# HG changeset patch
# User bgruening
# Date 1684849363 0
# Node ID cffa21bb7a9287759e7c32667a5d6767046ed4b5
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/agat commit 0851e9e6d46223a8233c56f3b0bcf14e19d63916
diff -r 000000000000 -r cffa21bb7a92 agat.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/agat.xml Tue May 23 13:42:43 2023 +0000
@@ -0,0 +1,374 @@
+
+ GTF/GFF analysis toolkit
+
+ macros.xml
+
+
+
+ agat_sq_stat_basic.pl --version
+ '${annotation_gff}'
+ #else if $tool.selector == 'convert_GFF2GTF'
+ @input_annotation_single@
+ agat_convert_sp_gff2gtf.pl --gff $input_annotation --gtf_version $tool.gtf_version --output 'output.gtf' &&
+ cat 'output.gtf' > '${annotation_gtf}'
+ #else if $tool.selector == 'convert_GTF2GFF'
+ @input_annotation_single@
+ agat_convert_sp_gxf2gxf.pl --gff $input_annotation --output 'output.gff' &&
+ cat 'output.gff' > '${annotation_gff}'
+ #else if $tool.selector == 'compare'
+ @input_annotation_double@
+ agat_sp_compare_two_annotations.pl --gff1 $input1 --gff2 $input2 --output 'temp_output' &&
+ cat 'temp_output' > '${stats_output}'
+ #else if $tool.selector == 'extract'
+ @input_annotation_single@
+ @input_reference@
+ agat_sp_extract_sequences.pl
+ --gff $input_annotation
+ -f $ref_genome
+ $tool.mrna
+ $tool.cdna
+ $tool.clean_final_stop
+ $tool.clean_internal_stop
+ #if $tool.downstream
+ --downstream $tool.downstream
+ #end if
+ $tool.full
+ $tool.keep_attributes
+ $tool.keep_parent_attributes
+ $tool.merge
+ $tool.plus_strand_only
+ $tool.protein
+ $tool.remove_orf_offset
+ $tool.revcomp
+ $tool.split
+ #if $tool.type
+ --type $tool.type
+ #end if
+ #if $tool.upstream
+ --upstream $tool.upstream
+ #end if
+ --output '${sequence_output}'
+ #else if $tool.selector == 'functional_analysis'
+ @input_annotation_single@
+ @input_reference@
+ mkdir -p './statistics' &&
+ agat_sp_statistics.pl
+ --gff $input_annotation
+ --gs $ref_genome
+ --output 'temp_output' &&
+ cat 'temp_output' > '$stats_output'
+ #else if $tool.selector == 'merge_annotations'
+ @input_annotation_double@
+ agat_sp_merge_annotations.pl -gff $input1 --gff $input2 --output 'temp_output' &&
+ cat 'temp_output' > '${annotation_gff}'
+ #else if $tool.selector == 'annotation_statistics'
+ @input_annotation_single@
+ @input_reference@
+ agat_sp_statistics.pl --gff $input_annotation --gs $ref_genome -d --output 'temp_output' &&
+ cat 'temp_output' > '$stats_output'
+ #else if $tool.selector == 'filter_feature_fasta'
+ @input_annotation_single@
+ @input_reference@
+ agat_sq_filter_feature_from_fasta.pl --gff $input_annotation --fasta $ref_genome --output 'temp_output' &&
+ cat 'temp_output' > '${features_filtered}'
+ #else if $tool.selector == 'complement'
+ @input_annotation_double@
+ agat_sp_complement_annotations.pl --ref $input1 --add $input2 --size_min $tool.size_min --output 'temp_output' &&
+ cat 'temp_output' > '${annotation_gff}'
+ #end if
+ ]]>
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+ tool['selector'] not in ['annotation_statistics','extract','functional_analysis','compare','convert_GFF2GTF','filter_feature_fasta']
+
+
+ tool['selector'] == 'convert_GFF2GTF'
+
+
+ tool['selector'] == 'filter_feature_fasta'
+
+
+ tool['selector'] =='extract'
+
+
+ tool['selector'] in ['annotation_statistics','compare','functional_analysis']
+
+
+
+ tool['selector'] == 'annotation_statistics'
+
+
+
+ tool['selector'] == 'annotation_statistics'
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
diff -r 000000000000 -r cffa21bb7a92 macros.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/macros.xml Tue May 23 13:42:43 2023 +0000
@@ -0,0 +1,63 @@
+
+ 1.1.0
+ 0
+
+
+ agat
+ perl-statistics-r
+
+
+
+
+ agat
+
+
+
+
+ 10.5281/zenodo.3552717
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
diff -r 000000000000 -r cffa21bb7a92 test-data/annotation.gtf
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/annotation.gtf Tue May 23 13:42:43 2023 +0000
@@ -0,0 +1,1522 @@
+##gtf-version 3
+#!gff-spec-version 1.21
+#!processor NCBI annotwriter
+#!genome-build ASM301845v1
+#!genome-build-accession NCBI_Assembly:GCF_003018455.1
+#!annotation-date 05/25/2022 04:54:31
+#!annotation-source NCBI RefSeq
+##sequence-region NZ_CP027599.1 1 5942969
+##species https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=562
+NZ_CP027601.1 RefSeq gene 1 542 . - . gene_id "nbis-pseudogene-254"; ID "nbis-pseudogene-254"; Name "C7A06_RS33350"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33350"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "1";
+NZ_CP027601.1 RefSeq transcript 1 542 . - . gene_id "nbis-pseudogene-254"; transcript_id "gene-C7A06_RS33350"; ID "gene-C7A06_RS33350"; Name "C7A06_RS33350"; Parent "nbis-pseudogene-254"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33350"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "1";
+NZ_CP027601.1 Protein Homology exon 1 542 . - . gene_id "nbis-pseudogene-254"; transcript_id "gene-C7A06_RS33350"; ID "nbis-exon-5902"; Note "frameshifted; incomplete; missing C-terminus"; Parent "gene-C7A06_RS33350"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001066419.1"; locus_tag "C7A06_RS33350"; partial "true"; product "IS66 family transposase zinc-finger binding domain-containing protein"; pseudo "true"; start_range "." "1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 1 542 . - 0 gene_id "nbis-pseudogene-254"; transcript_id "gene-C7A06_RS33350"; ID "cds-C7A06_RS33350"; Note "frameshifted; incomplete; missing C-terminus"; Parent "gene-C7A06_RS33350"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001066419.1"; locus_tag "C7A06_RS33350"; partial "true"; product "IS66 family transposase zinc-finger binding domain-containing protein"; pseudo "true"; start_range "." "1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 562 909 . - . gene_id "nbis-gene-5648"; ID "nbis-gene-5648"; Name "tnpB"; gbkey "Gene"; gene "tnpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33355";
+NZ_CP027601.1 RefSeq transcript 562 909 . - . gene_id "nbis-gene-5648"; transcript_id "gene-C7A06_RS33355"; ID "gene-C7A06_RS33355"; Name "tnpB"; Parent "nbis-gene-5648"; gbkey "Gene"; gene "tnpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33355"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 562 909 . - . gene_id "nbis-gene-5648"; transcript_id "gene-C7A06_RS33355"; Dbxref "Genbank:WP_000631725.1"; ID "nbis-exon-5903"; Name "WP_000631725.1"; Note "TnpB, as the term is used for proteins encoded by IS66 family insertion elements, is considered an accessory protein, since TnpC, encoded by a neighboring gene, is a DDE family transposase."; Parent "gene-C7A06_RS33355"; gbkey "CDS"; gene "tnpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858152.1"; locus_tag "C7A06_RS33355"; product "IS66 family insertion sequence element accessory protein TnpB"; protein_id "WP_000631725.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 562 909 . - 0 gene_id "nbis-gene-5648"; transcript_id "gene-C7A06_RS33355"; Dbxref "Genbank:WP_000631725.1"; ID "cds-WP_000631725.1"; Name "WP_000631725.1"; Note "TnpB, as the term is used for proteins encoded by IS66 family insertion elements, is considered an accessory protein, since TnpC, encoded by a neighboring gene, is a DDE family transposase."; Parent "gene-C7A06_RS33355"; gbkey "CDS"; gene "tnpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858152.1"; locus_tag "C7A06_RS33355"; product "IS66 family insertion sequence element accessory protein TnpB"; protein_id "WP_000631725.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 906 1580 . - . gene_id "nbis-gene-5649"; ID "nbis-gene-5649"; Name "tnpA"; gbkey "Gene"; gene "tnpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33360";
+NZ_CP027601.1 RefSeq transcript 906 1580 . - . gene_id "nbis-gene-5649"; transcript_id "gene-C7A06_RS33360"; ID "gene-C7A06_RS33360"; Name "tnpA"; Parent "nbis-gene-5649"; gbkey "Gene"; gene "tnpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33360"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 906 1580 . - . gene_id "nbis-gene-5649"; transcript_id "gene-C7A06_RS33360"; Dbxref "Genbank:WP_001341423.1"; ID "nbis-exon-5904"; Name "WP_001341423.1"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33360"; gbkey "CDS"; gene "tnpA"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_311873.1"; locus_tag "C7A06_RS33360"; product "IS66-like element accessory protein TnpA"; protein_id "WP_001341423.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 906 1580 . - 0 gene_id "nbis-gene-5649"; transcript_id "gene-C7A06_RS33360"; Dbxref "Genbank:WP_001341423.1"; ID "cds-WP_001341423.1"; Name "WP_001341423.1"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33360"; gbkey "CDS"; gene "tnpA"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_311873.1"; locus_tag "C7A06_RS33360"; product "IS66-like element accessory protein TnpA"; protein_id "WP_001341423.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 1664 1930 . + . gene_id "nbis-pseudogene-366"; ID "nbis-pseudogene-366"; Name "C7A06_RS35230"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS35230"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "1664";
+NZ_CP027601.1 RefSeq transcript 1664 1930 . + . gene_id "nbis-pseudogene-366"; transcript_id "gene-C7A06_RS35230"; ID "gene-C7A06_RS35230"; Name "C7A06_RS35230"; Parent "nbis-pseudogene-366"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS35230"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "1664";
+NZ_CP027601.1 Protein Homology exon 1664 1930 . + . gene_id "nbis-pseudogene-366"; transcript_id "gene-C7A06_RS35230"; ID "nbis-exon-6226"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS35230"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_016245103.1"; locus_tag "C7A06_RS35230"; partial "true"; product "YqiJ family protein"; pseudo "true"; start_range "." "1664"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 1664 1930 . + 0 gene_id "nbis-pseudogene-366"; transcript_id "gene-C7A06_RS35230"; ID "cds-C7A06_RS35230"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS35230"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_016245103.1"; locus_tag "C7A06_RS35230"; partial "true"; product "YqiJ family protein"; pseudo "true"; start_range "." "1664"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 1978 2190 . - . gene_id "nbis-pseudogene-255"; ID "nbis-pseudogene-255"; Name "C7A06_RS33375"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33375"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "1978";
+NZ_CP027601.1 RefSeq transcript 1978 2190 . - . gene_id "nbis-pseudogene-255"; transcript_id "gene-C7A06_RS33375"; ID "gene-C7A06_RS33375"; Name "C7A06_RS33375"; Parent "nbis-pseudogene-255"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33375"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "1978";
+NZ_CP027601.1 Protein Homology exon 1978 2190 . - . gene_id "nbis-pseudogene-255"; transcript_id "gene-C7A06_RS33375"; ID "nbis-exon-5905"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33375"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611998.1"; locus_tag "C7A06_RS33375"; partial "true"; product "transposase"; pseudo "true"; start_range "." "1978"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 1978 2190 . - 0 gene_id "nbis-pseudogene-255"; transcript_id "gene-C7A06_RS33375"; ID "cds-C7A06_RS33375"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33375"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611998.1"; locus_tag "C7A06_RS33375"; partial "true"; product "transposase"; pseudo "true"; start_range "." "1978"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 2252 2425 . + . gene_id "nbis-pseudogene-256"; ID "nbis-pseudogene-256"; Name "C7A06_RS33380"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33380"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "2252";
+NZ_CP027601.1 RefSeq transcript 2252 2425 . + . gene_id "nbis-pseudogene-256"; transcript_id "gene-C7A06_RS33380"; ID "gene-C7A06_RS33380"; Name "C7A06_RS33380"; Parent "nbis-pseudogene-256"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33380"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "2252";
+NZ_CP027601.1 Protein Homology exon 2252 2425 . + . gene_id "nbis-pseudogene-256"; transcript_id "gene-C7A06_RS33380"; ID "nbis-exon-5906"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS33380"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000998048.1"; locus_tag "C7A06_RS33380"; partial "true"; product "IS66 family transposase"; pseudo "true"; start_range "." "2252"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 2252 2425 . + 0 gene_id "nbis-pseudogene-256"; transcript_id "gene-C7A06_RS33380"; ID "cds-C7A06_RS33380"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS33380"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000998048.1"; locus_tag "C7A06_RS33380"; partial "true"; product "IS66 family transposase"; pseudo "true"; start_range "." "2252"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 2868 6770 . + . gene_id "nbis-gene-5650"; ID "nbis-gene-5650"; Name "espP"; gbkey "Gene"; gene "espP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33385";
+NZ_CP027601.1 RefSeq transcript 2868 6770 . + . gene_id "nbis-gene-5650"; transcript_id "gene-C7A06_RS33385"; ID "gene-C7A06_RS33385"; Name "espP"; Parent "nbis-gene-5650"; gbkey "Gene"; gene "espP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33385"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 2868 6770 . + . gene_id "nbis-gene-5650"; transcript_id "gene-C7A06_RS33385"; Dbxref "Genbank:WP_001034100.1"; ID "nbis-exon-5907"; Name "WP_001034100.1"; Parent "gene-C7A06_RS33385"; gbkey "CDS"; gene "espP"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052685.1"; locus_tag "C7A06_RS33385"; product "serine protease autotransporter EspP"; protein_id "WP_001034100.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 2868 6770 . + 0 gene_id "nbis-gene-5650"; transcript_id "gene-C7A06_RS33385"; Dbxref "Genbank:WP_001034100.1"; ID "cds-WP_001034100.1"; Name "WP_001034100.1"; Parent "gene-C7A06_RS33385"; gbkey "CDS"; gene "espP"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052685.1"; locus_tag "C7A06_RS33385"; product "serine protease autotransporter EspP"; protein_id "WP_001034100.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 7018 7275 . - . gene_id "nbis-gene-5772"; ID "nbis-gene-5772"; Name "C7A06_RS34375"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34375";
+NZ_CP027601.1 RefSeq transcript 7018 7275 . - . gene_id "nbis-gene-5772"; transcript_id "gene-C7A06_RS34375"; ID "gene-C7A06_RS34375"; Name "C7A06_RS34375"; Parent "nbis-gene-5772"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34375"; original_biotype "mrna";
+NZ_CP027601.1 GeneMarkS-2+ exon 7018 7275 . - . gene_id "nbis-gene-5772"; transcript_id "gene-C7A06_RS34375"; Dbxref "Genbank:WP_000112000.1"; ID "nbis-exon-6062"; Name "WP_000112000.1"; Parent "gene-C7A06_RS34375"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS34375"; product "hypothetical protein"; protein_id "WP_000112000.1"; transl_table "11";
+NZ_CP027601.1 GeneMarkS-2+ CDS 7018 7275 . - 0 gene_id "nbis-gene-5772"; transcript_id "gene-C7A06_RS34375"; Dbxref "Genbank:WP_000112000.1"; ID "cds-WP_000112000.1"; Name "WP_000112000.1"; Parent "gene-C7A06_RS34375"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS34375"; product "hypothetical protein"; protein_id "WP_000112000.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 7314 7526 . + . gene_id "nbis-pseudogene-257"; ID "nbis-pseudogene-257"; Name "C7A06_RS33395"; end_range "7526" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33395"; original_biotype "pseudogene"; partial "true"; pseudo "true";
+NZ_CP027601.1 RefSeq transcript 7314 7526 . + . gene_id "nbis-pseudogene-257"; transcript_id "gene-C7A06_RS33395"; ID "gene-C7A06_RS33395"; Name "C7A06_RS33395"; Parent "nbis-pseudogene-257"; end_range "7526" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33395"; original_biotype "mrna"; partial "true"; pseudo "true";
+NZ_CP027601.1 Protein Homology exon 7314 7526 . + . gene_id "nbis-pseudogene-257"; transcript_id "gene-C7A06_RS33395"; ID "nbis-exon-5908"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33395"; end_range "7526" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611998.1"; locus_tag "C7A06_RS33395"; partial "true"; product "transposase"; pseudo "true"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 7314 7526 . + 0 gene_id "nbis-pseudogene-257"; transcript_id "gene-C7A06_RS33395"; ID "cds-C7A06_RS33395"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33395"; end_range "7526" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611998.1"; locus_tag "C7A06_RS33395"; partial "true"; product "transposase"; pseudo "true"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 7574 7840 . - . gene_id "nbis-pseudogene-367"; ID "nbis-pseudogene-367"; Name "C7A06_RS35235"; end_range "7840" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS35235"; original_biotype "pseudogene"; partial "true"; pseudo "true";
+NZ_CP027601.1 RefSeq transcript 7574 7840 . - . gene_id "nbis-pseudogene-367"; transcript_id "gene-C7A06_RS35235"; ID "gene-C7A06_RS35235"; Name "C7A06_RS35235"; Parent "nbis-pseudogene-367"; end_range "7840" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS35235"; original_biotype "mrna"; partial "true"; pseudo "true";
+NZ_CP027601.1 Protein Homology exon 7574 7840 . - . gene_id "nbis-pseudogene-367"; transcript_id "gene-C7A06_RS35235"; ID "nbis-exon-6227"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS35235"; end_range "7840" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_016245103.1"; locus_tag "C7A06_RS35235"; partial "true"; product "YqiJ family protein"; pseudo "true"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 7574 7840 . - 0 gene_id "nbis-pseudogene-367"; transcript_id "gene-C7A06_RS35235"; ID "cds-C7A06_RS35235"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS35235"; end_range "7840" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_016245103.1"; locus_tag "C7A06_RS35235"; partial "true"; product "YqiJ family protein"; pseudo "true"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 7986 9199 . + . gene_id "nbis-gene-5651"; ID "nbis-gene-5651"; Name "C7A06_RS33410"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33410";
+NZ_CP027601.1 RefSeq transcript 7986 9199 . + . gene_id "nbis-gene-5651"; transcript_id "gene-C7A06_RS33410"; ID "gene-C7A06_RS33410"; Name "C7A06_RS33410"; Parent "nbis-gene-5651"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33410"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 7986 9199 . + . gene_id "nbis-gene-5651"; transcript_id "gene-C7A06_RS33410"; Dbxref "Genbank:WP_162908518.1"; ID "nbis-exon-5909"; Name "WP_162908518.1"; Note "programmed frameshift"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33410"; exception "ribosomal slippage"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_086558238.1"; locus_tag "C7A06_RS33410"; product "IS3 family transposase"; protein_id "WP_162908518.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 7986 9199 . + 0 gene_id "nbis-gene-5651"; transcript_id "gene-C7A06_RS33410"; Dbxref "Genbank:WP_162908518.1"; ID "cds-WP_162908518.1"; Name "WP_162908518.1"; Note "programmed frameshift"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33410"; exception "ribosomal slippage"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_086558238.1"; locus_tag "C7A06_RS33410"; product "IS3 family transposase"; protein_id "WP_162908518.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 9240 9620 . - . gene_id "nbis-pseudogene-258"; ID "nbis-pseudogene-258"; Name "C7A06_RS33415"; end_range "9620" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33415"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "9240";
+NZ_CP027601.1 RefSeq transcript 9240 9620 . - . gene_id "nbis-pseudogene-258"; transcript_id "gene-C7A06_RS33415"; ID "gene-C7A06_RS33415"; Name "C7A06_RS33415"; Parent "nbis-pseudogene-258"; end_range "9620" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33415"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "9240";
+NZ_CP027601.1 Protein Homology exon 9240 9620 . - . gene_id "nbis-pseudogene-258"; transcript_id "gene-C7A06_RS33415"; ID "nbis-exon-5910"; Note "incomplete; partial in the middle of a contig; missing N-terminus and C-terminus"; Parent "gene-C7A06_RS33415"; end_range "9620" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611997.1"; locus_tag "C7A06_RS33415"; partial "true"; product "IS3 family transposase"; pseudo "true"; start_range "." "9240"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 9240 9620 . - 0 gene_id "nbis-pseudogene-258"; transcript_id "gene-C7A06_RS33415"; ID "cds-C7A06_RS33415"; Note "incomplete; partial in the middle of a contig; missing N-terminus and C-terminus"; Parent "gene-C7A06_RS33415"; end_range "9620" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611997.1"; locus_tag "C7A06_RS33415"; partial "true"; product "IS3 family transposase"; pseudo "true"; start_range "." "9240"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 9651 11222 . - . gene_id "nbis-gene-5652"; ID "nbis-gene-5652"; Name "C7A06_RS33420"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33420";
+NZ_CP027601.1 RefSeq transcript 9651 11222 . - . gene_id "nbis-gene-5652"; transcript_id "gene-C7A06_RS33420"; ID "gene-C7A06_RS33420"; Name "C7A06_RS33420"; Parent "nbis-gene-5652"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33420"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 9651 11222 . - . gene_id "nbis-gene-5652"; transcript_id "gene-C7A06_RS33420"; Dbxref "Genbank:WP_000381395.1"; ID "nbis-exon-5911"; Name "WP_000381395.1"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33420"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012904571.1"; locus_tag "C7A06_RS33420"; product "IS66 family transposase"; protein_id "WP_000381395.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 9651 11222 . - 0 gene_id "nbis-gene-5652"; transcript_id "gene-C7A06_RS33420"; Dbxref "Genbank:WP_000381395.1"; ID "cds-WP_000381395.1-10"; Name "WP_000381395.1"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33420"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012904571.1"; locus_tag "C7A06_RS33420"; product "IS66 family transposase"; protein_id "WP_000381395.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 11242 11589 . - . gene_id "nbis-gene-5653"; ID "nbis-gene-5653"; Name "tnpB"; gbkey "Gene"; gene "tnpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33425";
