg18.2bit
+#hg19	Human (Homo sapiens): hg19	/depot/data2/galaxy/twobit/hg19.2bit
+#mm9	Mouse (Mus musculus): mm9	/depot/data2/galaxy/twobit/mm9.2bit
+#
+#then your /depot/data2/galaxy/twobit/ directory
+#would need to contain the following 2bit files:
+#
+#-rw-r--r--  1 james    universe 830134 2005-09-13 10:12 hg18.2bit
+#-rw-r--r--  1 james    universe 527388 2005-09-13 10:12 hg19.2bit
+#-rw-r--r--  1 james    universe 269808 2005-09-13 10:12 mm9.2bit
+#
+#Your lastz_seqs.loc file should include an entry per line for 
+#each file you have stored that you want to be available. Note that 
+#your files should all have the extension '2bit'.
+#
+#Please note that the <unique_build_id> is also used as "Species name abbreviation".
diff -r 000000000000 -r af2607db5c89 tool_data_table_conf.xml.sample
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml.sample	Wed Dec 16 16:37:45 2015 -0500
@@ -0,0 +1,8 @@
+<!-- Use the file tool_data_table_conf.xml.oldlocstyle if you don't want to update your loc files as changed in revision 4550:535d276c92bc-->
+<tables>
+    <!-- Locations of 2bit sequence files for use in Lastz -->
+    <table name="lastz_seqs" comment_char="#">
+        <columns>value, name, path</columns>
+        <file path="tool-data/lastz_seqs.loc" />
+    </table>
+</tables>
diff -r 000000000000 -r af2607db5c89 tool_dependencies.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_dependencies.xml	Wed Dec 16 16:37:45 2015 -0500
@@ -0,0 +1,9 @@
+<?xml version="1.0"?>
+<tool_dependency>
+    <package name="python" version="2.7.10">
+        <repository changeset_revision="a28e3c30828d" name="package_python_2_7_10" owner="iuc" toolshed="https://testtoolshed.g2.bx.psu.edu" />
+    </package>
+    <package name="deepTools" version="2.0">
+        <repository changeset_revision="747571992679" name="package_python_2_7_deeptools_2_0" owner="iuc" toolshed="https://testtoolshed.g2.bx.psu.edu" />
+    </package>
+</tool_dependency>