+NZ_CP027601.1 RefSeq transcript 11242 11589 . - . gene_id "nbis-gene-5653"; transcript_id "gene-C7A06_RS33425"; ID "gene-C7A06_RS33425"; Name "tnpB"; Parent "nbis-gene-5653"; gbkey "Gene"; gene "tnpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33425"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 11242 11589 . - . gene_id "nbis-gene-5653"; transcript_id "gene-C7A06_RS33425"; Dbxref "Genbank:WP_000624622.1"; ID "nbis-exon-5912"; Name "WP_000624622.1"; Note "TnpB, as the term is used for proteins encoded by IS66 family insertion elements, is considered an accessory protein, since TnpC, encoded by a neighboring gene, is a DDE family transposase."; Parent "gene-C7A06_RS33425"; gbkey "CDS"; gene "tnpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858152.1"; locus_tag "C7A06_RS33425"; product "IS66 family insertion sequence element accessory protein TnpB"; protein_id "WP_000624622.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 11242 11589 . - 0 gene_id "nbis-gene-5653"; transcript_id "gene-C7A06_RS33425"; Dbxref "Genbank:WP_000624622.1"; ID "cds-WP_000624622.1-10"; Name "WP_000624622.1"; Note "TnpB, as the term is used for proteins encoded by IS66 family insertion elements, is considered an accessory protein, since TnpC, encoded by a neighboring gene, is a DDE family transposase."; Parent "gene-C7A06_RS33425"; gbkey "CDS"; gene "tnpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858152.1"; locus_tag "C7A06_RS33425"; product "IS66 family insertion sequence element accessory protein TnpB"; protein_id "WP_000624622.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 11589 12266 . - . gene_id "nbis-gene-5654"; ID "nbis-gene-5654"; Name "tnpA"; gbkey "Gene"; gene "tnpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33430";
+NZ_CP027601.1 RefSeq transcript 11589 12266 . - . gene_id "nbis-gene-5654"; transcript_id "gene-C7A06_RS33430"; ID "gene-C7A06_RS33430"; Name "tnpA"; Parent "nbis-gene-5654"; gbkey "Gene"; gene "tnpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33430"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 11589 12266 . - . gene_id "nbis-gene-5654"; transcript_id "gene-C7A06_RS33430"; Dbxref "Genbank:WP_001339397.1"; ID "nbis-exon-5913"; Name "WP_001339397.1"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33430"; gbkey "CDS"; gene "tnpA"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001743492.1"; locus_tag "C7A06_RS33430"; product "IS66-like element accessory protein TnpA"; protein_id "WP_001339397.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 11589 12266 . - 0 gene_id "nbis-gene-5654"; transcript_id "gene-C7A06_RS33430"; Dbxref "Genbank:WP_001339397.1"; ID "cds-WP_001339397.1-10"; Name "WP_001339397.1"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33430"; gbkey "CDS"; gene "tnpA"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001743492.1"; locus_tag "C7A06_RS33430"; product "IS66-like element accessory protein TnpA"; protein_id "WP_001339397.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 12319 12635 . - . gene_id "nbis-pseudogene-259"; ID "nbis-pseudogene-259"; Name "C7A06_RS33440"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33440"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "12319";
+NZ_CP027601.1 RefSeq transcript 12319 12635 . - . gene_id "nbis-pseudogene-259"; transcript_id "gene-C7A06_RS33440"; ID "gene-C7A06_RS33440"; Name "C7A06_RS33440"; Parent "nbis-pseudogene-259"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33440"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "12319";
+NZ_CP027601.1 Protein Homology exon 12319 12635 . - . gene_id "nbis-pseudogene-259"; transcript_id "gene-C7A06_RS33440"; ID "nbis-exon-5914"; Note "frameshifted; incomplete; partial in the middle of a contig; missing C-terminus"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33440"; gbkey "CDS"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611998.1"; locus_tag "C7A06_RS33440"; partial "true"; product "transposase"; pseudo "true"; start_range "." "12319"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 12319 12635 . - 0 gene_id "nbis-pseudogene-259"; transcript_id "gene-C7A06_RS33440"; ID "cds-C7A06_RS33440"; Note "frameshifted; incomplete; partial in the middle of a contig; missing C-terminus"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33440"; gbkey "CDS"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611998.1"; locus_tag "C7A06_RS33440"; partial "true"; product "transposase"; pseudo "true"; start_range "." "12319"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 12701 12994 . + . gene_id "nbis-pseudogene-368"; ID "nbis-pseudogene-368"; Name "C7A06_RS35240"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS35240"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "12701";
+NZ_CP027601.1 RefSeq transcript 12701 12994 . + . gene_id "nbis-pseudogene-368"; transcript_id "gene-C7A06_RS35240"; ID "gene-C7A06_RS35240"; Name "C7A06_RS35240"; Parent "nbis-pseudogene-368"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS35240"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "12701";
+NZ_CP027601.1 Protein Homology exon 12701 12994 . + . gene_id "nbis-pseudogene-368"; transcript_id "gene-C7A06_RS35240"; ID "nbis-exon-6228"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS35240"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000077650.1"; locus_tag "C7A06_RS35240"; partial "true"; product "conjugal transfer protein TrbC"; pseudo "true"; start_range "." "12701"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 12701 12994 . + 0 gene_id "nbis-pseudogene-368"; transcript_id "gene-C7A06_RS35240"; ID "cds-C7A06_RS35240"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS35240"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000077650.1"; locus_tag "C7A06_RS35240"; partial "true"; product "conjugal transfer protein TrbC"; pseudo "true"; start_range "." "12701"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 13215 15935 . - . gene_id "nbis-gene-5655"; ID "nbis-gene-5655"; Name "C7A06_RS33450"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33450";
+NZ_CP027601.1 RefSeq transcript 13215 15935 . - . gene_id "nbis-gene-5655"; transcript_id "gene-C7A06_RS33450"; ID "gene-C7A06_RS33450"; Name "C7A06_RS33450"; Parent "nbis-gene-5655"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33450"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 13215 15935 . - . gene_id "nbis-gene-5655"; transcript_id "gene-C7A06_RS33450"; Dbxref "Genbank:WP_000991402.1"; ID "nbis-exon-5915"; Name "WP_000991402.1"; Parent "gene-C7A06_RS33450"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000991381.1"; locus_tag "C7A06_RS33450"; product "relaxase/mobilization nuclease domain-containing protein"; protein_id "WP_000991402.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 13215 15935 . - 0 gene_id "nbis-gene-5655"; transcript_id "gene-C7A06_RS33450"; Dbxref "Genbank:WP_000991402.1"; ID "cds-WP_000991402.1"; Name "WP_000991402.1"; Parent "gene-C7A06_RS33450"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000991381.1"; locus_tag "C7A06_RS33450"; product "relaxase/mobilization nuclease domain-containing protein"; protein_id "WP_000991402.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 15947 16279 . - . gene_id "nbis-gene-5656"; ID "nbis-gene-5656"; Name "C7A06_RS33455"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33455";
+NZ_CP027601.1 RefSeq transcript 15947 16279 . - . gene_id "nbis-gene-5656"; transcript_id "gene-C7A06_RS33455"; ID "gene-C7A06_RS33455"; Name "C7A06_RS33455"; Parent "nbis-gene-5656"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33455"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 15947 16279 . - . gene_id "nbis-gene-5656"; transcript_id "gene-C7A06_RS33455"; Dbxref "Genbank:WP_001291056.1"; ID "nbis-exon-5916"; Name "WP_001291056.1"; Parent "gene-C7A06_RS33455"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001291057.1"; locus_tag "C7A06_RS33455"; product "DUF6290 family protein"; protein_id "WP_001291056.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 15947 16279 . - 0 gene_id "nbis-gene-5656"; transcript_id "gene-C7A06_RS33455"; Dbxref "Genbank:WP_001291056.1"; ID "cds-WP_001291056.1"; Name "WP_001291056.1"; Parent "gene-C7A06_RS33455"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001291057.1"; locus_tag "C7A06_RS33455"; product "DUF6290 family protein"; protein_id "WP_001291056.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 16511 16846 . + . gene_id "nbis-gene-5657"; ID "nbis-gene-5657"; Name "C7A06_RS33460"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33460";
+NZ_CP027601.1 RefSeq transcript 16511 16846 . + . gene_id "nbis-gene-5657"; transcript_id "gene-C7A06_RS33460"; ID "gene-C7A06_RS33460"; Name "C7A06_RS33460"; Parent "nbis-gene-5657"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33460"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 16511 16846 . + . gene_id "nbis-gene-5657"; transcript_id "gene-C7A06_RS33460"; Dbxref "Genbank:WP_000157095.1"; ID "nbis-exon-5917"; Name "WP_000157095.1"; Parent "gene-C7A06_RS33460"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000157082.1"; locus_tag "C7A06_RS33460"; product "molybdopterin-guanine dinucleotide biosynthesis protein MobC"; protein_id "WP_000157095.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 16511 16846 . + 0 gene_id "nbis-gene-5657"; transcript_id "gene-C7A06_RS33460"; Dbxref "Genbank:WP_000157095.1"; ID "cds-WP_000157095.1"; Name "WP_000157095.1"; Parent "gene-C7A06_RS33460"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000157082.1"; locus_tag "C7A06_RS33460"; product "molybdopterin-guanine dinucleotide biosynthesis protein MobC"; protein_id "WP_000157095.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 16932 17780 . - . gene_id "nbis-gene-5658"; ID "nbis-gene-5658"; Name "C7A06_RS33465"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33465";
+NZ_CP027601.1 RefSeq transcript 16932 17780 . - . gene_id "nbis-gene-5658"; transcript_id "gene-C7A06_RS33465"; ID "gene-C7A06_RS33465"; Name "C7A06_RS33465"; Parent "nbis-gene-5658"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33465"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 16932 17780 . - . gene_id "nbis-gene-5658"; transcript_id "gene-C7A06_RS33465"; Dbxref "Genbank:WP_001341408.1"; ID "nbis-exon-5918"; Name "WP_001341408.1"; Parent "gene-C7A06_RS33465"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001401764.1"; locus_tag "C7A06_RS33465"; product "DUF4942 domain-containing protein"; protein_id "WP_001341408.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 16932 17780 . - 0 gene_id "nbis-gene-5658"; transcript_id "gene-C7A06_RS33465"; Dbxref "Genbank:WP_001341408.1"; ID "cds-WP_001341408.1"; Name "WP_001341408.1"; Parent "gene-C7A06_RS33465"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001401764.1"; locus_tag "C7A06_RS33465"; product "DUF4942 domain-containing protein"; protein_id "WP_001341408.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 17973 18299 . + . gene_id "nbis-gene-5659"; ID "nbis-gene-5659"; Name "C7A06_RS33470"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33470";
+NZ_CP027601.1 RefSeq transcript 17973 18299 . + . gene_id "nbis-gene-5659"; transcript_id "gene-C7A06_RS33470"; ID "gene-C7A06_RS33470"; Name "C7A06_RS33470"; Parent "nbis-gene-5659"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33470"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 17973 18299 . + . gene_id "nbis-gene-5659"; transcript_id "gene-C7A06_RS33470"; Dbxref "Genbank:WP_199852433.1"; ID "nbis-exon-5919"; Name "WP_199852433.1"; Parent "gene-C7A06_RS33470"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001431784.1"; locus_tag "C7A06_RS33470"; product "hypothetical protein"; protein_id "WP_199852433.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 17973 18299 . + 0 gene_id "nbis-gene-5659"; transcript_id "gene-C7A06_RS33470"; Dbxref "Genbank:WP_199852433.1"; ID "cds-WP_199852433.1"; Name "WP_199852433.1"; Parent "gene-C7A06_RS33470"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001431784.1"; locus_tag "C7A06_RS33470"; product "hypothetical protein"; protein_id "WP_199852433.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 18358 18609 . + . gene_id "nbis-gene-5660"; ID "nbis-gene-5660"; Name "C7A06_RS33475"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33475";
+NZ_CP027601.1 RefSeq transcript 18358 18609 . + . gene_id "nbis-gene-5660"; transcript_id "gene-C7A06_RS33475"; ID "gene-C7A06_RS33475"; Name "C7A06_RS33475"; Parent "nbis-gene-5660"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33475"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 18358 18609 . + . gene_id "nbis-gene-5660"; transcript_id "gene-C7A06_RS33475"; Dbxref "Genbank:WP_000148286.1"; ID "nbis-exon-5920"; Name "WP_000148286.1"; Parent "gene-C7A06_RS33475"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_003980153.1"; locus_tag "C7A06_RS33475"; product "helix-turn-helix domain-containing protein"; protein_id "WP_000148286.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 18358 18609 . + 0 gene_id "nbis-gene-5660"; transcript_id "gene-C7A06_RS33475"; Dbxref "Genbank:WP_000148286.1"; ID "cds-WP_000148286.1"; Name "WP_000148286.1"; Parent "gene-C7A06_RS33475"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_003980153.1"; locus_tag "C7A06_RS33475"; product "helix-turn-helix domain-containing protein"; protein_id "WP_000148286.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 18640 19539 . - . gene_id "nbis-gene-5661"; ID "nbis-gene-5661"; Name "C7A06_RS33480"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33480";
+NZ_CP027601.1 RefSeq transcript 18640 19539 . - . gene_id "nbis-gene-5661"; transcript_id "gene-C7A06_RS33480"; ID "gene-C7A06_RS33480"; Name "C7A06_RS33480"; Parent "nbis-gene-5661"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33480"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 18640 19539 . - . gene_id "nbis-gene-5661"; transcript_id "gene-C7A06_RS33480"; Dbxref "Genbank:WP_032348834.1"; ID "nbis-exon-5921"; Name "WP_032348834.1"; Parent "gene-C7A06_RS33480"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000038335.1"; locus_tag "C7A06_RS33480"; product "Rpn family recombination-promoting nuclease/putative transposase"; protein_id "WP_032348834.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 18640 19539 . - 0 gene_id "nbis-gene-5661"; transcript_id "gene-C7A06_RS33480"; Dbxref "Genbank:WP_032348834.1"; ID "cds-WP_032348834.1"; Name "WP_032348834.1"; Parent "gene-C7A06_RS33480"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000038335.1"; locus_tag "C7A06_RS33480"; product "Rpn family recombination-promoting nuclease/putative transposase"; protein_id "WP_032348834.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 19604 19870 . - . gene_id "nbis-gene-5662"; ID "nbis-gene-5662"; Name "C7A06_RS33485"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33485";
+NZ_CP027601.1 RefSeq transcript 19604 19870 . - . gene_id "nbis-gene-5662"; transcript_id "gene-C7A06_RS33485"; ID "gene-C7A06_RS33485"; Name "C7A06_RS33485"; Parent "nbis-gene-5662"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33485"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 19604 19870 . - . gene_id "nbis-gene-5662"; transcript_id "gene-C7A06_RS33485"; Dbxref "Genbank:WP_001247865.1"; ID "nbis-exon-5922"; Name "WP_001247865.1"; Parent "gene-C7A06_RS33485"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001247860.1"; locus_tag "C7A06_RS33485"; product "hypothetical protein"; protein_id "WP_001247865.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 19604 19870 . - 0 gene_id "nbis-gene-5662"; transcript_id "gene-C7A06_RS33485"; Dbxref "Genbank:WP_001247865.1"; ID "cds-WP_001247865.1"; Name "WP_001247865.1"; Parent "gene-C7A06_RS33485"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001247860.1"; locus_tag "C7A06_RS33485"; product "hypothetical protein"; protein_id "WP_001247865.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 19963 20397 . - . gene_id "nbis-gene-5663"; ID "nbis-gene-5663"; Name "C7A06_RS33490"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33490";
+NZ_CP027601.1 RefSeq transcript 19963 20397 . - . gene_id "nbis-gene-5663"; transcript_id "gene-C7A06_RS33490"; ID "gene-C7A06_RS33490"; Name "C7A06_RS33490"; Parent "nbis-gene-5663"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33490"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 19963 20397 . - . gene_id "nbis-gene-5663"; transcript_id "gene-C7A06_RS33490"; Dbxref "Genbank:WP_000218854.1"; ID "nbis-exon-5923"; Name "WP_000218854.1"; Parent "gene-C7A06_RS33490"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000218847.1"; locus_tag "C7A06_RS33490"; product "hypothetical protein"; protein_id "WP_000218854.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 19963 20397 . - 0 gene_id "nbis-gene-5663"; transcript_id "gene-C7A06_RS33490"; Dbxref "Genbank:WP_000218854.1"; ID "cds-WP_000218854.1"; Name "WP_000218854.1"; Parent "gene-C7A06_RS33490"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000218847.1"; locus_tag "C7A06_RS33490"; product "hypothetical protein"; protein_id "WP_000218854.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 20503 21123 . + . gene_id "nbis-gene-5805"; ID "nbis-gene-5805"; Name "C7A06_RS34645"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34645";
+NZ_CP027601.1 RefSeq transcript 20503 21123 . + . gene_id "nbis-gene-5805"; transcript_id "gene-C7A06_RS34645"; ID "gene-C7A06_RS34645"; Name "C7A06_RS34645"; Parent "nbis-gene-5805"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34645"; original_biotype "mrna";
+NZ_CP027601.1 GeneMarkS-2+ exon 20503 21123 . + . gene_id "nbis-gene-5805"; transcript_id "gene-C7A06_RS34645"; Dbxref "Genbank:WP_162137195.1"; ID "nbis-exon-6111"; Name "WP_162137195.1"; Parent "gene-C7A06_RS34645"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS34645"; product "hypothetical protein"; protein_id "WP_162137195.1"; transl_table "11";
+NZ_CP027601.1 GeneMarkS-2+ CDS 20503 21123 . + 0 gene_id "nbis-gene-5805"; transcript_id "gene-C7A06_RS34645"; Dbxref "Genbank:WP_162137195.1"; ID "cds-WP_162137195.1"; Name "WP_162137195.1"; Parent "gene-C7A06_RS34645"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS34645"; product "hypothetical protein"; protein_id "WP_162137195.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 21125 21625 . - . gene_id "nbis-gene-5664"; ID "nbis-gene-5664"; Name "C7A06_RS33505"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33505";
+NZ_CP027601.1 RefSeq transcript 21125 21625 . - . gene_id "nbis-gene-5664"; transcript_id "gene-C7A06_RS33505"; ID "gene-C7A06_RS33505"; Name "C7A06_RS33505"; Parent "nbis-gene-5664"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33505"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 21125 21625 . - . gene_id "nbis-gene-5664"; transcript_id "gene-C7A06_RS33505"; Dbxref "Genbank:WP_000117628.1"; ID "nbis-exon-5924"; Name "WP_000117628.1"; Parent "gene-C7A06_RS33505"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000117633.1"; locus_tag "C7A06_RS33505"; product "antirestriction protein ArdA"; protein_id "WP_000117628.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 21125 21625 . - 0 gene_id "nbis-gene-5664"; transcript_id "gene-C7A06_RS33505"; Dbxref "Genbank:WP_000117628.1"; ID "cds-WP_000117628.1"; Name "WP_000117628.1"; Parent "gene-C7A06_RS33505"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000117633.1"; locus_tag "C7A06_RS33505"; product "antirestriction protein ArdA"; protein_id "WP_000117628.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 22087 22684 . - . gene_id "nbis-pseudogene-306"; ID "nbis-pseudogene-306"; Name "C7A06_RS34650"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34650"; original_biotype "pseudogene"; pseudo "true";
+NZ_CP027601.1 RefSeq transcript 22087 22684 . - . gene_id "nbis-pseudogene-306"; transcript_id "gene-C7A06_RS34650"; ID "gene-C7A06_RS34650"; Name "C7A06_RS34650"; Parent "nbis-pseudogene-306"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34650"; original_biotype "mrna"; pseudo "true";
+NZ_CP027601.1 Protein Homology exon 22087 22684 . - . gene_id "nbis-pseudogene-306"; transcript_id "gene-C7A06_RS34650"; ID "nbis-exon-6112"; Note "frameshifted"; Parent "gene-C7A06_RS34650"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000978013.1"; locus_tag "C7A06_RS34650"; product "hypothetical protein"; pseudo "true"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 22087 22684 . - 0 gene_id "nbis-pseudogene-306"; transcript_id "gene-C7A06_RS34650"; ID "cds-C7A06_RS34650"; Note "frameshifted"; Parent "gene-C7A06_RS34650"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000978013.1"; locus_tag "C7A06_RS34650"; product "hypothetical protein"; pseudo "true"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 22681 23400 . - . gene_id "nbis-gene-5665"; ID "nbis-gene-5665"; Name "C7A06_RS33520"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33520";
+NZ_CP027601.1 RefSeq transcript 22681 23400 . - . gene_id "nbis-gene-5665"; transcript_id "gene-C7A06_RS33520"; ID "gene-C7A06_RS33520"; Name "C7A06_RS33520"; Parent "nbis-gene-5665"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33520"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 22681 23400 . - . gene_id "nbis-gene-5665"; transcript_id "gene-C7A06_RS33520"; Dbxref "Genbank:WP_001276261.1"; ID "nbis-exon-5925"; Name "WP_001276261.1"; Parent "gene-C7A06_RS33520"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001723065.1"; locus_tag "C7A06_RS33520"; product "plasmid SOS inhibition protein A"; protein_id "WP_001276261.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 22681 23400 . - 0 gene_id "nbis-gene-5665"; transcript_id "gene-C7A06_RS33520"; Dbxref "Genbank:WP_001276261.1"; ID "cds-WP_001276261.1"; Name "WP_001276261.1"; Parent "gene-C7A06_RS33520"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001723065.1"; locus_tag "C7A06_RS33520"; product "plasmid SOS inhibition protein A"; protein_id "WP_001276261.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 23397 23645 . - . gene_id "nbis-pseudogene-307"; ID "nbis-pseudogene-307"; Name "psiB"; end_range "23645" "."; gbkey "Gene"; gene "psiB"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34655"; original_biotype "pseudogene"; partial "true"; pseudo "true";
+NZ_CP027601.1 RefSeq transcript 23397 23645 . - . gene_id "nbis-pseudogene-307"; transcript_id "gene-C7A06_RS34655"; ID "gene-C7A06_RS34655"; Name "psiB"; Parent "nbis-pseudogene-307"; end_range "23645" "."; gbkey "Gene"; gene "psiB"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34655"; original_biotype "mrna"; partial "true"; pseudo "true";
+NZ_CP027601.1 Protein Homology exon 23397 23645 . - . gene_id "nbis-pseudogene-307"; transcript_id "gene-C7A06_RS34655"; ID "nbis-exon-6113"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS34655"; end_range "23645" "."; gbkey "CDS"; gene "psiB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000845953.1"; locus_tag "C7A06_RS34655"; partial "true"; product "conjugation system SOS inhibitor PsiB"; pseudo "true"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 23397 23645 . - 0 gene_id "nbis-pseudogene-307"; transcript_id "gene-C7A06_RS34655"; ID "cds-C7A06_RS34655"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS34655"; end_range "23645" "."; gbkey "CDS"; gene "psiB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000845953.1"; locus_tag "C7A06_RS34655"; partial "true"; product "conjugation system SOS inhibitor PsiB"; pseudo "true"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 23640 23879 . - . gene_id "nbis-pseudogene-308"; ID "nbis-pseudogene-308"; Name "C7A06_RS34660"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34660"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "23640";
+NZ_CP027601.1 RefSeq transcript 23640 23879 . - . gene_id "nbis-pseudogene-308"; transcript_id "gene-C7A06_RS34660"; ID "gene-C7A06_RS34660"; Name "C7A06_RS34660"; Parent "nbis-pseudogene-308"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34660"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "23640";
+NZ_CP027601.1 Protein Homology exon 23640 23879 . - . gene_id "nbis-pseudogene-308"; transcript_id "gene-C7A06_RS34660"; ID "nbis-exon-6114"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS34660"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858335.1"; locus_tag "C7A06_RS34660"; partial "true"; product "hypothetical protein"; pseudo "true"; start_range "." "23640"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 23640 23879 . - 0 gene_id "nbis-pseudogene-308"; transcript_id "gene-C7A06_RS34660"; ID "cds-C7A06_RS34660"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS34660"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858335.1"; locus_tag "C7A06_RS34660"; partial "true"; product "hypothetical protein"; pseudo "true"; start_range "." "23640"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 23924 24410 . - . gene_id "nbis-pseudogene-260"; ID "nbis-pseudogene-260"; Name "C7A06_RS33530"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33530"; original_biotype "pseudogene"; pseudo "true";
+NZ_CP027601.1 RefSeq transcript 23924 24410 . - . gene_id "nbis-pseudogene-260"; transcript_id "gene-C7A06_RS33530"; ID "gene-C7A06_RS33530"; Name "C7A06_RS33530"; Parent "nbis-pseudogene-260"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33530"; original_biotype "mrna"; pseudo "true";
+NZ_CP027601.1 Protein Homology exon 23924 24410 . - . gene_id "nbis-pseudogene-260"; transcript_id "gene-C7A06_RS33530"; ID "nbis-exon-5926"; Note "frameshifted"; Parent "gene-C7A06_RS33530"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052646.1"; locus_tag "C7A06_RS33530"; product "DUF1380 domain-containing protein"; pseudo "true"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 23924 24410 . - 0 gene_id "nbis-pseudogene-260"; transcript_id "gene-C7A06_RS33530"; ID "cds-C7A06_RS33530"; Note "frameshifted"; Parent "gene-C7A06_RS33530"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052646.1"; locus_tag "C7A06_RS33530"; product "DUF1380 domain-containing protein"; pseudo "true"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 24370 24588 . - . gene_id "nbis-gene-5666"; ID "nbis-gene-5666"; Name "C7A06_RS33535"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33535";
+NZ_CP027601.1 RefSeq transcript 24370 24588 . - . gene_id "nbis-gene-5666"; transcript_id "gene-C7A06_RS33535"; ID "gene-C7A06_RS33535"; Name "C7A06_RS33535"; Parent "nbis-gene-5666"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33535"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 24370 24588 . - . gene_id "nbis-gene-5666"; transcript_id "gene-C7A06_RS33535"; Dbxref "Genbank:WP_001443814.1"; ID "nbis-exon-5927"; Name "WP_001443814.1"; Parent "gene-C7A06_RS33535"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858332.1"; locus_tag "C7A06_RS33535"; product "hypothetical protein"; protein_id "WP_001443814.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 24370 24588 . - 0 gene_id "nbis-gene-5666"; transcript_id "gene-C7A06_RS33535"; Dbxref "Genbank:WP_001443814.1"; ID "cds-WP_001443814.1"; Name "WP_001443814.1"; Parent "gene-C7A06_RS33535"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858332.1"; locus_tag "C7A06_RS33535"; product "hypothetical protein"; protein_id "WP_001443814.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 24588 25271 . - . gene_id "nbis-gene-5667"; ID "nbis-gene-5667"; Name "C7A06_RS33540"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33540";
+NZ_CP027601.1 RefSeq transcript 24588 25271 . - . gene_id "nbis-gene-5667"; transcript_id "gene-C7A06_RS33540"; ID "gene-C7A06_RS33540"; Name "C7A06_RS33540"; Parent "nbis-gene-5667"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33540"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 24588 25271 . - . gene_id "nbis-gene-5667"; transcript_id "gene-C7A06_RS33540"; Dbxref "Genbank:WP_000086167.1"; ID "nbis-exon-5928"; Name "WP_000086167.1"; Parent "gene-C7A06_RS33540"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858331.2"; locus_tag "C7A06_RS33540"; product "DNA methylase"; protein_id "WP_000086167.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 24588 25271 . - 0 gene_id "nbis-gene-5667"; transcript_id "gene-C7A06_RS33540"; Dbxref "Genbank:WP_000086167.1"; ID "cds-WP_000086167.1"; Name "WP_000086167.1"; Parent "gene-C7A06_RS33540"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858331.2"; locus_tag "C7A06_RS33540"; product "DNA methylase"; protein_id "WP_000086167.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 25347 25658 . - . gene_id "nbis-gene-5668"; ID "nbis-gene-5668"; Name "C7A06_RS33545"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33545";
+NZ_CP027601.1 RefSeq transcript 25347 25658 . - . gene_id "nbis-gene-5668"; transcript_id "gene-C7A06_RS33545"; ID "gene-C7A06_RS33545"; Name "C7A06_RS33545"; Parent "nbis-gene-5668"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33545"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 25347 25658 . - . gene_id "nbis-gene-5668"; transcript_id "gene-C7A06_RS33545"; Dbxref "Genbank:WP_012680995.1"; ID "nbis-exon-5929"; Name "WP_012680995.1"; Parent "gene-C7A06_RS33545"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858330.2"; locus_tag "C7A06_RS33545"; product "hypothetical protein"; protein_id "WP_012680995.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 25347 25658 . - 0 gene_id "nbis-gene-5668"; transcript_id "gene-C7A06_RS33545"; Dbxref "Genbank:WP_012680995.1"; ID "cds-WP_012680995.1-2"; Name "WP_012680995.1"; Parent "gene-C7A06_RS33545"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858330.2"; locus_tag "C7A06_RS33545"; product "hypothetical protein"; protein_id "WP_012680995.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 25655 26557 . - . gene_id "nbis-gene-5669"; ID "nbis-gene-5669"; Name "C7A06_RS33550"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33550";
+NZ_CP027601.1 RefSeq transcript 25655 26557 . - . gene_id "nbis-gene-5669"; transcript_id "gene-C7A06_RS33550"; ID "gene-C7A06_RS33550"; Name "C7A06_RS33550"; Parent "nbis-gene-5669"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33550"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 25655 26557 . - . gene_id "nbis-gene-5669"; transcript_id "gene-C7A06_RS33550"; Dbxref "Genbank:WP_077249722.1"; ID "nbis-exon-5930"; Name "WP_077249722.1"; Parent "gene-C7A06_RS33550"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052643.1"; locus_tag "C7A06_RS33550"; product "DUF1281 domain-containing protein"; protein_id "WP_077249722.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 25655 26557 . - 0 gene_id "nbis-gene-5669"; transcript_id "gene-C7A06_RS33550"; Dbxref "Genbank:WP_077249722.1"; ID "cds-WP_077249722.1"; Name "WP_077249722.1"; Parent "gene-C7A06_RS33550"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052643.1"; locus_tag "C7A06_RS33550"; product "DUF1281 domain-containing protein"; protein_id "WP_077249722.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 26830 27789 . + . gene_id "nbis-gene-5670"; ID "nbis-gene-5670"; Name "C7A06_RS33555"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33555";
+NZ_CP027601.1 RefSeq transcript 26830 27789 . + . gene_id "nbis-gene-5670"; transcript_id "gene-C7A06_RS33555"; ID "gene-C7A06_RS33555"; Name "C7A06_RS33555"; Parent "nbis-gene-5670"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33555"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 26830 27789 . + . gene_id "nbis-gene-5670"; transcript_id "gene-C7A06_RS33555"; Dbxref "Genbank:WP_000921957.1"; ID "nbis-exon-5931"; Name "WP_000921957.1"; Parent "gene-C7A06_RS33555"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858328.1"; locus_tag "C7A06_RS33555"; product "plasmid segregation protein ParM"; protein_id "WP_000921957.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 26830 27789 . + 0 gene_id "nbis-gene-5670"; transcript_id "gene-C7A06_RS33555"; Dbxref "Genbank:WP_000921957.1"; ID "cds-WP_000921957.1"; Name "WP_000921957.1"; Parent "gene-C7A06_RS33555"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858328.1"; locus_tag "C7A06_RS33555"; product "plasmid segregation protein ParM"; protein_id "WP_000921957.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 27789 28184 . + . gene_id "nbis-gene-5671"; ID "nbis-gene-5671"; Name "C7A06_RS33560"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33560";
+NZ_CP027601.1 RefSeq transcript 27789 28184 . + . gene_id "nbis-gene-5671"; transcript_id "gene-C7A06_RS33560"; ID "gene-C7A06_RS33560"; Name "C7A06_RS33560"; Parent "nbis-gene-5671"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33560"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 27789 28184 . + . gene_id "nbis-gene-5671"; transcript_id "gene-C7A06_RS33560"; Dbxref "Genbank:WP_000445934.1"; ID "nbis-exon-5932"; Name "WP_000445934.1"; Parent "gene-C7A06_RS33560"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858327.1"; locus_tag "C7A06_RS33560"; product "plasmid partitioning/stability family protein"; protein_id "WP_000445934.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 27789 28184 . + 0 gene_id "nbis-gene-5671"; transcript_id "gene-C7A06_RS33560"; Dbxref "Genbank:WP_000445934.1"; ID "cds-WP_000445934.1"; Name "WP_000445934.1"; Parent "gene-C7A06_RS33560"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858327.1"; locus_tag "C7A06_RS33560"; product "plasmid partitioning/stability family protein"; protein_id "WP_000445934.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 28264 29031 . - . gene_id "nbis-pseudogene-261"; ID "nbis-pseudogene-261"; Name "C7A06_RS33565"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33565"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "28264";
+NZ_CP027601.1 RefSeq transcript 28264 29031 . - . gene_id "nbis-pseudogene-261"; transcript_id "gene-C7A06_RS33565"; ID "gene-C7A06_RS33565"; Name "C7A06_RS33565"; Parent "nbis-pseudogene-261"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33565"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "28264";
+NZ_CP027601.1 Protein Homology exon 28264 29031 . - . gene_id "nbis-pseudogene-261"; transcript_id "gene-C7A06_RS33565"; ID "nbis-exon-5933"; Note "frameshifted; internal stop; incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33565"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076612086.1"; locus_tag "C7A06_RS33565"; partial "true"; product "IS3 family transposase"; pseudo "true"; start_range "." "28264"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 28264 29031 . - 0 gene_id "nbis-pseudogene-261"; transcript_id "gene-C7A06_RS33565"; ID "cds-C7A06_RS33565"; Note "frameshifted; internal stop; incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33565"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076612086.1"; locus_tag "C7A06_RS33565"; partial "true"; product "IS3 family transposase"; pseudo "true"; start_range "." "28264"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 29145 29534 . - . gene_id "nbis-gene-5672"; ID "nbis-gene-5672"; Name "C7A06_RS33570"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33570";
+NZ_CP027601.1 RefSeq transcript 29145 29534 . - . gene_id "nbis-gene-5672"; transcript_id "gene-C7A06_RS33570"; ID "gene-C7A06_RS33570"; Name "C7A06_RS33570"; Parent "nbis-gene-5672"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33570"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 29145 29534 . - . gene_id "nbis-gene-5672"; transcript_id "gene-C7A06_RS33570"; Dbxref "Genbank:WP_001172748.1"; ID "nbis-exon-5934"; Name "WP_001172748.1"; Ontology_term "GO:0022900" "GO:0005506" "GO:0009055" "GO:0020037" "GO:0042597"; Parent "gene-C7A06_RS33570"; gbkey "CDS"; go_component "periplasmic space|0042597||IEA"; go_function "iron ion binding|0005506||IEA" "electron transfer activity|0009055||IEA" "heme binding|0020037||IEA"; go_process "electron transport chain|0022900||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_016242783.1"; locus_tag "C7A06_RS33570"; product "cytochrome b562"; protein_id "WP_001172748.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 29145 29534 . - 0 gene_id "nbis-gene-5672"; transcript_id "gene-C7A06_RS33570"; Dbxref "Genbank:WP_001172748.1"; ID "cds-WP_001172748.1"; Name "WP_001172748.1"; Ontology_term "GO:0022900" "GO:0005506" "GO:0009055" "GO:0020037" "GO:0042597"; Parent "gene-C7A06_RS33570"; gbkey "CDS"; go_component "periplasmic space|0042597||IEA"; go_function "iron ion binding|0005506||IEA" "electron transfer activity|0009055||IEA" "heme binding|0020037||IEA"; go_process "electron transport chain|0022900||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_016242783.1"; locus_tag "C7A06_RS33570"; product "cytochrome b562"; protein_id "WP_001172748.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 29578 31788 . - . gene_id "nbis-gene-5673"; ID "nbis-gene-5673"; Name "katP"; gbkey "Gene"; gene "katP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33575";
+NZ_CP027601.1 RefSeq transcript 29578 31788 . - . gene_id "nbis-gene-5673"; transcript_id "gene-C7A06_RS33575"; ID "gene-C7A06_RS33575"; Name "katP"; Parent "nbis-gene-5673"; gbkey "Gene"; gene "katP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33575"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 29578 31788 . - . gene_id "nbis-gene-5673"; transcript_id "gene-C7A06_RS33575"; Dbxref "Genbank:WP_000592771.1"; ID "nbis-exon-5935"; Name "WP_000592771.1"; Parent "gene-C7A06_RS33575"; gbkey "CDS"; gene "katP"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000592771.1"; locus_tag "C7A06_RS33575"; product "catalase/peroxidase KatP"; protein_id "WP_000592771.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 29578 31788 . - 0 gene_id "nbis-gene-5673"; transcript_id "gene-C7A06_RS33575"; Dbxref "Genbank:WP_000592771.1"; ID "cds-WP_000592771.1"; Name "WP_000592771.1"; Parent "gene-C7A06_RS33575"; gbkey "CDS"; gene "katP"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000592771.1"; locus_tag "C7A06_RS33575"; product "catalase/peroxidase KatP"; protein_id "WP_000592771.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 31961 33174 . - . gene_id "nbis-gene-5674"; ID "nbis-gene-5674"; Name "C7A06_RS33585"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33585";
+NZ_CP027601.1 RefSeq transcript 31961 33174 . - . gene_id "nbis-gene-5674"; transcript_id "gene-C7A06_RS33585"; ID "gene-C7A06_RS33585"; Name "C7A06_RS33585"; Parent "nbis-gene-5674"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33585"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 31961 33174 . - . gene_id "nbis-gene-5674"; transcript_id "gene-C7A06_RS33585"; Dbxref "Genbank:WP_162908515.1"; ID "nbis-exon-5936"; Name "WP_162908515.1"; Note "programmed frameshift"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33585"; exception "ribosomal slippage"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_086558238.1"; locus_tag "C7A06_RS33585"; product "IS3 family transposase"; protein_id "WP_162908515.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 31961 33174 . - 2 gene_id "nbis-gene-5674"; transcript_id "gene-C7A06_RS33585"; Dbxref "Genbank:WP_162908515.1"; ID "cds-WP_162908515.1"; Name "WP_162908515.1"; Note "programmed frameshift"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33585"; exception "ribosomal slippage"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_086558238.1"; locus_tag "C7A06_RS33585"; product "IS3 family transposase"; protein_id "WP_162908515.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 33980 34957 . + . gene_id "nbis-gene-5675"; ID "nbis-gene-5675"; Name "C7A06_RS33590"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33590";
+NZ_CP027601.1 RefSeq transcript 33980 34957 . + . gene_id "nbis-gene-5675"; transcript_id "gene-C7A06_RS33590"; ID "gene-C7A06_RS33590"; Name "C7A06_RS33590"; Parent "nbis-gene-5675"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33590"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 33980 34957 . + . gene_id "nbis-gene-5675"; transcript_id "gene-C7A06_RS33590"; Dbxref "Genbank:WP_000361610.1"; ID "nbis-exon-5937"; Name "WP_000361610.1"; Ontology_term "GO:0006270" "GO:0003887"; Parent "gene-C7A06_RS33590"; gbkey "CDS"; go_function "DNA-directed DNA polymerase activity|0003887||IEA"; go_process "DNA replication initiation|0006270||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052630.2"; locus_tag "C7A06_RS33590"; product "RepB family plasmid replication initiator protein"; protein_id "WP_000361610.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 33980 34957 . + 0 gene_id "nbis-gene-5675"; transcript_id "gene-C7A06_RS33590"; Dbxref "Genbank:WP_000361610.1"; ID "cds-WP_000361610.1"; Name "WP_000361610.1"; Ontology_term "GO:0006270" "GO:0003887"; Parent "gene-C7A06_RS33590"; gbkey "CDS"; go_function "DNA-directed DNA polymerase activity|0003887||IEA"; go_process "DNA replication initiation|0006270||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052630.2"; locus_tag "C7A06_RS33590"; product "RepB family plasmid replication initiator protein"; protein_id "WP_000361610.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 35141 35347 . + . gene_id "nbis-gene-5676"; ID "nbis-gene-5676"; Name "C7A06_RS33595"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33595";
+NZ_CP027601.1 RefSeq transcript 35141 35347 . + . gene_id "nbis-gene-5676"; transcript_id "gene-C7A06_RS33595"; ID "gene-C7A06_RS33595"; Name "C7A06_RS33595"; Parent "nbis-gene-5676"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33595"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 35141 35347 . + . gene_id "nbis-gene-5676"; transcript_id "gene-C7A06_RS33595"; Dbxref "Genbank:WP_012917682.1"; ID "nbis-exon-5938"; Name "WP_012917682.1"; Parent "gene-C7A06_RS33595"; gbkey "CDS"; inference "COORDINATES: protein motif:HMM:NF013677.2"; locus_tag "C7A06_RS33595"; product "transposase"; protein_id "WP_012917682.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 35141 35347 . + 0 gene_id "nbis-gene-5676"; transcript_id "gene-C7A06_RS33595"; Dbxref "Genbank:WP_012917682.1"; ID "cds-WP_012917682.1"; Name "WP_012917682.1"; Parent "gene-C7A06_RS33595"; gbkey "CDS"; inference "COORDINATES: protein motif:HMM:NF013677.2"; locus_tag "C7A06_RS33595"; product "transposase"; protein_id "WP_012917682.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 35401 36075 . + . gene_id "nbis-gene-5677"; ID "nbis-gene-5677"; Name "tnpA"; gbkey "Gene"; gene "tnpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33600";
+NZ_CP027601.1 RefSeq transcript 35401 36075 . + . gene_id "nbis-gene-5677"; transcript_id "gene-C7A06_RS33600"; ID "gene-C7A06_RS33600"; Name "tnpA"; Parent "nbis-gene-5677"; gbkey "Gene"; gene "tnpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33600"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 35401 36075 . + . gene_id "nbis-gene-5677"; transcript_id "gene-C7A06_RS33600"; Dbxref "Genbank:WP_001341423.1"; ID "nbis-exon-5939"; Name "WP_001341423.1"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33600"; gbkey "CDS"; gene "tnpA"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_311873.1"; locus_tag "C7A06_RS33600"; product "IS66-like element accessory protein TnpA"; protein_id "WP_001341423.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 35401 36075 . + 0 gene_id "nbis-gene-5677"; transcript_id "gene-C7A06_RS33600"; Dbxref "Genbank:WP_001341423.1"; ID "cds-WP_001341423.1-2"; Name "WP_001341423.1"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33600"; gbkey "CDS"; gene "tnpA"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_311873.1"; locus_tag "C7A06_RS33600"; product "IS66-like element accessory protein TnpA"; protein_id "WP_001341423.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 36072 36419 . + . gene_id "nbis-gene-5678"; ID "nbis-gene-5678"; Name "tnpB"; gbkey "Gene"; gene "tnpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33605";
+NZ_CP027601.1 RefSeq transcript 36072 36419 . + . gene_id "nbis-gene-5678"; transcript_id "gene-C7A06_RS33605"; ID "gene-C7A06_RS33605"; Name "tnpB"; Parent "nbis-gene-5678"; gbkey "Gene"; gene "tnpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33605"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 36072 36419 . + . gene_id "nbis-gene-5678"; transcript_id "gene-C7A06_RS33605"; Dbxref "Genbank:WP_000631725.1"; ID "nbis-exon-5940"; Name "WP_000631725.1"; Note "TnpB, as the term is used for proteins encoded by IS66 family insertion elements, is considered an accessory protein, since TnpC, encoded by a neighboring gene, is a DDE family transposase."; Parent "gene-C7A06_RS33605"; gbkey "CDS"; gene "tnpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858152.1"; locus_tag "C7A06_RS33605"; product "IS66 family insertion sequence element accessory protein TnpB"; protein_id "WP_000631725.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 36072 36419 . + 0 gene_id "nbis-gene-5678"; transcript_id "gene-C7A06_RS33605"; Dbxref "Genbank:WP_000631725.1"; ID "cds-WP_000631725.1-2"; Name "WP_000631725.1"; Note "TnpB, as the term is used for proteins encoded by IS66 family insertion elements, is considered an accessory protein, since TnpC, encoded by a neighboring gene, is a DDE family transposase."; Parent "gene-C7A06_RS33605"; gbkey "CDS"; gene "tnpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858152.1"; locus_tag "C7A06_RS33605"; product "IS66 family insertion sequence element accessory protein TnpB"; protein_id "WP_000631725.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 36439 37991 . + . gene_id "nbis-pseudogene-262"; ID "nbis-pseudogene-262"; Name "C7A06_RS33610"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33610"; original_biotype "pseudogene"; pseudo "true";
+NZ_CP027601.1 RefSeq transcript 36439 37991 . + . gene_id "nbis-pseudogene-262"; transcript_id "gene-C7A06_RS33610"; ID "gene-C7A06_RS33610"; Name "C7A06_RS33610"; Parent "nbis-pseudogene-262"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33610"; original_biotype "mrna"; pseudo "true";
+NZ_CP027601.1 Protein Homology exon 36439 37991 . + . gene_id "nbis-pseudogene-262"; transcript_id "gene-C7A06_RS33610"; ID "nbis-exon-5941"; Note "frameshifted"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33610"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001066419.1"; locus_tag "C7A06_RS33610"; product "IS66 family transposase"; pseudo "true"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 36439 37991 . + 0 gene_id "nbis-pseudogene-262"; transcript_id "gene-C7A06_RS33610"; ID "cds-C7A06_RS33610"; Note "frameshifted"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33610"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001066419.1"; locus_tag "C7A06_RS33610"; product "IS66 family transposase"; pseudo "true"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 38025 38414 . + . gene_id "nbis-pseudogene-263"; ID "nbis-pseudogene-263"; Name "C7A06_RS33615"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33615"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "38025";
+NZ_CP027601.1 RefSeq transcript 38025 38414 . + . gene_id "nbis-pseudogene-263"; transcript_id "gene-C7A06_RS33615"; ID "gene-C7A06_RS33615"; Name "C7A06_RS33615"; Parent "nbis-pseudogene-263"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33615"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "38025";
+NZ_CP027601.1 Protein Homology exon 38025 38414 . + . gene_id "nbis-pseudogene-263"; transcript_id "gene-C7A06_RS33615"; ID "nbis-exon-5942"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS33615"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052628.1"; locus_tag "C7A06_RS33615"; partial "true"; product "site-specific integrase"; pseudo "true"; start_range "." "38025"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 38025 38414 . + 0 gene_id "nbis-pseudogene-263"; transcript_id "gene-C7A06_RS33615"; ID "cds-C7A06_RS33615"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS33615"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052628.1"; locus_tag "C7A06_RS33615"; partial "true"; product "site-specific integrase"; pseudo "true"; start_range "." "38025"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 38815 39180 . + . gene_id "nbis-gene-5679"; ID "nbis-gene-5679"; Name "C7A06_RS33625"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33625";
+NZ_CP027601.1 RefSeq transcript 38815 39180 . + . gene_id "nbis-gene-5679"; transcript_id "gene-C7A06_RS33625"; ID "gene-C7A06_RS33625"; Name "C7A06_RS33625"; Parent "nbis-gene-5679"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33625"; original_biotype "mrna";
+NZ_CP027601.1 GeneMarkS-2+ exon 38815 39180 . + . gene_id "nbis-gene-5679"; transcript_id "gene-C7A06_RS33625"; Dbxref "Genbank:WP_000091308.1"; ID "nbis-exon-5943"; Name "WP_000091308.1"; Parent "gene-C7A06_RS33625"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS33625"; product "hypothetical protein"; protein_id "WP_000091308.1"; transl_table "11";
+NZ_CP027601.1 GeneMarkS-2+ CDS 38815 39180 . + 0 gene_id "nbis-gene-5679"; transcript_id "gene-C7A06_RS33625"; Dbxref "Genbank:WP_000091308.1"; ID "cds-WP_000091308.1"; Name "WP_000091308.1"; Parent "gene-C7A06_RS33625"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS33625"; product "hypothetical protein"; protein_id "WP_000091308.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 39180 40367 . + . gene_id "nbis-gene-5680"; ID "nbis-gene-5680"; Name "C7A06_RS33630"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33630";
+NZ_CP027601.1 RefSeq transcript 39180 40367 . + . gene_id "nbis-gene-5680"; transcript_id "gene-C7A06_RS33630"; ID "gene-C7A06_RS33630"; Name "C7A06_RS33630"; Parent "nbis-gene-5680"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33630"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 39180 40367 . + . gene_id "nbis-gene-5680"; transcript_id "gene-C7A06_RS33630"; Dbxref "Genbank:WP_000937603.1"; ID "nbis-exon-5944"; Name "WP_000937603.1"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33630"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_013747467.1"; locus_tag "C7A06_RS33630"; product "IS91 family transposase"; protein_id "WP_000937603.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 39180 40367 . + 0 gene_id "nbis-gene-5680"; transcript_id "gene-C7A06_RS33630"; Dbxref "Genbank:WP_000937603.1"; ID "cds-WP_000937603.1"; Name "WP_000937603.1"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33630"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_013747467.1"; locus_tag "C7A06_RS33630"; product "IS91 family transposase"; protein_id "WP_000937603.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 40646 42198 . - . gene_id "nbis-pseudogene-264"; ID "nbis-pseudogene-264"; Name "C7A06_RS33635"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33635"; original_biotype "pseudogene"; pseudo "true";
+NZ_CP027601.1 RefSeq transcript 40646 42198 . - . gene_id "nbis-pseudogene-264"; transcript_id "gene-C7A06_RS33635"; ID "gene-C7A06_RS33635"; Name "C7A06_RS33635"; Parent "nbis-pseudogene-264"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33635"; original_biotype "mrna"; pseudo "true";
+NZ_CP027601.1 Protein Homology exon 40646 42198 . - . gene_id "nbis-pseudogene-264"; transcript_id "gene-C7A06_RS33635"; ID "nbis-exon-5945"; Note "frameshifted"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33635"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001066419.1"; locus_tag "C7A06_RS33635"; product "IS66 family transposase"; pseudo "true"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 40646 42198 . - 0 gene_id "nbis-pseudogene-264"; transcript_id "gene-C7A06_RS33635"; ID "cds-C7A06_RS33635"; Note "frameshifted"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33635"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001066419.1"; locus_tag "C7A06_RS33635"; product "IS66 family transposase"; pseudo "true"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 42218 42565 . - . gene_id "nbis-gene-5681"; ID "nbis-gene-5681"; Name "tnpB"; gbkey "Gene"; gene "tnpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33640";
+NZ_CP027601.1 RefSeq transcript 42218 42565 . - . gene_id "nbis-gene-5681"; transcript_id "gene-C7A06_RS33640"; ID "gene-C7A06_RS33640"; Name "tnpB"; Parent "nbis-gene-5681"; gbkey "Gene"; gene "tnpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33640"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 42218 42565 . - . gene_id "nbis-gene-5681"; transcript_id "gene-C7A06_RS33640"; Dbxref "Genbank:WP_000631725.1"; ID "nbis-exon-5946"; Name "WP_000631725.1"; Note "TnpB, as the term is used for proteins encoded by IS66 family insertion elements, is considered an accessory protein, since TnpC, encoded by a neighboring gene, is a DDE family transposase."; Parent "gene-C7A06_RS33640"; gbkey "CDS"; gene "tnpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858152.1"; locus_tag "C7A06_RS33640"; product "IS66 family insertion sequence element accessory protein TnpB"; protein_id "WP_000631725.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 42218 42565 . - 0 gene_id "nbis-gene-5681"; transcript_id "gene-C7A06_RS33640"; Dbxref "Genbank:WP_000631725.1"; ID "cds-WP_000631725.1-3"; Name "WP_000631725.1"; Note "TnpB, as the term is used for proteins encoded by IS66 family insertion elements, is considered an accessory protein, since TnpC, encoded by a neighboring gene, is a DDE family transposase."; Parent "gene-C7A06_RS33640"; gbkey "CDS"; gene "tnpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858152.1"; locus_tag "C7A06_RS33640"; product "IS66 family insertion sequence element accessory protein TnpB"; protein_id "WP_000631725.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 42562 43236 . - . gene_id "nbis-gene-5682"; ID "nbis-gene-5682"; Name "tnpA"; gbkey "Gene"; gene "tnpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33645";
+NZ_CP027601.1 RefSeq transcript 42562 43236 . - . gene_id "nbis-gene-5682"; transcript_id "gene-C7A06_RS33645"; ID "gene-C7A06_RS33645"; Name "tnpA"; Parent "nbis-gene-5682"; gbkey "Gene"; gene "tnpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33645"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 42562 43236 . - . gene_id "nbis-gene-5682"; transcript_id "gene-C7A06_RS33645"; Dbxref "Genbank:WP_001341423.1"; ID "nbis-exon-5947"; Name "WP_001341423.1"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33645"; gbkey "CDS"; gene "tnpA"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_311873.1"; locus_tag "C7A06_RS33645"; product "IS66-like element accessory protein TnpA"; protein_id "WP_001341423.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 42562 43236 . - 0 gene_id "nbis-gene-5682"; transcript_id "gene-C7A06_RS33645"; Dbxref "Genbank:WP_001341423.1"; ID "cds-WP_001341423.1-3"; Name "WP_001341423.1"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33645"; gbkey "CDS"; gene "tnpA"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_311873.1"; locus_tag "C7A06_RS33645"; product "IS66-like element accessory protein TnpA"; protein_id "WP_001341423.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 43320 43676 . - . gene_id "nbis-pseudogene-265"; ID "nbis-pseudogene-265"; Name "C7A06_RS33650"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33650"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "43320";
+NZ_CP027601.1 RefSeq transcript 43320 43676 . - . gene_id "nbis-pseudogene-265"; transcript_id "gene-C7A06_RS33650"; ID "gene-C7A06_RS33650"; Name "C7A06_RS33650"; Parent "nbis-pseudogene-265"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33650"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "43320";
+NZ_CP027601.1 Protein Homology exon 43320 43676 . - . gene_id "nbis-pseudogene-265"; transcript_id "gene-C7A06_RS33650"; ID "nbis-exon-5948"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Ontology_term "GO:0006310" "GO:0015074" "GO:0003677"; Parent "gene-C7A06_RS33650"; gbkey "CDS"; go_function "DNA binding|0003677||IEA"; go_process "DNA recombination|0006310||IEA" "DNA integration|0015074||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052628.1"; locus_tag "C7A06_RS33650"; partial "true"; product "tyrosine-type recombinase/integrase"; pseudo "true"; start_range "." "43320"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 43320 43676 . - 0 gene_id "nbis-pseudogene-265"; transcript_id "gene-C7A06_RS33650"; ID "cds-C7A06_RS33650"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Ontology_term "GO:0006310" "GO:0015074" "GO:0003677"; Parent "gene-C7A06_RS33650"; gbkey "CDS"; go_function "DNA binding|0003677||IEA"; go_process "DNA recombination|0006310||IEA" "DNA integration|0015074||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052628.1"; locus_tag "C7A06_RS33650"; partial "true"; product "tyrosine-type recombinase/integrase"; pseudo "true"; start_range "." "43320"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 43804 44664 . + . gene_id "nbis-gene-5683"; ID "nbis-gene-5683"; Name "C7A06_RS33655"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33655";
+NZ_CP027601.1 RefSeq transcript 43804 44664 . + . gene_id "nbis-gene-5683"; transcript_id "gene-C7A06_RS33655"; ID "gene-C7A06_RS33655"; Name "C7A06_RS33655"; Parent "nbis-gene-5683"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33655"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 43804 44664 . + . gene_id "nbis-gene-5683"; transcript_id "gene-C7A06_RS33655"; Dbxref "Genbank:WP_000704534.1"; ID "nbis-exon-5949"; Name "WP_000704534.1"; Parent "gene-C7A06_RS33655"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052670.1"; locus_tag "C7A06_RS33655"; product "alpha/beta hydrolase"; protein_id "WP_000704534.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 43804 44664 . + 0 gene_id "nbis-gene-5683"; transcript_id "gene-C7A06_RS33655"; Dbxref "Genbank:WP_000704534.1"; ID "cds-WP_000704534.1"; Name "WP_000704534.1"; Parent "gene-C7A06_RS33655"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052670.1"; locus_tag "C7A06_RS33655"; product "alpha/beta hydrolase"; protein_id "WP_000704534.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 45279 45428 . + . gene_id "nbis-gene-5806"; ID "nbis-gene-5806"; Name "C7A06_RS34665"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34665";
+NZ_CP027601.1 RefSeq transcript 45279 45428 . + . gene_id "nbis-gene-5806"; transcript_id "gene-C7A06_RS34665"; ID "gene-C7A06_RS34665"; Name "C7A06_RS34665"; Parent "nbis-gene-5806"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34665"; original_biotype "mrna";
+NZ_CP027601.1 GeneMarkS-2+ exon 45279 45428 . + . gene_id "nbis-gene-5806"; transcript_id "gene-C7A06_RS34665"; Dbxref "Genbank:WP_000955366.1"; ID "nbis-exon-6115"; Name "WP_000955366.1"; Parent "gene-C7A06_RS34665"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS34665"; product "hypothetical protein"; protein_id "WP_000955366.1"; transl_table "11";
+NZ_CP027601.1 GeneMarkS-2+ CDS 45279 45428 . + 0 gene_id "nbis-gene-5806"; transcript_id "gene-C7A06_RS34665"; Dbxref "Genbank:WP_000955366.1"; ID "cds-WP_000955366.1"; Name "WP_000955366.1"; Parent "gene-C7A06_RS34665"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS34665"; product "hypothetical protein"; protein_id "WP_000955366.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 45469 46625 . - . gene_id "nbis-gene-5684"; ID "nbis-gene-5684"; Name "C7A06_RS33660"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33660";
+NZ_CP027601.1 RefSeq transcript 45469 46625 . - . gene_id "nbis-gene-5684"; transcript_id "gene-C7A06_RS33660"; ID "gene-C7A06_RS33660"; Name "C7A06_RS33660"; Parent "nbis-gene-5684"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33660"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 45469 46625 . - . gene_id "nbis-gene-5684"; transcript_id "gene-C7A06_RS33660"; Dbxref "Genbank:WP_085948186.1"; ID "nbis-exon-5950"; Name "WP_085948186.1"; Note "programmed frameshift"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33660"; exception "ribosomal slippage"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611998.1"; locus_tag "C7A06_RS33660"; product "IS3 family transposase"; protein_id "WP_085948186.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 45469 46625 . - 2 gene_id "nbis-gene-5684"; transcript_id "gene-C7A06_RS33660"; Dbxref "Genbank:WP_085948186.1"; ID "cds-WP_085948186.1-12"; Name "WP_085948186.1"; Note "programmed frameshift"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33660"; exception "ribosomal slippage"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611998.1"; locus_tag "C7A06_RS33660"; product "IS3 family transposase"; protein_id "WP_085948186.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 46693 47238 . + . gene_id "nbis-gene-5685"; ID "nbis-gene-5685"; Name "C7A06_RS33665"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33665";
+NZ_CP027601.1 RefSeq transcript 46693 47238 . + . gene_id "nbis-gene-5685"; transcript_id "gene-C7A06_RS33665"; ID "gene-C7A06_RS33665"; Name "C7A06_RS33665"; Parent "nbis-gene-5685"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33665"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 46693 47238 . + . gene_id "nbis-gene-5685"; transcript_id "gene-C7A06_RS33665"; Dbxref "Genbank:WP_001165114.1"; ID "nbis-exon-5951"; Name "WP_001165114.1"; Parent "gene-C7A06_RS33665"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001165114.1"; locus_tag "C7A06_RS33665"; product "hypothetical protein"; protein_id "WP_001165114.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 46693 47238 . + 0 gene_id "nbis-gene-5685"; transcript_id "gene-C7A06_RS33665"; Dbxref "Genbank:WP_001165114.1"; ID "cds-WP_001165114.1"; Name "WP_001165114.1"; Parent "gene-C7A06_RS33665"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001165114.1"; locus_tag "C7A06_RS33665"; product "hypothetical protein"; protein_id "WP_001165114.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 47400 47816 . - . gene_id "nbis-gene-5686"; ID "nbis-gene-5686"; Name "C7A06_RS33670"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33670";
+NZ_CP027601.1 RefSeq transcript 47400 47816 . - . gene_id "nbis-gene-5686"; transcript_id "gene-C7A06_RS33670"; ID "gene-C7A06_RS33670"; Name "C7A06_RS33670"; Parent "nbis-gene-5686"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33670"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 47400 47816 . - . gene_id "nbis-gene-5686"; transcript_id "gene-C7A06_RS33670"; Dbxref "Genbank:WP_001044768.1"; ID "nbis-exon-5952"; Name "WP_001044768.1"; Parent "gene-C7A06_RS33670"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_005229630.1"; locus_tag "C7A06_RS33670"; product "type II toxin-antitoxin system VapC family toxin"; protein_id "WP_001044768.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 47400 47816 . - 0 gene_id "nbis-gene-5686"; transcript_id "gene-C7A06_RS33670"; Dbxref "Genbank:WP_001044768.1"; ID "cds-WP_001044768.1"; Name "WP_001044768.1"; Parent "gene-C7A06_RS33670"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_005229630.1"; locus_tag "C7A06_RS33670"; product "type II toxin-antitoxin system VapC family toxin"; protein_id "WP_001044768.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 47813 48043 . - . gene_id "nbis-gene-5687"; ID "nbis-gene-5687"; Name "vapB"; gbkey "Gene"; gene "vapB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33675";
+NZ_CP027601.1 RefSeq transcript 47813 48043 . - . gene_id "nbis-gene-5687"; transcript_id "gene-C7A06_RS33675"; ID "gene-C7A06_RS33675"; Name "vapB"; Parent "nbis-gene-5687"; gbkey "Gene"; gene "vapB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33675"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 47813 48043 . - . gene_id "nbis-gene-5687"; transcript_id "gene-C7A06_RS33675"; Dbxref "Genbank:WP_001261287.1"; ID "nbis-exon-5953"; Name "WP_001261287.1"; Parent "gene-C7A06_RS33675"; gbkey "CDS"; gene "vapB"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_005229629.1"; locus_tag "C7A06_RS33675"; product "type II toxin-antitoxin system VapB family antitoxin"; protein_id "WP_001261287.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 47813 48043 . - 0 gene_id "nbis-gene-5687"; transcript_id "gene-C7A06_RS33675"; Dbxref "Genbank:WP_001261287.1"; ID "cds-WP_001261287.1"; Name "WP_001261287.1"; Parent "gene-C7A06_RS33675"; gbkey "CDS"; gene "vapB"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_005229629.1"; locus_tag "C7A06_RS33675"; product "type II toxin-antitoxin system VapB family antitoxin"; protein_id "WP_001261287.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 48603 49016 . + . gene_id "nbis-gene-5688"; ID "nbis-gene-5688"; Name "C7A06_RS33695"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33695";
+NZ_CP027601.1 RefSeq transcript 48603 49016 . + . gene_id "nbis-gene-5688"; transcript_id "gene-C7A06_RS33695"; ID "gene-C7A06_RS33695"; Name "C7A06_RS33695"; Parent "nbis-gene-5688"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33695"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 48603 49016 . + . gene_id "nbis-gene-5688"; transcript_id "gene-C7A06_RS33695"; Dbxref "Genbank:WP_000465041.1"; ID "nbis-exon-5954"; Name "WP_000465041.1"; Parent "gene-C7A06_RS33695"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001536595.1"; locus_tag "C7A06_RS33695"; product "hypothetical protein"; protein_id "WP_000465041.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 48603 49016 . + 0 gene_id "nbis-gene-5688"; transcript_id "gene-C7A06_RS33695"; Dbxref "Genbank:WP_000465041.1"; ID "cds-WP_000465041.1"; Name "WP_000465041.1"; Parent "gene-C7A06_RS33695"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001536595.1"; locus_tag "C7A06_RS33695"; product "hypothetical protein"; protein_id "WP_000465041.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 49018 49800 . + . gene_id "nbis-gene-5689"; ID "nbis-gene-5689"; Name "C7A06_RS33700"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33700";
+NZ_CP027601.1 RefSeq transcript 49018 49800 . + . gene_id "nbis-gene-5689"; transcript_id "gene-C7A06_RS33700"; ID "gene-C7A06_RS33700"; Name "C7A06_RS33700"; Parent "nbis-gene-5689"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33700"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 49018 49800 . + . gene_id "nbis-gene-5689"; transcript_id "gene-C7A06_RS33700"; Dbxref "Genbank:WP_001164205.1"; ID "nbis-exon-5955"; Name "WP_001164205.1"; Parent "gene-C7A06_RS33700"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001164193.1"; locus_tag "C7A06_RS33700"; product "site-specific integrase"; protein_id "WP_001164205.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 49018 49800 . + 0 gene_id "nbis-gene-5689"; transcript_id "gene-C7A06_RS33700"; Dbxref "Genbank:WP_001164205.1"; ID "cds-WP_001164205.1"; Name "WP_001164205.1"; Parent "gene-C7A06_RS33700"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001164193.1"; locus_tag "C7A06_RS33700"; product "site-specific integrase"; protein_id "WP_001164205.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 49972 50325 . + . gene_id "nbis-gene-5690"; ID "nbis-gene-5690"; Name "cmi"; gbkey "Gene"; gene "cmi"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33705";
+NZ_CP027601.1 RefSeq transcript 49972 50325 . + . gene_id "nbis-gene-5690"; transcript_id "gene-C7A06_RS33705"; ID "gene-C7A06_RS33705"; Name "cmi"; Parent "nbis-gene-5690"; gbkey "Gene"; gene "cmi"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33705"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 49972 50325 . + . gene_id "nbis-gene-5690"; transcript_id "gene-C7A06_RS33705"; Dbxref "Genbank:WP_000864810.1"; ID "nbis-exon-5956"; Name "WP_000864810.1"; Parent "gene-C7A06_RS33705"; gbkey "CDS"; gene "cmi"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_104216667.1"; locus_tag "C7A06_RS33705"; product "colicin M immunity protein"; protein_id "WP_000864810.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 49972 50325 . + 0 gene_id "nbis-gene-5690"; transcript_id "gene-C7A06_RS33705"; Dbxref "Genbank:WP_000864810.1"; ID "cds-WP_000864810.1"; Name "WP_000864810.1"; Parent "gene-C7A06_RS33705"; gbkey "CDS"; gene "cmi"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_104216667.1"; locus_tag "C7A06_RS33705"; product "colicin M immunity protein"; protein_id "WP_000864810.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 50333 50524 . - . gene_id "nbis-pseudogene-266"; ID "nbis-pseudogene-266"; Name "C7A06_RS33710"; end_range "50524" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33710"; original_biotype "pseudogene"; partial "true"; pseudo "true";
+NZ_CP027601.1 RefSeq transcript 50333 50524 . - . gene_id "nbis-pseudogene-266"; transcript_id "gene-C7A06_RS33710"; ID "gene-C7A06_RS33710"; Name "C7A06_RS33710"; Parent "nbis-pseudogene-266"; end_range "50524" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33710"; original_biotype "mrna"; partial "true"; pseudo "true";
+NZ_CP027601.1 Protein Homology exon 50333 50524 . - . gene_id "nbis-pseudogene-266"; transcript_id "gene-C7A06_RS33710"; ID "nbis-exon-5957"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Ontology_term "GO:0042742"; Parent "gene-C7A06_RS33710"; end_range "50524" "."; gbkey "CDS"; go_process "defense response to bacterium|0042742||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000449473.1"; locus_tag "C7A06_RS33710"; partial "true"; product "lipid II-degrading bacteriocin"; pseudo "true"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 50333 50524 . - 0 gene_id "nbis-pseudogene-266"; transcript_id "gene-C7A06_RS33710"; ID "cds-C7A06_RS33710"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Ontology_term "GO:0042742"; Parent "gene-C7A06_RS33710"; end_range "50524" "."; gbkey "CDS"; go_process "defense response to bacterium|0042742||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000449473.1"; locus_tag "C7A06_RS33710"; partial "true"; product "lipid II-degrading bacteriocin"; pseudo "true"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 50528 50671 . - . gene_id "nbis-pseudogene-267"; ID "nbis-pseudogene-267"; Name "C7A06_RS33715"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33715"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "50528";
+NZ_CP027601.1 RefSeq transcript 50528 50671 . - . gene_id "nbis-pseudogene-267"; transcript_id "gene-C7A06_RS33715"; ID "gene-C7A06_RS33715"; Name "C7A06_RS33715"; Parent "nbis-pseudogene-267"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33715"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "50528";
+NZ_CP027601.1 Protein Homology exon 50528 50671 . - . gene_id "nbis-pseudogene-267"; transcript_id "gene-C7A06_RS33715"; ID "nbis-exon-5958"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33715"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_958720.1"; locus_tag "C7A06_RS33715"; partial "true"; product "transcriptional regulator"; pseudo "true"; start_range "." "50528"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 50528 50671 . - 0 gene_id "nbis-pseudogene-267"; transcript_id "gene-C7A06_RS33715"; ID "cds-C7A06_RS33715"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33715"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_958720.1"; locus_tag "C7A06_RS33715"; partial "true"; product "transcriptional regulator"; pseudo "true"; start_range "." "50528"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 50738 52176 . - . gene_id "nbis-pseudogene-268"; ID "nbis-pseudogene-268"; Name "ehxD"; gbkey "Gene"; gene "ehxD"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33720"; original_biotype "pseudogene"; pseudo "true";
+NZ_CP027601.1 RefSeq transcript 50738 52176 . - . gene_id "nbis-pseudogene-268"; transcript_id "gene-C7A06_RS33720"; ID "gene-C7A06_RS33720"; Name "ehxD"; Parent "nbis-pseudogene-268"; gbkey "Gene"; gene "ehxD"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33720"; original_biotype "mrna"; pseudo "true";
+NZ_CP027601.1 Protein Homology exon 50738 52176 . - . gene_id "nbis-pseudogene-268"; transcript_id "gene-C7A06_RS33720"; ID "nbis-exon-5959"; Note "frameshifted"; Parent "gene-C7A06_RS33720"; gbkey "CDS"; gene "ehxD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052626.1"; locus_tag "C7A06_RS33720"; product "enterohemolysin T1SS ABC transporter subunit EhxD"; pseudo "true"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 50738 52176 . - 0 gene_id "nbis-pseudogene-268"; transcript_id "gene-C7A06_RS33720"; ID "cds-C7A06_RS33720"; Note "frameshifted"; Parent "gene-C7A06_RS33720"; gbkey "CDS"; gene "ehxD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052626.1"; locus_tag "C7A06_RS33720"; product "enterohemolysin T1SS ABC transporter subunit EhxD"; pseudo "true"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 52180 54300 . - . gene_id "nbis-gene-5691"; ID "nbis-gene-5691"; Name "ehxB"; gbkey "Gene"; gene "ehxB"; gene_biotype "protein_coding"; gene_synonym "hlyB"; locus_tag "C7A06_RS33725";
+NZ_CP027601.1 RefSeq transcript 52180 54300 . - . gene_id "nbis-gene-5691"; transcript_id "gene-C7A06_RS33725"; ID "gene-C7A06_RS33725"; Name "ehxB"; Parent "nbis-gene-5691"; gbkey "Gene"; gene "ehxB"; gene_biotype "protein_coding"; gene_synonym "hlyB"; locus_tag "C7A06_RS33725"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 52180 54300 . - . gene_id "nbis-gene-5691"; transcript_id "gene-C7A06_RS33725"; Dbxref "Genbank:WP_000987096.1"; ID "nbis-exon-5960"; Name "WP_000987096.1"; Parent "gene-C7A06_RS33725"; gbkey "CDS"; gene "ehxB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052625.1"; locus_tag "C7A06_RS33725"; product "enterohemolysin T1SS ABC transporter permease/ATPase EhxB"; protein_id "WP_000987096.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 52180 54300 . - 0 gene_id "nbis-gene-5691"; transcript_id "gene-C7A06_RS33725"; Dbxref "Genbank:WP_000987096.1"; ID "cds-WP_000987096.1"; Name "WP_000987096.1"; Parent "gene-C7A06_RS33725"; gbkey "CDS"; gene "ehxB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052625.1"; locus_tag "C7A06_RS33725"; product "enterohemolysin T1SS ABC transporter permease/ATPase EhxB"; protein_id "WP_000987096.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 54350 57346 . - . gene_id "nbis-gene-5692"; ID "nbis-gene-5692"; Name "ehxA"; gbkey "Gene"; gene "ehxA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33730";
+NZ_CP027601.1 RefSeq transcript 54350 57346 . - . gene_id "nbis-gene-5692"; transcript_id "gene-C7A06_RS33730"; ID "gene-C7A06_RS33730"; Name "ehxA"; Parent "nbis-gene-5692"; gbkey "Gene"; gene "ehxA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33730"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 54350 57346 . - . gene_id "nbis-gene-5692"; transcript_id "gene-C7A06_RS33730"; Dbxref "Genbank:WP_000217745.1"; ID "nbis-exon-5961"; Name "WP_000217745.1"; Parent "gene-C7A06_RS33730"; gbkey "CDS"; gene "ehxA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052624.1"; locus_tag "C7A06_RS33730"; product "enterohemolysin EhxA"; protein_id "WP_000217745.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 54350 57346 . - 0 gene_id "nbis-gene-5692"; transcript_id "gene-C7A06_RS33730"; Dbxref "Genbank:WP_000217745.1"; ID "cds-WP_000217745.1"; Name "WP_000217745.1"; Parent "gene-C7A06_RS33730"; gbkey "CDS"; gene "ehxA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052624.1"; locus_tag "C7A06_RS33730"; product "enterohemolysin EhxA"; protein_id "WP_000217745.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 57348 57862 . - . gene_id "nbis-pseudogene-269"; ID "nbis-pseudogene-269"; Name "ehxC"; gbkey "Gene"; gene "ehxC"; gene_biotype "pseudogene"; gene_synonym "hlyC"; locus_tag "C7A06_RS33735"; original_biotype "pseudogene"; pseudo "true";
+NZ_CP027601.1 RefSeq transcript 57348 57862 . - . gene_id "nbis-pseudogene-269"; transcript_id "gene-C7A06_RS33735"; ID "gene-C7A06_RS33735"; Name "ehxC"; Parent "nbis-pseudogene-269"; gbkey "Gene"; gene "ehxC"; gene_biotype "pseudogene"; gene_synonym "hlyC"; locus_tag "C7A06_RS33735"; original_biotype "mrna"; pseudo "true";
+NZ_CP027601.1 Protein Homology exon 57348 57862 . - . gene_id "nbis-pseudogene-269"; transcript_id "gene-C7A06_RS33735"; ID "nbis-exon-5962"; Note "frameshifted"; Parent "gene-C7A06_RS33735"; gbkey "CDS"; gene "ehxC"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000839950.1"; locus_tag "C7A06_RS33735"; product "enterohemolysin-activating lysine-acyltransferase EhxC"; pseudo "true"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 57348 57862 . - 0 gene_id "nbis-pseudogene-269"; transcript_id "gene-C7A06_RS33735"; ID "cds-C7A06_RS33735"; Note "frameshifted"; Parent "gene-C7A06_RS33735"; gbkey "CDS"; gene "ehxC"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000839950.1"; locus_tag "C7A06_RS33735"; product "enterohemolysin-activating lysine-acyltransferase EhxC"; pseudo "true"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 58385 59037 . - . gene_id "nbis-pseudogene-270"; ID "nbis-pseudogene-270"; Name "C7A06_RS33745"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33745"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "58385";
+NZ_CP027601.1 RefSeq transcript 58385 59037 . - . gene_id "nbis-pseudogene-270"; transcript_id "gene-C7A06_RS33745"; ID "gene-C7A06_RS33745"; Name "C7A06_RS33745"; Parent "nbis-pseudogene-270"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33745"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "58385";
+NZ_CP027601.1 Protein Homology exon 58385 59037 . - . gene_id "nbis-pseudogene-270"; transcript_id "gene-C7A06_RS33745"; ID "nbis-exon-5963"; Note "frameshifted; incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33745"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076612086.1"; locus_tag "C7A06_RS33745"; partial "true"; product "IS3 family transposase"; pseudo "true"; start_range "." "58385"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 58385 59037 . - 0 gene_id "nbis-pseudogene-270"; transcript_id "gene-C7A06_RS33745"; ID "cds-C7A06_RS33745"; Note "frameshifted; incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33745"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076612086.1"; locus_tag "C7A06_RS33745"; partial "true"; product "IS3 family transposase"; pseudo "true"; start_range "." "58385"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 60511 61332 . + . gene_id "nbis-gene-5693"; ID "nbis-gene-5693"; Name "C7A06_RS33755"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33755";
+NZ_CP027601.1 RefSeq transcript 60511 61332 . + . gene_id "nbis-gene-5693"; transcript_id "gene-C7A06_RS33755"; ID "gene-C7A06_RS33755"; Name "C7A06_RS33755"; Parent "nbis-gene-5693"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33755"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 60511 61332 . + . gene_id "nbis-gene-5693"; transcript_id "gene-C7A06_RS33755"; Dbxref "Genbank:WP_001302199.1"; ID "nbis-exon-5964"; Name "WP_001302199.1"; Parent "gene-C7A06_RS33755"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001302199.1"; locus_tag "C7A06_RS33755"; product "polysaccharide deacetylase family protein"; protein_id "WP_001302199.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 60511 61332 . + 0 gene_id "nbis-gene-5693"; transcript_id "gene-C7A06_RS33755"; Dbxref "Genbank:WP_001302199.1"; ID "cds-WP_001302199.1"; Name "WP_001302199.1"; Parent "gene-C7A06_RS33755"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001302199.1"; locus_tag "C7A06_RS33755"; product "polysaccharide deacetylase family protein"; protein_id "WP_001302199.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 61332 62438 . + . gene_id "nbis-gene-5694"; ID "nbis-gene-5694"; Name "C7A06_RS33760"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33760";
+NZ_CP027601.1 RefSeq transcript 61332 62438 . + . gene_id "nbis-gene-5694"; transcript_id "gene-C7A06_RS33760"; ID "gene-C7A06_RS33760"; Name "C7A06_RS33760"; Parent "nbis-gene-5694"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33760"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 61332 62438 . + . gene_id "nbis-gene-5694"; transcript_id "gene-C7A06_RS33760"; Dbxref "Genbank:WP_000975743.1"; ID "nbis-exon-5965"; Name "WP_000975743.1"; Parent "gene-C7A06_RS33760"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052687.1"; locus_tag "C7A06_RS33760"; product "glycosyltransferase family 4 protein"; protein_id "WP_000975743.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 61332 62438 . + 0 gene_id "nbis-gene-5694"; transcript_id "gene-C7A06_RS33760"; Dbxref "Genbank:WP_000975743.1"; ID "cds-WP_000975743.1"; Name "WP_000975743.1"; Parent "gene-C7A06_RS33760"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052687.1"; locus_tag "C7A06_RS33760"; product "glycosyltransferase family 4 protein"; protein_id "WP_000975743.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 62532 64253 . + . gene_id "nbis-gene-5695"; ID "nbis-gene-5695"; Name "cptA"; gbkey "Gene"; gene "cptA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33765";
+NZ_CP027601.1 RefSeq transcript 62532 64253 . + . gene_id "nbis-gene-5695"; transcript_id "gene-C7A06_RS33765"; ID "gene-C7A06_RS33765"; Name "cptA"; Parent "nbis-gene-5695"; gbkey "Gene"; gene "cptA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33765"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 62532 64253 . + . gene_id "nbis-gene-5695"; transcript_id "gene-C7A06_RS33765"; Dbxref "Genbank:WP_000550559.1"; ID "nbis-exon-5966"; Name "WP_000550559.1"; Parent "gene-C7A06_RS33765"; gbkey "CDS"; gene "cptA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052688.1"; locus_tag "C7A06_RS33765"; product "phosphoethanolamine transferase CptA"; protein_id "WP_000550559.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 62532 64253 . + 0 gene_id "nbis-gene-5695"; transcript_id "gene-C7A06_RS33765"; Dbxref "Genbank:WP_000550559.1"; ID "cds-WP_000550559.1"; Name "WP_000550559.1"; Parent "gene-C7A06_RS33765"; gbkey "CDS"; gene "cptA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052688.1"; locus_tag "C7A06_RS33765"; product "phosphoethanolamine transferase CptA"; protein_id "WP_000550559.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 64327 65325 . + . gene_id "nbis-gene-5696"; ID "nbis-gene-5696"; Name "lpxM"; gbkey "Gene"; gene "lpxM"; gene_biotype "protein_coding"; gene_synonym "msbB"; locus_tag "C7A06_RS33770";
+NZ_CP027601.1 RefSeq transcript 64327 65325 . + . gene_id "nbis-gene-5696"; transcript_id "gene-C7A06_RS33770"; ID "gene-C7A06_RS33770"; Name "lpxM"; Parent "nbis-gene-5696"; gbkey "Gene"; gene "lpxM"; gene_biotype "protein_coding"; gene_synonym "msbB"; locus_tag "C7A06_RS33770"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 64327 65325 . + . gene_id "nbis-gene-5696"; transcript_id "gene-C7A06_RS33770"; Dbxref "Genbank:WP_012680945.1"; ID "nbis-exon-5967"; Name "WP_012680945.1"; Note "LpxM is lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase, an enzyme characterized in Escherichia coli and involved in biosynthesis of the form of lipid A found in that species and some closely related species."; Ontology_term "GO:0009245" "GO:0016746"; Parent "gene-C7A06_RS33770"; gbkey "CDS"; gene "lpxM"; go_function "acyltransferase activity|0016746||IEA"; go_process "lipid A biosynthetic process|0009245||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052689.1"; locus_tag "C7A06_RS33770"; product "lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase"; protein_id "WP_012680945.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 64327 65325 . + 0 gene_id "nbis-gene-5696"; transcript_id "gene-C7A06_RS33770"; Dbxref "Genbank:WP_012680945.1"; ID "cds-WP_012680945.1"; Name "WP_012680945.1"; Note "LpxM is lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase, an enzyme characterized in Escherichia coli and involved in biosynthesis of the form of lipid A found in that species and some closely related species."; Ontology_term "GO:0009245" "GO:0016746"; Parent "gene-C7A06_RS33770"; gbkey "CDS"; gene "lpxM"; go_function "acyltransferase activity|0016746||IEA"; go_process "lipid A biosynthetic process|0009245||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052689.1"; locus_tag "C7A06_RS33770"; product "lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase"; protein_id "WP_012680945.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 65378 65566 . + . gene_id "nbis-pseudogene-271"; ID "nbis-pseudogene-271"; Name "C7A06_RS33775"; end_range "65566" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33775"; original_biotype "pseudogene"; partial "true"; pseudo "true";
+NZ_CP027601.1 RefSeq transcript 65378 65566 . + . gene_id "nbis-pseudogene-271"; transcript_id "gene-C7A06_RS33775"; ID "gene-C7A06_RS33775"; Name "C7A06_RS33775"; Parent "nbis-pseudogene-271"; end_range "65566" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33775"; original_biotype "mrna"; partial "true"; pseudo "true";
+NZ_CP027601.1 Protein Homology exon 65378 65566 . + . gene_id "nbis-pseudogene-271"; transcript_id "gene-C7A06_RS33775"; ID "nbis-exon-5968"; Note "internal stop; incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33775"; end_range "65566" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012767718.1"; locus_tag "C7A06_RS33775"; partial "true"; product "hypothetical protein"; pseudo "true"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 65378 65566 . + 0 gene_id "nbis-pseudogene-271"; transcript_id "gene-C7A06_RS33775"; ID "cds-C7A06_RS33775"; Note "internal stop; incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33775"; end_range "65566" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012767718.1"; locus_tag "C7A06_RS33775"; partial "true"; product "hypothetical protein"; pseudo "true"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 65629 67167 . - . gene_id "nbis-gene-5697"; ID "nbis-gene-5697"; Name "C7A06_RS33780"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33780";
+NZ_CP027601.1 RefSeq transcript 65629 67167 . - . gene_id "nbis-gene-5697"; transcript_id "gene-C7A06_RS33780"; ID "gene-C7A06_RS33780"; Name "C7A06_RS33780"; Parent "nbis-gene-5697"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33780"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 65629 67167 . - . gene_id "nbis-gene-5697"; transcript_id "gene-C7A06_RS33780"; Dbxref "Genbank:WP_012917688.1"; ID "nbis-exon-5969"; Name "WP_012917688.1"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33780"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000998048.1"; locus_tag "C7A06_RS33780"; product "IS66 family transposase"; protein_id "WP_012917688.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 65629 67167 . - 0 gene_id "nbis-gene-5697"; transcript_id "gene-C7A06_RS33780"; Dbxref "Genbank:WP_012917688.1"; ID "cds-WP_012917688.1"; Name "WP_012917688.1"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33780"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000998048.1"; locus_tag "C7A06_RS33780"; product "IS66 family transposase"; protein_id "WP_012917688.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 67217 67564 . - . gene_id "nbis-gene-5698"; ID "nbis-gene-5698"; Name "tnpB"; gbkey "Gene"; gene "tnpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33785";
+NZ_CP027601.1 RefSeq transcript 67217 67564 . - . gene_id "nbis-gene-5698"; transcript_id "gene-C7A06_RS33785"; ID "gene-C7A06_RS33785"; Name "tnpB"; Parent "nbis-gene-5698"; gbkey "Gene"; gene "tnpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33785"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 67217 67564 . - . gene_id "nbis-gene-5698"; transcript_id "gene-C7A06_RS33785"; Dbxref "Genbank:WP_000612591.1"; ID "nbis-exon-5970"; Name "WP_000612591.1"; Note "TnpB, as the term is used for proteins encoded by IS66 family insertion elements, is considered an accessory protein, since TnpC, encoded by a neighboring gene, is a DDE family transposase."; Parent "gene-C7A06_RS33785"; gbkey "CDS"; gene "tnpB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_019104956.1"; locus_tag "C7A06_RS33785"; product "IS66 family insertion sequence element accessory protein TnpB"; protein_id "WP_000612591.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 67217 67564 . - 0 gene_id "nbis-gene-5698"; transcript_id "gene-C7A06_RS33785"; Dbxref "Genbank:WP_000612591.1"; ID "cds-WP_000612591.1-5"; Name "WP_000612591.1"; Note "TnpB, as the term is used for proteins encoded by IS66 family insertion elements, is considered an accessory protein, since TnpC, encoded by a neighboring gene, is a DDE family transposase."; Parent "gene-C7A06_RS33785"; gbkey "CDS"; gene "tnpB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_019104956.1"; locus_tag "C7A06_RS33785"; product "IS66 family insertion sequence element accessory protein TnpB"; protein_id "WP_000612591.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 67801 68166 . + . gene_id "nbis-gene-5699"; ID "nbis-gene-5699"; Name "C7A06_RS33795"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33795";
+NZ_CP027601.1 RefSeq transcript 67801 68166 . + . gene_id "nbis-gene-5699"; transcript_id "gene-C7A06_RS33795"; ID "gene-C7A06_RS33795"; Name "C7A06_RS33795"; Parent "nbis-gene-5699"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33795"; original_biotype "mrna";
+NZ_CP027601.1 GeneMarkS-2+ exon 67801 68166 . + . gene_id "nbis-gene-5699"; transcript_id "gene-C7A06_RS33795"; Dbxref "Genbank:WP_000091308.1"; ID "nbis-exon-5971"; Name "WP_000091308.1"; Parent "gene-C7A06_RS33795"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS33795"; product "hypothetical protein"; protein_id "WP_000091308.1"; transl_table "11";
+NZ_CP027601.1 GeneMarkS-2+ CDS 67801 68166 . + 0 gene_id "nbis-gene-5699"; transcript_id "gene-C7A06_RS33795"; Dbxref "Genbank:WP_000091308.1"; ID "cds-WP_000091308.1-2"; Name "WP_000091308.1"; Parent "gene-C7A06_RS33795"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS33795"; product "hypothetical protein"; protein_id "WP_000091308.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 68166 69353 . + . gene_id "nbis-gene-5700"; ID "nbis-gene-5700"; Name "C7A06_RS33800"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33800";
+NZ_CP027601.1 RefSeq transcript 68166 69353 . + . gene_id "nbis-gene-5700"; transcript_id "gene-C7A06_RS33800"; ID "gene-C7A06_RS33800"; Name "C7A06_RS33800"; Parent "nbis-gene-5700"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33800"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 68166 69353 . + . gene_id "nbis-gene-5700"; transcript_id "gene-C7A06_RS33800"; Dbxref "Genbank:WP_000937603.1"; ID "nbis-exon-5972"; Name "WP_000937603.1"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33800"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_013747467.1"; locus_tag "C7A06_RS33800"; product "IS91 family transposase"; protein_id "WP_000937603.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 68166 69353 . + 0 gene_id "nbis-gene-5700"; transcript_id "gene-C7A06_RS33800"; Dbxref "Genbank:WP_000937603.1"; ID "cds-WP_000937603.1-2"; Name "WP_000937603.1"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33800"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_013747467.1"; locus_tag "C7A06_RS33800"; product "IS91 family transposase"; protein_id "WP_000937603.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 69944 70951 . + . gene_id "nbis-pseudogene-272"; ID "nbis-pseudogene-272"; Name "C7A06_RS33810"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33810"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "69944";
+NZ_CP027601.1 RefSeq transcript 69944 70951 . + . gene_id "nbis-pseudogene-272"; transcript_id "gene-C7A06_RS33810"; ID "gene-C7A06_RS33810"; Name "C7A06_RS33810"; Parent "nbis-pseudogene-272"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33810"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "69944";
+NZ_CP027601.1 Protein Homology exon 69944 70951 . + . gene_id "nbis-pseudogene-272"; transcript_id "gene-C7A06_RS33810"; ID "nbis-exon-5973"; Note "frameshifted; internal stop; incomplete; partial in the middle of a contig; missing N-terminus"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33810"; gbkey "CDS"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_013747467.1"; locus_tag "C7A06_RS33810"; partial "true"; product "transposase"; pseudo "true"; start_range "." "69944"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 69944 70951 . + 0 gene_id "nbis-pseudogene-272"; transcript_id "gene-C7A06_RS33810"; ID "cds-C7A06_RS33810"; Note "frameshifted; internal stop; incomplete; partial in the middle of a contig; missing N-terminus"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33810"; gbkey "CDS"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_013747467.1"; locus_tag "C7A06_RS33810"; partial "true"; product "transposase"; pseudo "true"; start_range "." "69944"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 71571 73080 . + . gene_id "nbis-pseudogene-273"; ID "nbis-pseudogene-273"; Name "C7A06_RS33815"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33815"; original_biotype "pseudogene"; pseudo "true";
+NZ_CP027601.1 RefSeq transcript 71571 73080 . + . gene_id "nbis-pseudogene-273"; transcript_id "gene-C7A06_RS33815"; ID "gene-C7A06_RS33815"; Name "C7A06_RS33815"; Parent "nbis-pseudogene-273"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33815"; original_biotype "mrna"; pseudo "true";
+NZ_CP027601.1 Protein Homology exon 71571 73080 . + . gene_id "nbis-pseudogene-273"; transcript_id "gene-C7A06_RS33815"; ID "nbis-exon-5974"; Note "frameshifted"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33815"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001368704.1"; locus_tag "C7A06_RS33815"; product "ISL3 family transposase"; pseudo "true"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 71571 73080 . + 0 gene_id "nbis-pseudogene-273"; transcript_id "gene-C7A06_RS33815"; ID "cds-C7A06_RS33815"; Note "frameshifted"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33815"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001368704.1"; locus_tag "C7A06_RS33815"; product "ISL3 family transposase"; pseudo "true"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 73131 73245 . - . gene_id "nbis-pseudogene-274"; ID "nbis-pseudogene-274"; Name "C7A06_RS33820"; end_range "73245" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33820"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "73131";
+NZ_CP027601.1 RefSeq transcript 73131 73245 . - . gene_id "nbis-pseudogene-274"; transcript_id "gene-C7A06_RS33820"; ID "gene-C7A06_RS33820"; Name "C7A06_RS33820"; Parent "nbis-pseudogene-274"; end_range "73245" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33820"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "73131";
+NZ_CP027601.1 Protein Homology exon 73131 73245 . - . gene_id "nbis-pseudogene-274"; transcript_id "gene-C7A06_RS33820"; ID "nbis-exon-5975"; Note "frameshifted; incomplete; partial in the middle of a contig; missing N-terminus and C-terminus"; Parent "gene-C7A06_RS33820"; end_range "73245" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012477168.1"; locus_tag "C7A06_RS33820"; partial "true"; product "IS3 family transposase"; pseudo "true"; start_range "." "73131"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 73131 73245 . - 0 gene_id "nbis-pseudogene-274"; transcript_id "gene-C7A06_RS33820"; ID "cds-C7A06_RS33820"; Note "frameshifted; incomplete; partial in the middle of a contig; missing N-terminus and C-terminus"; Parent "gene-C7A06_RS33820"; end_range "73245" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012477168.1"; locus_tag "C7A06_RS33820"; partial "true"; product "IS3 family transposase"; pseudo "true"; start_range "." "73131"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 73332 73808 . + . gene_id "nbis-gene-5701"; ID "nbis-gene-5701"; Name "C7A06_RS33825"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33825";
+NZ_CP027601.1 RefSeq transcript 73332 73808 . + . gene_id "nbis-gene-5701"; transcript_id "gene-C7A06_RS33825"; ID "gene-C7A06_RS33825"; Name "C7A06_RS33825"; Parent "nbis-gene-5701"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33825"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 73332 73808 . + . gene_id "nbis-gene-5701"; transcript_id "gene-C7A06_RS33825"; Dbxref "Genbank:WP_000422675.1"; ID "nbis-exon-5976"; Name "WP_000422675.1"; Parent "gene-C7A06_RS33825"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000422669.1"; locus_tag "C7A06_RS33825"; product "transposase"; protein_id "WP_000422675.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 73332 73808 . + 0 gene_id "nbis-gene-5701"; transcript_id "gene-C7A06_RS33825"; Dbxref "Genbank:WP_000422675.1"; ID "cds-WP_000422675.1"; Name "WP_000422675.1"; Parent "gene-C7A06_RS33825"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000422669.1"; locus_tag "C7A06_RS33825"; product "transposase"; protein_id "WP_000422675.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 73789 74941 . + . gene_id "nbis-pseudogene-275"; ID "nbis-pseudogene-275"; Name "C7A06_RS33830"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33830"; original_biotype "pseudogene"; pseudo "true";
+NZ_CP027601.1 RefSeq transcript 73789 74941 . + . gene_id "nbis-pseudogene-275"; transcript_id "gene-C7A06_RS33830"; ID "gene-C7A06_RS33830"; Name "C7A06_RS33830"; Parent "nbis-pseudogene-275"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33830"; original_biotype "mrna"; pseudo "true";
+NZ_CP027601.1 Protein Homology exon 73789 74941 . + . gene_id "nbis-pseudogene-275"; transcript_id "gene-C7A06_RS33830"; ID "nbis-exon-5977"; Note "frameshifted"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33830"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611553.1"; locus_tag "C7A06_RS33830"; product "IS3 family transposase"; pseudo "true"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 73789 74941 . + 0 gene_id "nbis-pseudogene-275"; transcript_id "gene-C7A06_RS33830"; ID "cds-C7A06_RS33830"; Note "frameshifted"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33830"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611553.1"; locus_tag "C7A06_RS33830"; product "IS3 family transposase"; pseudo "true"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 75004 76453 . + . gene_id "nbis-pseudogene-276"; ID "nbis-pseudogene-276"; Name "C7A06_RS33835"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33835"; original_biotype "pseudogene"; pseudo "true";
+NZ_CP027601.1 RefSeq transcript 75004 76453 . + . gene_id "nbis-pseudogene-276"; transcript_id "gene-C7A06_RS33835"; ID "gene-C7A06_RS33835"; Name "C7A06_RS33835"; Parent "nbis-pseudogene-276"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33835"; original_biotype "mrna"; pseudo "true";
+NZ_CP027601.1 Protein Homology exon 75004 76453 . + . gene_id "nbis-pseudogene-276"; transcript_id "gene-C7A06_RS33835"; ID "nbis-exon-5978"; Note "frameshifted; internal stop"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33835"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000080164.1"; locus_tag "C7A06_RS33835"; product "IS66 family transposase"; pseudo "true"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 75004 76453 . + 0 gene_id "nbis-pseudogene-276"; transcript_id "gene-C7A06_RS33835"; ID "cds-C7A06_RS33835"; Note "frameshifted; internal stop"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33835"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000080164.1"; locus_tag "C7A06_RS33835"; product "IS66 family transposase"; pseudo "true"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 76520 77012 . - . gene_id "nbis-pseudogene-277"; ID "nbis-pseudogene-277"; Name "C7A06_RS33840"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33840"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "76520";
+NZ_CP027601.1 RefSeq transcript 76520 77012 . - . gene_id "nbis-pseudogene-277"; transcript_id "gene-C7A06_RS33840"; ID "gene-C7A06_RS33840"; Name "C7A06_RS33840"; Parent "nbis-pseudogene-277"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33840"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "76520";
+NZ_CP027601.1 Protein Homology exon 76520 77012 . - . gene_id "nbis-pseudogene-277"; transcript_id "gene-C7A06_RS33840"; ID "nbis-exon-5979"; Note "frameshifted; incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33840"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_086558155.1"; locus_tag "C7A06_RS33840"; partial "true"; product "IS3 family transposase"; pseudo "true"; start_range "." "76520"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 76520 77012 . - 0 gene_id "nbis-pseudogene-277"; transcript_id "gene-C7A06_RS33840"; ID "cds-C7A06_RS33840"; Note "frameshifted; incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33840"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_086558155.1"; locus_tag "C7A06_RS33840"; partial "true"; product "IS3 family transposase"; pseudo "true"; start_range "." "76520"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 76935 77165 . + . gene_id "nbis-gene-5702"; ID "nbis-gene-5702"; Name "C7A06_RS33845"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33845";
+NZ_CP027601.1 RefSeq transcript 76935 77165 . + . gene_id "nbis-gene-5702"; transcript_id "gene-C7A06_RS33845"; ID "gene-C7A06_RS33845"; Name "C7A06_RS33845"; Parent "nbis-gene-5702"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33845"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 76935 77165 . + . gene_id "nbis-gene-5702"; transcript_id "gene-C7A06_RS33845"; Dbxref "Genbank:WP_001443774.1"; ID "nbis-exon-5980"; Name "WP_001443774.1"; Parent "gene-C7A06_RS33845"; gbkey "CDS"; inference "COORDINATES: protein motif:HMM:NF015365.2"; locus_tag "C7A06_RS33845"; product "IS1 family transposase"; protein_id "WP_001443774.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 76935 77165 . + 0 gene_id "nbis-gene-5702"; transcript_id "gene-C7A06_RS33845"; Dbxref "Genbank:WP_001443774.1"; ID "cds-WP_001443774.1"; Name "WP_001443774.1"; Parent "gene-C7A06_RS33845"; gbkey "CDS"; inference "COORDINATES: protein motif:HMM:NF015365.2"; locus_tag "C7A06_RS33845"; product "IS1 family transposase"; protein_id "WP_001443774.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 77280 86778 . + . gene_id "nbis-pseudogene-278"; ID "nbis-pseudogene-278"; Name "toxB"; gbkey "Gene"; gene "toxB"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33850"; original_biotype "pseudogene"; pseudo "true";
+NZ_CP027601.1 RefSeq transcript 77280 86778 . + . gene_id "nbis-pseudogene-278"; transcript_id "gene-C7A06_RS33850"; ID "gene-C7A06_RS33850"; Name "toxB"; Parent "nbis-pseudogene-278"; gbkey "Gene"; gene "toxB"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33850"; original_biotype "mrna"; pseudo "true";
+NZ_CP027601.1 Protein Homology exon 77280 86778 . + . gene_id "nbis-pseudogene-278"; transcript_id "gene-C7A06_RS33850"; ID "nbis-exon-5981"; Note "frameshifted"; Parent "gene-C7A06_RS33850"; gbkey "CDS"; gene "toxB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000581688.1"; locus_tag "C7A06_RS33850"; product "toxin B"; pseudo "true"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 77280 86778 . + 0 gene_id "nbis-pseudogene-278"; transcript_id "gene-C7A06_RS33850"; ID "cds-C7A06_RS33850"; Note "frameshifted"; Parent "gene-C7A06_RS33850"; gbkey "CDS"; gene "toxB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000581688.1"; locus_tag "C7A06_RS33850"; product "toxin B"; pseudo "true"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 87738 88769 . - . gene_id "nbis-gene-5703"; ID "nbis-gene-5703"; Name "C7A06_RS33865"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33865";
+NZ_CP027601.1 RefSeq transcript 87738 88769 . - . gene_id "nbis-gene-5703"; transcript_id "gene-C7A06_RS33865"; ID "gene-C7A06_RS33865"; Name "C7A06_RS33865"; Parent "nbis-gene-5703"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33865"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 87738 88769 . - . gene_id "nbis-gene-5703"; transcript_id "gene-C7A06_RS33865"; Dbxref "Genbank:WP_000907857.1"; ID "nbis-exon-5982"; Name "WP_000907857.1"; Parent "gene-C7A06_RS33865"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000907860.1"; locus_tag "C7A06_RS33865"; product "replication initiation protein"; protein_id "WP_000907857.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 87738 88769 . - 0 gene_id "nbis-gene-5703"; transcript_id "gene-C7A06_RS33865"; Dbxref "Genbank:WP_000907857.1"; ID "cds-WP_000907857.1"; Name "WP_000907857.1"; Parent "gene-C7A06_RS33865"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000907860.1"; locus_tag "C7A06_RS33865"; product "replication initiation protein"; protein_id "WP_000907857.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 89478 90119 . + . gene_id "nbis-gene-5704"; ID "nbis-gene-5704"; Name "C7A06_RS33880"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33880";
+NZ_CP027601.1 RefSeq transcript 89478 90119 . + . gene_id "nbis-gene-5704"; transcript_id "gene-C7A06_RS33880"; ID "gene-C7A06_RS33880"; Name "C7A06_RS33880"; Parent "nbis-gene-5704"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33880"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 89478 90119 . + . gene_id "nbis-gene-5704"; transcript_id "gene-C7A06_RS33880"; Dbxref "Genbank:WP_000335839.1"; ID "nbis-exon-5983"; Name "WP_000335839.1"; Parent "gene-C7A06_RS33880"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000335849.1"; locus_tag "C7A06_RS33880"; product "transcription termination factor NusG"; protein_id "WP_000335839.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 89478 90119 . + 0 gene_id "nbis-gene-5704"; transcript_id "gene-C7A06_RS33880"; Dbxref "Genbank:WP_000335839.1"; ID "cds-WP_000335839.1"; Name "WP_000335839.1"; Parent "gene-C7A06_RS33880"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000335849.1"; locus_tag "C7A06_RS33880"; product "transcription termination factor NusG"; protein_id "WP_000335839.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 90260 90925 . + . gene_id "nbis-gene-5705"; ID "nbis-gene-5705"; Name "C7A06_RS33885"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33885";
+NZ_CP027601.1 RefSeq transcript 90260 90925 . + . gene_id "nbis-gene-5705"; transcript_id "gene-C7A06_RS33885"; ID "gene-C7A06_RS33885"; Name "C7A06_RS33885"; Parent "nbis-gene-5705"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33885"; original_biotype "mrna";
+NZ_CP027601.1 Protein Homology exon 90260 90925 . + . gene_id "nbis-gene-5705"; transcript_id "gene-C7A06_RS33885"; Dbxref "Genbank:WP_000154135.1"; ID "nbis-exon-5984"; Name "WP_000154135.1"; Parent "gene-C7A06_RS33885"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000154135.1"; locus_tag "C7A06_RS33885"; product "hypothetical protein"; protein_id "WP_000154135.1"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 90260 90925 . + 0 gene_id "nbis-gene-5705"; transcript_id "gene-C7A06_RS33885"; Dbxref "Genbank:WP_000154135.1"; ID "cds-WP_000154135.1"; Name "WP_000154135.1"; Parent "gene-C7A06_RS33885"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000154135.1"; locus_tag "C7A06_RS33885"; product "hypothetical protein"; protein_id "WP_000154135.1"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 91191 91579 . + . gene_id "nbis-pseudogene-279"; ID "nbis-pseudogene-279"; Name "C7A06_RS33895"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33895"; original_biotype "pseudogene"; pseudo "true";
+NZ_CP027601.1 RefSeq transcript 91191 91579 . + . gene_id "nbis-pseudogene-279"; transcript_id "gene-C7A06_RS33895"; ID "gene-C7A06_RS33895"; Name "C7A06_RS33895"; Parent "nbis-pseudogene-279"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33895"; original_biotype "mrna"; pseudo "true";
+NZ_CP027601.1 Protein Homology exon 91191 91579 . + . gene_id "nbis-pseudogene-279"; transcript_id "gene-C7A06_RS33895"; ID "nbis-exon-5985"; Note "frameshifted"; Parent "gene-C7A06_RS33895"; gbkey "CDS"; inference "COORDINATES: protein motif:HMM:NF018941.2"; locus_tag "C7A06_RS33895"; product "YqiJ family protein"; pseudo "true"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 91191 91579 . + 0 gene_id "nbis-pseudogene-279"; transcript_id "gene-C7A06_RS33895"; ID "cds-C7A06_RS33895"; Note "frameshifted"; Parent "gene-C7A06_RS33895"; gbkey "CDS"; inference "COORDINATES: protein motif:HMM:NF018941.2"; locus_tag "C7A06_RS33895"; product "YqiJ family protein"; pseudo "true"; transl_table "11";
+NZ_CP027601.1 RefSeq gene 91582 92590 . - . gene_id "nbis-pseudogene-280"; ID "nbis-pseudogene-280"; Name "C7A06_RS33900"; end_range "92590" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33900"; original_biotype "pseudogene"; partial "true"; pseudo "true";
+NZ_CP027601.1 RefSeq transcript 91582 92590 . - . gene_id "nbis-pseudogene-280"; transcript_id "gene-C7A06_RS33900"; ID "gene-C7A06_RS33900"; Name "C7A06_RS33900"; Parent "nbis-pseudogene-280"; end_range "92590" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33900"; original_biotype "mrna"; partial "true"; pseudo "true";
+NZ_CP027601.1 Protein Homology exon 91582 92590 . - . gene_id "nbis-pseudogene-280"; transcript_id "gene-C7A06_RS33900"; ID "nbis-exon-5986"; Note "frameshifted; incomplete; missing N-terminus"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33900"; end_range "92590" "."; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001066419.1"; locus_tag "C7A06_RS33900"; partial "true"; product "IS66 family transposase"; pseudo "true"; transl_table "11";
+NZ_CP027601.1 Protein Homology CDS 91582 92590 . - 2 gene_id "nbis-pseudogene-280"; transcript_id "gene-C7A06_RS33900"; ID "cds-C7A06_RS33900"; Note "frameshifted; incomplete; missing N-terminus"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33900"; end_range "92590" "."; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001066419.1"; locus_tag "C7A06_RS33900"; partial "true"; product "IS66 family transposase"; pseudo "true"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 1052 2152 . + . gene_id "nbis-gene-2"; ID "nbis-gene-2"; Name "dnaN"; gbkey "Gene"; gene "dnaN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00010";
+NZ_CP027599.1 RefSeq transcript 1052 2152 . + . gene_id "nbis-gene-2"; transcript_id "gene-C7A06_RS00010"; ID "gene-C7A06_RS00010"; Name "dnaN"; Parent "nbis-gene-2"; gbkey "Gene"; gene "dnaN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00010"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 1052 2152 . + . gene_id "nbis-gene-2"; transcript_id "gene-C7A06_RS00010"; Dbxref "Genbank:WP_000673464.1"; ID "nbis-exon-2"; Name "WP_000673464.1"; Ontology_term "GO:0006260" "GO:0003887" "GO:0009360"; Parent "gene-C7A06_RS00010"; gbkey "CDS"; gene "dnaN"; go_component "DNA polymerase III complex|0009360||IEA"; go_function "DNA-directed DNA polymerase activity|0003887||IEA"; go_process "DNA replication|0006260||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1"; locus_tag "C7A06_RS00010"; product "DNA polymerase III subunit beta"; protein_id "WP_000673464.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 1052 2152 . + 0 gene_id "nbis-gene-2"; transcript_id "gene-C7A06_RS00010"; Dbxref "Genbank:WP_000673464.1"; ID "cds-WP_000673464.1"; Name "WP_000673464.1"; Ontology_term "GO:0006260" "GO:0003887" "GO:0009360"; Parent "gene-C7A06_RS00010"; gbkey "CDS"; gene "dnaN"; go_component "DNA polymerase III complex|0009360||IEA"; go_function "DNA-directed DNA polymerase activity|0003887||IEA"; go_process "DNA replication|0006260||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1"; locus_tag "C7A06_RS00010"; product "DNA polymerase III subunit beta"; protein_id "WP_000673464.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 2152 3225 . + . gene_id "nbis-gene-3"; ID "nbis-gene-3"; Name "recF"; gbkey "Gene"; gene "recF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00015";
+NZ_CP027599.1 RefSeq transcript 2152 3225 . + . gene_id "nbis-gene-3"; transcript_id "gene-C7A06_RS00015"; ID "gene-C7A06_RS00015"; Name "recF"; Parent "nbis-gene-3"; gbkey "Gene"; gene "recF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00015"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 2152 3225 . + . gene_id "nbis-gene-3"; transcript_id "gene-C7A06_RS00015"; Dbxref "Genbank:WP_000060112.1"; ID "nbis-exon-3"; Name "WP_000060112.1"; Ontology_term "GO:0006281" "GO:0003697" "GO:0005524"; Parent "gene-C7A06_RS00015"; gbkey "CDS"; gene "recF"; go_function "single-stranded DNA binding|0003697||IEA" "ATP binding|0005524||IEA"; go_process "DNA repair|0006281||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1"; locus_tag "C7A06_RS00015"; product "DNA replication/repair protein RecF"; protein_id "WP_000060112.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 2152 3225 . + 0 gene_id "nbis-gene-3"; transcript_id "gene-C7A06_RS00015"; Dbxref "Genbank:WP_000060112.1"; ID "cds-WP_000060112.1"; Name "WP_000060112.1"; Ontology_term "GO:0006281" "GO:0003697" "GO:0005524"; Parent "gene-C7A06_RS00015"; gbkey "CDS"; gene "recF"; go_function "single-stranded DNA binding|0003697||IEA" "ATP binding|0005524||IEA"; go_process "DNA repair|0006281||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1"; locus_tag "C7A06_RS00015"; product "DNA replication/repair protein RecF"; protein_id "WP_000060112.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 3254 5668 . + . gene_id "nbis-gene-4"; ID "nbis-gene-4"; Name "gyrB"; gbkey "Gene"; gene "gyrB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00020";
+NZ_CP027599.1 RefSeq transcript 3254 5668 . + . gene_id "nbis-gene-4"; transcript_id "gene-C7A06_RS00020"; ID "gene-C7A06_RS00020"; Name "gyrB"; Parent "nbis-gene-4"; gbkey "Gene"; gene "gyrB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00020"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 3254 5668 . + . gene_id "nbis-gene-4"; transcript_id "gene-C7A06_RS00020"; Dbxref "Genbank:WP_000072067.1"; ID "nbis-exon-4"; Name "WP_000072067.1"; Ontology_term "GO:0006265" "GO:0003918" "GO:0009330"; Parent "gene-C7A06_RS00020"; gbkey "CDS"; gene "gyrB"; go_component "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) complex|0009330||IEA"; go_function "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) activity|0003918||IEA"; go_process "DNA topological change|0006265||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1"; locus_tag "C7A06_RS00020"; product "DNA topoisomerase (ATP-hydrolyzing) subunit B"; protein_id "WP_000072067.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 3254 5668 . + 0 gene_id "nbis-gene-4"; transcript_id "gene-C7A06_RS00020"; Dbxref "Genbank:WP_000072067.1"; ID "cds-WP_000072067.1"; Name "WP_000072067.1"; Ontology_term "GO:0006265" "GO:0003918" "GO:0009330"; Parent "gene-C7A06_RS00020"; gbkey "CDS"; gene "gyrB"; go_component "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) complex|0009330||IEA"; go_function "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) activity|0003918||IEA"; go_process "DNA topological change|0006265||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1"; locus_tag "C7A06_RS00020"; product "DNA topoisomerase (ATP-hydrolyzing) subunit B"; protein_id "WP_000072067.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 5908 6306 . + . gene_id "nbis-gene-5"; ID "nbis-gene-5"; Name "yidB"; gbkey "Gene"; gene "yidB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00025";
+NZ_CP027599.1 RefSeq transcript 5908 6306 . + . gene_id "nbis-gene-5"; transcript_id "gene-C7A06_RS00025"; ID "gene-C7A06_RS00025"; Name "yidB"; Parent "nbis-gene-5"; gbkey "Gene"; gene "yidB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00025"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 5908 6306 . + . gene_id "nbis-gene-5"; transcript_id "gene-C7A06_RS00025"; Dbxref "Genbank:WP_000522208.1"; ID "nbis-exon-5"; Name "WP_000522208.1"; Parent "gene-C7A06_RS00025"; gbkey "CDS"; gene "yidB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418153.4"; locus_tag "C7A06_RS00025"; product "YidB family protein"; protein_id "WP_000522208.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 5908 6306 . + 0 gene_id "nbis-gene-5"; transcript_id "gene-C7A06_RS00025"; Dbxref "Genbank:WP_000522208.1"; ID "cds-WP_000522208.1"; Name "WP_000522208.1"; Parent "gene-C7A06_RS00025"; gbkey "CDS"; gene "yidB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418153.4"; locus_tag "C7A06_RS00025"; product "YidB family protein"; protein_id "WP_000522208.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 6421 7233 . + . gene_id "nbis-gene-6"; ID "nbis-gene-6"; Name "yidA"; gbkey "Gene"; gene "yidA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00030";
+NZ_CP027599.1 RefSeq transcript 6421 7233 . + . gene_id "nbis-gene-6"; transcript_id "gene-C7A06_RS00030"; ID "gene-C7A06_RS00030"; Name "yidA"; Parent "nbis-gene-6"; gbkey "Gene"; gene "yidA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00030"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 6421 7233 . + . gene_id "nbis-gene-6"; transcript_id "gene-C7A06_RS00030"; Dbxref "Genbank:WP_000985541.1"; ID "nbis-exon-6"; Name "WP_000985541.1"; Ontology_term "GO:0016787"; Parent "gene-C7A06_RS00030"; gbkey "CDS"; gene "yidA"; go_function "hydrolase activity|0016787||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418152.1"; locus_tag "C7A06_RS00030"; product "sugar-phosphatase"; protein_id "WP_000985541.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 6421 7233 . + 0 gene_id "nbis-gene-6"; transcript_id "gene-C7A06_RS00030"; Dbxref "Genbank:WP_000985541.1"; ID "cds-WP_000985541.1"; Name "WP_000985541.1"; Ontology_term "GO:0016787"; Parent "gene-C7A06_RS00030"; gbkey "CDS"; gene "yidA"; go_function "hydrolase activity|0016787||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418152.1"; locus_tag "C7A06_RS00030"; product "sugar-phosphatase"; protein_id "WP_000985541.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 7279 7935 . - . gene_id "nbis-gene-7"; ID "nbis-gene-7"; Name "C7A06_RS00035"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00035";
+NZ_CP027599.1 RefSeq transcript 7279 7935 . - . gene_id "nbis-gene-7"; transcript_id "gene-C7A06_RS00035"; ID "gene-C7A06_RS00035"; Name "C7A06_RS00035"; Parent "nbis-gene-7"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00035"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 7279 7935 . - . gene_id "nbis-gene-7"; transcript_id "gene-C7A06_RS00035"; Dbxref "Genbank:WP_000772931.1"; ID "nbis-exon-7"; Name "WP_000772931.1"; Parent "gene-C7A06_RS00035"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709504.1"; locus_tag "C7A06_RS00035"; product "hypothetical protein"; protein_id "WP_000772931.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 7279 7935 . - 0 gene_id "nbis-gene-7"; transcript_id "gene-C7A06_RS00035"; Dbxref "Genbank:WP_000772931.1"; ID "cds-WP_000772931.1"; Name "WP_000772931.1"; Parent "gene-C7A06_RS00035"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709504.1"; locus_tag "C7A06_RS00035"; product "hypothetical protein"; protein_id "WP_000772931.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 8213 8902 . + . gene_id "nbis-gene-8"; ID "nbis-gene-8"; Name "dgoR"; gbkey "Gene"; gene "dgoR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00040";
+NZ_CP027599.1 RefSeq transcript 8213 8902 . + . gene_id "nbis-gene-8"; transcript_id "gene-C7A06_RS00040"; ID "gene-C7A06_RS00040"; Name "dgoR"; Parent "nbis-gene-8"; gbkey "Gene"; gene "dgoR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00040"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 8213 8902 . + . gene_id "nbis-gene-8"; transcript_id "gene-C7A06_RS00040"; Dbxref "Genbank:WP_000174305.1"; ID "nbis-exon-8"; Name "WP_000174305.1"; Parent "gene-C7A06_RS00040"; gbkey "CDS"; gene "dgoR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709505.1"; locus_tag "C7A06_RS00040"; product "D-galactonate utilization transcriptional regulator DgoR"; protein_id "WP_000174305.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 8213 8902 . + 0 gene_id "nbis-gene-8"; transcript_id "gene-C7A06_RS00040"; Dbxref "Genbank:WP_000174305.1"; ID "cds-WP_000174305.1"; Name "WP_000174305.1"; Parent "gene-C7A06_RS00040"; gbkey "CDS"; gene "dgoR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709505.1"; locus_tag "C7A06_RS00040"; product "D-galactonate utilization transcriptional regulator DgoR"; protein_id "WP_000174305.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 8899 9777 . + . gene_id "nbis-gene-9"; ID "nbis-gene-9"; Name "dgoK"; gbkey "Gene"; gene "dgoK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00045";
+NZ_CP027599.1 RefSeq transcript 8899 9777 . + . gene_id "nbis-gene-9"; transcript_id "gene-C7A06_RS00045"; ID "gene-C7A06_RS00045"; Name "dgoK"; Parent "nbis-gene-9"; gbkey "Gene"; gene "dgoK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00045"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 8899 9777 . + . gene_id "nbis-gene-9"; transcript_id "gene-C7A06_RS00045"; Dbxref "Genbank:WP_000127112.1"; ID "nbis-exon-9"; Name "WP_000127112.1"; Parent "gene-C7A06_RS00045"; gbkey "CDS"; gene "dgoK"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709506.1"; locus_tag "C7A06_RS00045"; product "2-dehydro-3-deoxygalactonokinase"; protein_id "WP_000127112.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 8899 9777 . + 0 gene_id "nbis-gene-9"; transcript_id "gene-C7A06_RS00045"; Dbxref "Genbank:WP_000127112.1"; ID "cds-WP_000127112.1"; Name "WP_000127112.1"; Parent "gene-C7A06_RS00045"; gbkey "CDS"; gene "dgoK"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709506.1"; locus_tag "C7A06_RS00045"; product "2-dehydro-3-deoxygalactonokinase"; protein_id "WP_000127112.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 9761 10378 . + . gene_id "nbis-gene-10"; ID "nbis-gene-10"; Name "dgoA"; gbkey "Gene"; gene "dgoA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00050";
+NZ_CP027599.1 RefSeq transcript 9761 10378 . + . gene_id "nbis-gene-10"; transcript_id "gene-C7A06_RS00050"; ID "gene-C7A06_RS00050"; Name "dgoA"; Parent "nbis-gene-10"; gbkey "Gene"; gene "dgoA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00050"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 9761 10378 . + . gene_id "nbis-gene-10"; transcript_id "gene-C7A06_RS00050"; Dbxref "Genbank:WP_001198699.1"; ID "nbis-exon-10"; Name "WP_001198699.1"; Parent "gene-C7A06_RS00050"; gbkey "CDS"; gene "dgoA"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026238.1"; locus_tag "C7A06_RS00050"; product "2-dehydro-3-deoxy-6-phosphogalactonate aldolase"; protein_id "WP_001198699.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 9761 10378 . + 0 gene_id "nbis-gene-10"; transcript_id "gene-C7A06_RS00050"; Dbxref "Genbank:WP_001198699.1"; ID "cds-WP_001198699.1"; Name "WP_001198699.1"; Parent "gene-C7A06_RS00050"; gbkey "CDS"; gene "dgoA"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026238.1"; locus_tag "C7A06_RS00050"; product "2-dehydro-3-deoxy-6-phosphogalactonate aldolase"; protein_id "WP_001198699.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 10375 11523 . + . gene_id "nbis-gene-11"; ID "nbis-gene-11"; Name "dgoD"; gbkey "Gene"; gene "dgoD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00055";
+NZ_CP027599.1 RefSeq transcript 10375 11523 . + . gene_id "nbis-gene-11"; transcript_id "gene-C7A06_RS00055"; ID "gene-C7A06_RS00055"; Name "dgoD"; Parent "nbis-gene-11"; gbkey "Gene"; gene "dgoD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00055"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 10375 11523 . + . gene_id "nbis-gene-11"; transcript_id "gene-C7A06_RS00055"; Dbxref "Genbank:WP_000705001.1"; ID "nbis-exon-11"; Name "WP_000705001.1"; Ontology_term "GO:0009063" "GO:0008869"; Parent "gene-C7A06_RS00055"; gbkey "CDS"; gene "dgoD"; go_function "galactonate dehydratase activity|0008869||IEA"; go_process "cellular amino acid catabolic process|0009063||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1"; locus_tag "C7A06_RS00055"; product "galactonate dehydratase"; protein_id "WP_000705001.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 10375 11523 . + 0 gene_id "nbis-gene-11"; transcript_id "gene-C7A06_RS00055"; Dbxref "Genbank:WP_000705001.1"; ID "cds-WP_000705001.1"; Name "WP_000705001.1"; Ontology_term "GO:0009063" "GO:0008869"; Parent "gene-C7A06_RS00055"; gbkey "CDS"; gene "dgoD"; go_function "galactonate dehydratase activity|0008869||IEA"; go_process "cellular amino acid catabolic process|0009063||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1"; locus_tag "C7A06_RS00055"; product "galactonate dehydratase"; protein_id "WP_000705001.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 11598 12935 . + . gene_id "nbis-gene-12"; ID "nbis-gene-12"; Name "dgoT"; gbkey "Gene"; gene "dgoT"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00060";
+NZ_CP027599.1 RefSeq transcript 11598 12935 . + . gene_id "nbis-gene-12"; transcript_id "gene-C7A06_RS00060"; ID "gene-C7A06_RS00060"; Name "dgoT"; Parent "nbis-gene-12"; gbkey "Gene"; gene "dgoT"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00060"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 11598 12935 . + . gene_id "nbis-gene-12"; transcript_id "gene-C7A06_RS00060"; Dbxref "Genbank:WP_000253455.1"; ID "nbis-exon-12"; Name "WP_000253455.1"; Parent "gene-C7A06_RS00060"; gbkey "CDS"; gene "dgoT"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709507.1"; locus_tag "C7A06_RS00060"; product "MFS transporter"; protein_id "WP_000253455.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 11598 12935 . + 0 gene_id "nbis-gene-12"; transcript_id "gene-C7A06_RS00060"; Dbxref "Genbank:WP_000253455.1"; ID "cds-WP_000253455.1"; Name "WP_000253455.1"; Parent "gene-C7A06_RS00060"; gbkey "CDS"; gene "dgoT"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709507.1"; locus_tag "C7A06_RS00060"; product "MFS transporter"; protein_id "WP_000253455.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 12932 13996 . - . gene_id "nbis-gene-13"; ID "nbis-gene-13"; Name "cbrA"; gbkey "Gene"; gene "cbrA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00065";
+NZ_CP027599.1 RefSeq transcript 12932 13996 . - . gene_id "nbis-gene-13"; transcript_id "gene-C7A06_RS00065"; ID "gene-C7A06_RS00065"; Name "cbrA"; Parent "nbis-gene-13"; gbkey "Gene"; gene "cbrA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00065"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 12932 13996 . - . gene_id "nbis-gene-13"; transcript_id "gene-C7A06_RS00065"; Dbxref "Genbank:WP_001341773.1"; ID "nbis-exon-13"; Name "WP_001341773.1"; Parent "gene-C7A06_RS00065"; gbkey "CDS"; gene "cbrA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418145.2"; locus_tag "C7A06_RS00065"; product "colicin M resistance lipid reductase CbrA"; protein_id "WP_001341773.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 12932 13996 . - 0 gene_id "nbis-gene-13"; transcript_id "gene-C7A06_RS00065"; Dbxref "Genbank:WP_001341773.1"; ID "cds-WP_001341773.1"; Name "WP_001341773.1"; Parent "gene-C7A06_RS00065"; gbkey "CDS"; gene "cbrA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418145.2"; locus_tag "C7A06_RS00065"; product "colicin M resistance lipid reductase CbrA"; protein_id "WP_001341773.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 14097 15311 . + . gene_id "nbis-gene-14"; ID "nbis-gene-14"; Name "yidR"; gbkey "Gene"; gene "yidR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00070";
+NZ_CP027599.1 RefSeq transcript 14097 15311 . + . gene_id "nbis-gene-14"; transcript_id "gene-C7A06_RS00070"; ID "gene-C7A06_RS00070"; Name "yidR"; Parent "nbis-gene-14"; gbkey "Gene"; gene "yidR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00070"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 14097 15311 . + . gene_id "nbis-gene-14"; transcript_id "gene-C7A06_RS00070"; Dbxref "Genbank:WP_001448315.1"; ID "nbis-exon-14"; Name "WP_001448315.1"; Parent "gene-C7A06_RS00070"; gbkey "CDS"; gene "yidR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312656.3"; locus_tag "C7A06_RS00070"; product "DUF3748 domain-containing protein"; protein_id "WP_001448315.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 14097 15311 . + 0 gene_id "nbis-gene-14"; transcript_id "gene-C7A06_RS00070"; Dbxref "Genbank:WP_001448315.1"; ID "cds-WP_001448315.1"; Name "WP_001448315.1"; Parent "gene-C7A06_RS00070"; gbkey "CDS"; gene "yidR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312656.3"; locus_tag "C7A06_RS00070"; product "DUF3748 domain-containing protein"; protein_id "WP_001448315.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 15313 15645 . - . gene_id "nbis-gene-15"; ID "nbis-gene-15"; Name "yidQ"; gbkey "Gene"; gene "yidQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00075";
+NZ_CP027599.1 RefSeq transcript 15313 15645 . - . gene_id "nbis-gene-15"; transcript_id "gene-C7A06_RS00075"; ID "gene-C7A06_RS00075"; Name "yidQ"; Parent "nbis-gene-15"; gbkey "Gene"; gene "yidQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00075"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 15313 15645 . - . gene_id "nbis-gene-15"; transcript_id "gene-C7A06_RS00075"; Dbxref "Genbank:WP_000620888.1"; ID "nbis-exon-15"; Name "WP_000620888.1"; Parent "gene-C7A06_RS00075"; gbkey "CDS"; gene "yidQ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418143.2"; locus_tag "C7A06_RS00075"; product "YceK/YidQ family lipoprotein"; protein_id "WP_000620888.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 15313 15645 . - 0 gene_id "nbis-gene-15"; transcript_id "gene-C7A06_RS00075"; Dbxref "Genbank:WP_000620888.1"; ID "cds-WP_000620888.1"; Name "WP_000620888.1"; Parent "gene-C7A06_RS00075"; gbkey "CDS"; gene "yidQ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418143.2"; locus_tag "C7A06_RS00075"; product "YceK/YidQ family lipoprotein"; protein_id "WP_000620888.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 15951 16364 . + . gene_id "nbis-gene-16"; ID "nbis-gene-16"; Name "ibpA"; gbkey "Gene"; gene "ibpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00080";
+NZ_CP027599.1 RefSeq transcript 15951 16364 . + . gene_id "nbis-gene-16"; transcript_id "gene-C7A06_RS00080"; ID "gene-C7A06_RS00080"; Name "ibpA"; Parent "nbis-gene-16"; gbkey "Gene"; gene "ibpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00080"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 15951 16364 . + . gene_id "nbis-gene-16"; transcript_id "gene-C7A06_RS00080"; Dbxref "Genbank:WP_001243437.1"; ID "nbis-exon-16"; Name "WP_001243437.1"; Parent "gene-C7A06_RS00080"; gbkey "CDS"; gene "ibpA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_006687722.1"; locus_tag "C7A06_RS00080"; product "heat shock chaperone IbpA"; protein_id "WP_001243437.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 15951 16364 . + 0 gene_id "nbis-gene-16"; transcript_id "gene-C7A06_RS00080"; Dbxref "Genbank:WP_001243437.1"; ID "cds-WP_001243437.1"; Name "WP_001243437.1"; Parent "gene-C7A06_RS00080"; gbkey "CDS"; gene "ibpA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_006687722.1"; locus_tag "C7A06_RS00080"; product "heat shock chaperone IbpA"; protein_id "WP_001243437.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 16476 16904 . + . gene_id "nbis-gene-17"; ID "nbis-gene-17"; Name "ibpB"; gbkey "Gene"; gene "ibpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00085";
+NZ_CP027599.1 RefSeq transcript 16476 16904 . + . gene_id "nbis-gene-17"; transcript_id "gene-C7A06_RS00085"; ID "gene-C7A06_RS00085"; Name "ibpB"; Parent "nbis-gene-17"; gbkey "Gene"; gene "ibpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00085"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 16476 16904 . + . gene_id "nbis-gene-17"; transcript_id "gene-C7A06_RS00085"; Dbxref "Genbank:WP_001243431.1"; ID "nbis-exon-17"; Name "WP_001243431.1"; Parent "gene-C7A06_RS00085"; gbkey "CDS"; gene "ibpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709512.2"; locus_tag "C7A06_RS00085"; product "heat shock chaperone IbpB"; protein_id "WP_001243431.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 16476 16904 . + 0 gene_id "nbis-gene-17"; transcript_id "gene-C7A06_RS00085"; Dbxref "Genbank:WP_001243431.1"; ID "cds-WP_001243431.1"; Name "WP_001243431.1"; Parent "gene-C7A06_RS00085"; gbkey "CDS"; gene "ibpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709512.2"; locus_tag "C7A06_RS00085"; product "heat shock chaperone IbpB"; protein_id "WP_001243431.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 17101 18762 . + . gene_id "nbis-gene-18"; ID "nbis-gene-18"; Name "yidE"; gbkey "Gene"; gene "yidE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00090";
+NZ_CP027599.1 RefSeq transcript 17101 18762 . + . gene_id "nbis-gene-18"; transcript_id "gene-C7A06_RS00090"; ID "gene-C7A06_RS00090"; Name "yidE"; Parent "nbis-gene-18"; gbkey "Gene"; gene "yidE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00090"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 17101 18762 . + . gene_id "nbis-gene-18"; transcript_id "gene-C7A06_RS00090"; Dbxref "Genbank:WP_001279752.1"; ID "nbis-exon-18"; Name "WP_001279752.1"; Ontology_term "GO:0006813" "GO:0008324"; Parent "gene-C7A06_RS00090"; gbkey "CDS"; gene "yidE"; go_function "cation transmembrane transporter activity|0008324||IEA"; go_process "potassium ion transport|0006813||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312652.2"; locus_tag "C7A06_RS00090"; product "putative transporter"; protein_id "WP_001279752.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 17101 18762 . + 0 gene_id "nbis-gene-18"; transcript_id "gene-C7A06_RS00090"; Dbxref "Genbank:WP_001279752.1"; ID "cds-WP_001279752.1"; Name "WP_001279752.1"; Ontology_term "GO:0006813" "GO:0008324"; Parent "gene-C7A06_RS00090"; gbkey "CDS"; gene "yidE"; go_function "cation transmembrane transporter activity|0008324||IEA"; go_process "potassium ion transport|0006813||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312652.2"; locus_tag "C7A06_RS00090"; product "putative transporter"; protein_id "WP_001279752.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 18759 19475 . - . gene_id "nbis-gene-19"; ID "nbis-gene-19"; Name "yidP"; gbkey "Gene"; gene "yidP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00095";
+NZ_CP027599.1 RefSeq transcript 18759 19475 . - . gene_id "nbis-gene-19"; transcript_id "gene-C7A06_RS00095"; ID "gene-C7A06_RS00095"; Name "yidP"; Parent "nbis-gene-19"; gbkey "Gene"; gene "yidP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00095"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 18759 19475 . - . gene_id "nbis-gene-19"; transcript_id "gene-C7A06_RS00095"; Dbxref "Genbank:WP_001300779.1"; ID "nbis-exon-19"; Name "WP_001300779.1"; Parent "gene-C7A06_RS00095"; gbkey "CDS"; gene "yidP"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418139.1"; locus_tag "C7A06_RS00095"; product "GntR family transcriptional regulator"; protein_id "WP_001300779.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 18759 19475 . - 0 gene_id "nbis-gene-19"; transcript_id "gene-C7A06_RS00095"; Dbxref "Genbank:WP_001300779.1"; ID "cds-WP_001300779.1"; Name "WP_001300779.1"; Parent "gene-C7A06_RS00095"; gbkey "CDS"; gene "yidP"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418139.1"; locus_tag "C7A06_RS00095"; product "GntR family transcriptional regulator"; protein_id "WP_001300779.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 19771 21387 . + . gene_id "nbis-gene-20"; ID "nbis-gene-20"; Name "C7A06_RS00100"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00100";
+NZ_CP027599.1 RefSeq transcript 19771 21387 . + . gene_id "nbis-gene-20"; transcript_id "gene-C7A06_RS00100"; ID "gene-C7A06_RS00100"; Name "C7A06_RS00100"; Parent "nbis-gene-20"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00100"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 19771 21387 . + . gene_id "nbis-gene-20"; transcript_id "gene-C7A06_RS00100"; Dbxref "Genbank:WP_000952127.1"; ID "nbis-exon-20"; Name "WP_000952127.1"; Parent "gene-C7A06_RS00100"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312650.2"; locus_tag "C7A06_RS00100"; product "PTS sugar transporter subunit IIB"; protein_id "WP_000952127.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 19771 21387 . + 0 gene_id "nbis-gene-20"; transcript_id "gene-C7A06_RS00100"; Dbxref "Genbank:WP_000952127.1"; ID "cds-WP_000952127.1"; Name "WP_000952127.1"; Parent "gene-C7A06_RS00100"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312650.2"; locus_tag "C7A06_RS00100"; product "PTS sugar transporter subunit IIB"; protein_id "WP_000952127.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 21387 22201 . + . gene_id "nbis-pseudogene-1"; ID "nbis-pseudogene-1"; Name "C7A06_RS00105"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00105"; original_biotype "pseudogene"; pseudo "true";
+NZ_CP027599.1 RefSeq transcript 21387 22201 . + . gene_id "nbis-pseudogene-1"; transcript_id "gene-C7A06_RS00105"; ID "gene-C7A06_RS00105"; Name "C7A06_RS00105"; Parent "nbis-pseudogene-1"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00105"; original_biotype "mrna"; pseudo "true";
+NZ_CP027599.1 Protein Homology exon 21387 22201 . + . gene_id "nbis-pseudogene-1"; transcript_id "gene-C7A06_RS00105"; ID "nbis-exon-21"; Note "frameshifted"; Parent "gene-C7A06_RS00105"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312649.2"; locus_tag "C7A06_RS00105"; product "hypothetical protein"; pseudo "true"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 21387 22201 . + 0 gene_id "nbis-pseudogene-1"; transcript_id "gene-C7A06_RS00105"; ID "cds-C7A06_RS00105"; Note "frameshifted"; Parent "gene-C7A06_RS00105"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312649.2"; locus_tag "C7A06_RS00105"; product "hypothetical protein"; pseudo "true"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 22198 23091 . - . gene_id "nbis-gene-21"; ID "nbis-gene-21"; Name "yidL"; gbkey "Gene"; gene "yidL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00110";
+NZ_CP027599.1 RefSeq transcript 22198 23091 . - . gene_id "nbis-gene-21"; transcript_id "gene-C7A06_RS00110"; ID "gene-C7A06_RS00110"; Name "yidL"; Parent "nbis-gene-21"; gbkey "Gene"; gene "yidL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00110"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 22198 23091 . - . gene_id "nbis-gene-21"; transcript_id "gene-C7A06_RS00110"; Dbxref "Genbank:WP_001013540.1"; ID "nbis-exon-22"; Name "WP_001013540.1"; Parent "gene-C7A06_RS00110"; gbkey "CDS"; gene "yidL"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418136.2"; locus_tag "C7A06_RS00110"; product "AraC family transcriptional regulator"; protein_id "WP_001013540.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 22198 23091 . - 0 gene_id "nbis-gene-21"; transcript_id "gene-C7A06_RS00110"; Dbxref "Genbank:WP_001013540.1"; ID "cds-WP_001013540.1"; Name "WP_001013540.1"; Parent "gene-C7A06_RS00110"; gbkey "CDS"; gene "yidL"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418136.2"; locus_tag "C7A06_RS00110"; product "AraC family transcriptional regulator"; protein_id "WP_001013540.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 23258 24973 . + . gene_id "nbis-gene-22"; ID "nbis-gene-22"; Name "yidK"; gbkey "Gene"; gene "yidK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00115";
+NZ_CP027599.1 RefSeq transcript 23258 24973 . + . gene_id "nbis-gene-22"; transcript_id "gene-C7A06_RS00115"; ID "gene-C7A06_RS00115"; Name "yidK"; Parent "nbis-gene-22"; gbkey "Gene"; gene "yidK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00115"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 23258 24973 . + . gene_id "nbis-gene-22"; transcript_id "gene-C7A06_RS00115"; Dbxref "Genbank:WP_001087147.1"; ID "nbis-exon-23"; Name "WP_001087147.1"; Ontology_term "GO:0055085" "GO:0022857" "GO:0016020"; Parent "gene-C7A06_RS00115"; gbkey "CDS"; gene "yidK"; go_component "membrane|0016020||IEA"; go_function "transmembrane transporter activity|0022857||IEA"; go_process "transmembrane transport|0055085||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418135.1"; locus_tag "C7A06_RS00115"; product "solute:sodium symporter family transporter"; protein_id "WP_001087147.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 23258 24973 . + 0 gene_id "nbis-gene-22"; transcript_id "gene-C7A06_RS00115"; Dbxref "Genbank:WP_001087147.1"; ID "cds-WP_001087147.1"; Name "WP_001087147.1"; Ontology_term "GO:0055085" "GO:0022857" "GO:0016020"; Parent "gene-C7A06_RS00115"; gbkey "CDS"; gene "yidK"; go_component "membrane|0016020||IEA"; go_function "transmembrane transporter activity|0022857||IEA"; go_process "transmembrane transport|0055085||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418135.1"; locus_tag "C7A06_RS00115"; product "solute:sodium symporter family transporter"; protein_id "WP_001087147.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 24970 26463 . + . gene_id "nbis-gene-23"; ID "nbis-gene-23"; Name "yidJ"; gbkey "Gene"; gene "yidJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00120";
+NZ_CP027599.1 RefSeq transcript 24970 26463 . + . gene_id "nbis-gene-23"; transcript_id "gene-C7A06_RS00120"; ID "gene-C7A06_RS00120"; Name "yidJ"; Parent "nbis-gene-23"; gbkey "Gene"; gene "yidJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00120"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 24970 26463 . + . gene_id "nbis-gene-23"; transcript_id "gene-C7A06_RS00120"; Dbxref "Genbank:WP_000828487.1"; ID "nbis-exon-24"; Name "WP_000828487.1"; Ontology_term "GO:0008484"; Parent "gene-C7A06_RS00120"; gbkey "CDS"; gene "yidJ"; go_function "sulfuric ester hydrolase activity|0008484||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418134.1"; locus_tag "C7A06_RS00120"; product "sulfatase-like hydrolase/transferase"; protein_id "WP_000828487.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 24970 26463 . + 0 gene_id "nbis-gene-23"; transcript_id "gene-C7A06_RS00120"; Dbxref "Genbank:WP_000828487.1"; ID "cds-WP_000828487.1"; Name "WP_000828487.1"; Ontology_term "GO:0008484"; Parent "gene-C7A06_RS00120"; gbkey "CDS"; gene "yidJ"; go_function "sulfuric ester hydrolase activity|0008484||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418134.1"; locus_tag "C7A06_RS00120"; product "sulfatase-like hydrolase/transferase"; protein_id "WP_000828487.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 26510 26959 . - . gene_id "nbis-gene-24"; ID "nbis-gene-24"; Name "C7A06_RS00125"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00125";
+NZ_CP027599.1 RefSeq transcript 26510 26959 . - . gene_id "nbis-gene-24"; transcript_id "gene-C7A06_RS00125"; ID "gene-C7A06_RS00125"; Name "C7A06_RS00125"; Parent "nbis-gene-24"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00125"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 26510 26959 . - . gene_id "nbis-gene-24"; transcript_id "gene-C7A06_RS00125"; Dbxref "Genbank:WP_000511287.1"; ID "nbis-exon-25"; Name "WP_000511287.1"; Parent "gene-C7A06_RS00125"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418133.1"; locus_tag "C7A06_RS00125"; product "membrane protein"; protein_id "WP_000511287.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 26510 26959 . - 0 gene_id "nbis-gene-24"; transcript_id "gene-C7A06_RS00125"; Dbxref "Genbank:WP_000511287.1"; ID "cds-WP_000511287.1"; Name "WP_000511287.1"; Parent "gene-C7A06_RS00125"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418133.1"; locus_tag "C7A06_RS00125"; product "membrane protein"; protein_id "WP_000511287.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 27069 27416 . + . gene_id "nbis-gene-25"; ID "nbis-gene-25"; Name "yidH"; gbkey "Gene"; gene "yidH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00130";
+NZ_CP027599.1 RefSeq transcript 27069 27416 . + . gene_id "nbis-gene-25"; transcript_id "gene-C7A06_RS00130"; ID "gene-C7A06_RS00130"; Name "yidH"; Parent "nbis-gene-25"; gbkey "Gene"; gene "yidH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00130"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 27069 27416 . + . gene_id "nbis-gene-25"; transcript_id "gene-C7A06_RS00130"; Dbxref "Genbank:WP_000703959.1"; ID "nbis-exon-26"; Name "WP_000703959.1"; Parent "gene-C7A06_RS00130"; gbkey "CDS"; gene "yidH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312644.1"; locus_tag "C7A06_RS00130"; product "YidH family protein"; protein_id "WP_000703959.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 27069 27416 . + 0 gene_id "nbis-gene-25"; transcript_id "gene-C7A06_RS00130"; Dbxref "Genbank:WP_000703959.1"; ID "cds-WP_000703959.1"; Name "WP_000703959.1"; Parent "gene-C7A06_RS00130"; gbkey "CDS"; gene "yidH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312644.1"; locus_tag "C7A06_RS00130"; product "YidH family protein"; protein_id "WP_000703959.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 27406 27768 . + . gene_id "nbis-gene-26"; ID "nbis-gene-26"; Name "yidG"; gbkey "Gene"; gene "yidG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00135";
+NZ_CP027599.1 RefSeq transcript 27406 27768 . + . gene_id "nbis-gene-26"; transcript_id "gene-C7A06_RS00135"; ID "gene-C7A06_RS00135"; Name "yidG"; Parent "nbis-gene-26"; gbkey "Gene"; gene "yidG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00135"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 27406 27768 . + . gene_id "nbis-gene-26"; transcript_id "gene-C7A06_RS00135"; Dbxref "Genbank:WP_001113432.1"; ID "nbis-exon-27"; Name "WP_001113432.1"; Parent "gene-C7A06_RS00135"; gbkey "CDS"; gene "yidG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312643.1"; locus_tag "C7A06_RS00135"; product "DUF202 domain-containing protein"; protein_id "WP_001113432.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 27406 27768 . + 0 gene_id "nbis-gene-26"; transcript_id "gene-C7A06_RS00135"; Dbxref "Genbank:WP_001113432.1"; ID "cds-WP_001113432.1"; Name "WP_001113432.1"; Parent "gene-C7A06_RS00135"; gbkey "CDS"; gene "yidG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312643.1"; locus_tag "C7A06_RS00135"; product "DUF202 domain-containing protein"; protein_id "WP_001113432.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 27765 28262 . + . gene_id "nbis-gene-27"; ID "nbis-gene-27"; Name "yidF"; gbkey "Gene"; gene "yidF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00140";
+NZ_CP027599.1 RefSeq transcript 27765 28262 . + . gene_id "nbis-gene-27"; transcript_id "gene-C7A06_RS00140"; ID "gene-C7A06_RS00140"; Name "yidF"; Parent "nbis-gene-27"; gbkey "Gene"; gene "yidF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00140"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 27765 28262 . + . gene_id "nbis-gene-27"; transcript_id "gene-C7A06_RS00140"; Dbxref "Genbank:WP_000148063.1"; ID "nbis-exon-28"; Name "WP_000148063.1"; Parent "gene-C7A06_RS00140"; gbkey "CDS"; gene "yidF"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709521.1"; locus_tag "C7A06_RS00140"; product "radical SAM protein"; protein_id "WP_000148063.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 27765 28262 . + 0 gene_id "nbis-gene-27"; transcript_id "gene-C7A06_RS00140"; Dbxref "Genbank:WP_000148063.1"; ID "cds-WP_000148063.1"; Name "WP_000148063.1"; Parent "gene-C7A06_RS00140"; gbkey "CDS"; gene "yidF"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709521.1"; locus_tag "C7A06_RS00140"; product "radical SAM protein"; protein_id "WP_000148063.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 28270 29454 . - . gene_id "nbis-gene-28"; ID "nbis-gene-28"; Name "emrD"; gbkey "Gene"; gene "emrD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00145";
+NZ_CP027599.1 RefSeq transcript 28270 29454 . - . gene_id "nbis-gene-28"; transcript_id "gene-C7A06_RS00145"; ID "gene-C7A06_RS00145"; Name "emrD"; Parent "nbis-gene-28"; gbkey "Gene"; gene "emrD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00145"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 28270 29454 . - . gene_id "nbis-gene-28"; transcript_id "gene-C7A06_RS00145"; Dbxref "Genbank:WP_000828746.1"; ID "nbis-exon-29"; Name "WP_000828746.1"; Parent "gene-C7A06_RS00145"; gbkey "CDS"; gene "emrD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418129.2"; locus_tag "C7A06_RS00145"; product "multidrug efflux MFS transporter EmrD"; protein_id "WP_000828746.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 28270 29454 . - 0 gene_id "nbis-gene-28"; transcript_id "gene-C7A06_RS00145"; Dbxref "Genbank:WP_000828746.1"; ID "cds-WP_000828746.1"; Name "WP_000828746.1"; Parent "gene-C7A06_RS00145"; gbkey "CDS"; gene "emrD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418129.2"; locus_tag "C7A06_RS00145"; product "multidrug efflux MFS transporter EmrD"; protein_id "WP_000828746.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 29536 29610 . + . gene_id "nbis-gene-5807"; ID "nbis-gene-5807"; Name "ysdE"; gbkey "Gene"; gene "ysdE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34670";
+NZ_CP027599.1 RefSeq transcript 29536 29610 . + . gene_id "nbis-gene-5807"; transcript_id "gene-C7A06_RS34670"; ID "gene-C7A06_RS34670"; Name "ysdE"; Parent "nbis-gene-5807"; gbkey "Gene"; gene "ysdE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34670"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 29536 29610 . + . gene_id "nbis-gene-5807"; transcript_id "gene-C7A06_RS34670"; Dbxref "Genbank:WP_211180519.1"; ID "nbis-exon-6116"; Name "WP_211180519.1"; Parent "gene-C7A06_RS34670"; gbkey "CDS"; gene "ysdE"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_010051212.1"; locus_tag "C7A06_RS34670"; product "protein YsdE"; protein_id "WP_211180519.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 29536 29610 . + 0 gene_id "nbis-gene-5807"; transcript_id "gene-C7A06_RS34670"; Dbxref "Genbank:WP_211180519.1"; ID "cds-WP_211180519.1"; Name "WP_211180519.1"; Parent "gene-C7A06_RS34670"; gbkey "CDS"; gene "ysdE"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_010051212.1"; locus_tag "C7A06_RS34670"; product "protein YsdE"; protein_id "WP_211180519.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 29873 29962 . - . gene_id "nbis-gene-29"; ID "nbis-gene-29"; Name "tisB"; gbkey "Gene"; gene "tisB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00155";
+NZ_CP027599.1 RefSeq transcript 29873 29962 . - . gene_id "nbis-gene-29"; transcript_id "gene-C7A06_RS00155"; ID "gene-C7A06_RS00155"; Name "tisB"; Parent "nbis-gene-29"; gbkey "Gene"; gene "tisB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00155"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 29873 29962 . - . gene_id "nbis-gene-29"; transcript_id "gene-C7A06_RS00155"; Dbxref "Genbank:WP_000060506.1"; ID "nbis-exon-30"; Name "WP_000060506.1"; Parent "gene-C7A06_RS00155"; gbkey "CDS"; gene "tisB"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502662.1"; locus_tag "C7A06_RS00155"; product "type I toxin-antitoxin system toxin TisB"; protein_id "WP_000060506.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 29873 29962 . - 0 gene_id "nbis-gene-29"; transcript_id "gene-C7A06_RS00155"; Dbxref "Genbank:WP_000060506.1"; ID "cds-WP_000060506.1"; Name "WP_000060506.1"; Parent "gene-C7A06_RS00155"; gbkey "CDS"; gene "tisB"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502662.1"; locus_tag "C7A06_RS00155"; product "type I toxin-antitoxin system toxin TisB"; protein_id "WP_000060506.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 30527 30625 . + . gene_id "nbis-gene-30"; ID "nbis-gene-30"; Name "ivbL"; gbkey "Gene"; gene "ivbL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00175";
+NZ_CP027599.1 RefSeq transcript 30527 30625 . + . gene_id "nbis-gene-30"; transcript_id "gene-C7A06_RS00175"; ID "gene-C7A06_RS00175"; Name "ivbL"; Parent "nbis-gene-30"; gbkey "Gene"; gene "ivbL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00175"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 30527 30625 . + . gene_id "nbis-gene-30"; transcript_id "gene-C7A06_RS00175"; Dbxref "Genbank:WP_001315912.1"; ID "nbis-exon-31"; Name "WP_001315912.1"; Parent "gene-C7A06_RS00175"; gbkey "CDS"; gene "ivbL"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418128.1"; locus_tag "C7A06_RS00175"; product "ilvB operon leader peptide IvbL"; protein_id "WP_001315912.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 30527 30625 . + 0 gene_id "nbis-gene-30"; transcript_id "gene-C7A06_RS00175"; Dbxref "Genbank:WP_001315912.1"; ID "cds-WP_001315912.1"; Name "WP_001315912.1"; Parent "gene-C7A06_RS00175"; gbkey "CDS"; gene "ivbL"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418128.1"; locus_tag "C7A06_RS00175"; product "ilvB operon leader peptide IvbL"; protein_id "WP_001315912.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 30731 32419 . + . gene_id "nbis-gene-31"; ID "nbis-gene-31"; Name "ilvB"; gbkey "Gene"; gene "ilvB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00180";
+NZ_CP027599.1 RefSeq transcript 30731 32419 . + . gene_id "nbis-gene-31"; transcript_id "gene-C7A06_RS00180"; ID "gene-C7A06_RS00180"; Name "ilvB"; Parent "nbis-gene-31"; gbkey "Gene"; gene "ilvB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00180"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 30731 32419 . + . gene_id "nbis-gene-31"; transcript_id "gene-C7A06_RS00180"; Dbxref "Genbank:WP_000168497.1"; ID "nbis-exon-32"; Name "WP_000168497.1"; Ontology_term "GO:0009082" "GO:0000287" "GO:0003984" "GO:0030976" "GO:0050660"; Parent "gene-C7A06_RS00180"; gbkey "CDS"; gene "ilvB"; go_function "magnesium ion binding|0000287||IEA" "acetolactate synthase activity|0003984||IEA" "thiamine pyrophosphate binding|0030976||IEA" "flavin adenine dinucleotide binding|0050660||IEA"; go_process "branched-chain amino acid biosynthetic process|0009082||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418127.1"; locus_tag "C7A06_RS00180"; product "acetolactate synthase large subunit"; protein_id "WP_000168497.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 30731 32419 . + 0 gene_id "nbis-gene-31"; transcript_id "gene-C7A06_RS00180"; Dbxref "Genbank:WP_000168497.1"; ID "cds-WP_000168497.1"; Name "WP_000168497.1"; Ontology_term "GO:0009082" "GO:0000287" "GO:0003984" "GO:0030976" "GO:0050660"; Parent "gene-C7A06_RS00180"; gbkey "CDS"; gene "ilvB"; go_function "magnesium ion binding|0000287||IEA" "acetolactate synthase activity|0003984||IEA" "thiamine pyrophosphate binding|0030976||IEA" "flavin adenine dinucleotide binding|0050660||IEA"; go_process "branched-chain amino acid biosynthetic process|0009082||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418127.1"; locus_tag "C7A06_RS00180"; product "acetolactate synthase large subunit"; protein_id "WP_000168497.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 32423 32713 . + . gene_id "nbis-gene-32"; ID "nbis-gene-32"; Name "ilvN"; gbkey "Gene"; gene "ilvN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00185";
+NZ_CP027599.1 RefSeq transcript 32423 32713 . + . gene_id "nbis-gene-32"; transcript_id "gene-C7A06_RS00185"; ID "gene-C7A06_RS00185"; Name "ilvN"; Parent "nbis-gene-32"; gbkey "Gene"; gene "ilvN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00185"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 32423 32713 . + . gene_id "nbis-gene-32"; transcript_id "gene-C7A06_RS00185"; Dbxref "Genbank:WP_001181706.1"; ID "nbis-exon-33"; Name "WP_001181706.1"; Parent "gene-C7A06_RS00185"; gbkey "CDS"; gene "ilvN"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312638.1"; locus_tag "C7A06_RS00185"; product "acetolactate synthase small subunit"; protein_id "WP_001181706.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 32423 32713 . + 0 gene_id "nbis-gene-32"; transcript_id "gene-C7A06_RS00185"; Dbxref "Genbank:WP_001181706.1"; ID "cds-WP_001181706.1"; Name "WP_001181706.1"; Parent "gene-C7A06_RS00185"; gbkey "CDS"; gene "ilvN"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312638.1"; locus_tag "C7A06_RS00185"; product "acetolactate synthase small subunit"; protein_id "WP_001181706.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 32788 33378 . + . gene_id "nbis-gene-33"; ID "nbis-gene-33"; Name "uhpA"; gbkey "Gene"; gene "uhpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00190";
+NZ_CP027599.1 RefSeq transcript 32788 33378 . + . gene_id "nbis-gene-33"; transcript_id "gene-C7A06_RS00190"; ID "gene-C7A06_RS00190"; Name "uhpA"; Parent "nbis-gene-33"; gbkey "Gene"; gene "uhpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00190"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 32788 33378 . + . gene_id "nbis-gene-33"; transcript_id "gene-C7A06_RS00190"; Dbxref "Genbank:WP_000633668.1"; ID "nbis-exon-34"; Name "WP_000633668.1"; Ontology_term "GO:0006355" "GO:0003677"; Parent "gene-C7A06_RS00190"; gbkey "CDS"; gene "uhpA"; go_function "DNA binding|0003677||IEA"; go_process "regulation of transcription, DNA-templated|0006355||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312633.1"; locus_tag "C7A06_RS00190"; product "transcriptional regulator UhpA"; protein_id "WP_000633668.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 32788 33378 . + 0 gene_id "nbis-gene-33"; transcript_id "gene-C7A06_RS00190"; Dbxref "Genbank:WP_000633668.1"; ID "cds-WP_000633668.1"; Name "WP_000633668.1"; Ontology_term "GO:0006355" "GO:0003677"; Parent "gene-C7A06_RS00190"; gbkey "CDS"; gene "uhpA"; go_function "DNA binding|0003677||IEA"; go_process "regulation of transcription, DNA-templated|0006355||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312633.1"; locus_tag "C7A06_RS00190"; product "transcriptional regulator UhpA"; protein_id "WP_000633668.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 33378 34880 . + . gene_id "nbis-gene-34"; ID "nbis-gene-34"; Name "uhpB"; gbkey "Gene"; gene "uhpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00195";
+NZ_CP027599.1 RefSeq transcript 33378 34880 . + . gene_id "nbis-gene-34"; transcript_id "gene-C7A06_RS00195"; ID "gene-C7A06_RS00195"; Name "uhpB"; Parent "nbis-gene-34"; gbkey "Gene"; gene "uhpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00195"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 33378 34880 . + . gene_id "nbis-gene-34"; transcript_id "gene-C7A06_RS00195"; Dbxref "Genbank:WP_001295243.1"; ID "nbis-exon-35"; Name "WP_001295243.1"; Ontology_term "GO:0000160" "GO:0000155"; Parent "gene-C7A06_RS00195"; gbkey "CDS"; gene "uhpB"; go_function "phosphorelay sensor kinase activity|0000155||IEA"; go_process "phosphorelay signal transduction system|0000160||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418124.4"; locus_tag "C7A06_RS00195"; product "signal transduction histidine-protein kinase/phosphatase UhpB"; protein_id "WP_001295243.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 33378 34880 . + 0 gene_id "nbis-gene-34"; transcript_id "gene-C7A06_RS00195"; Dbxref "Genbank:WP_001295243.1"; ID "cds-WP_001295243.1"; Name "WP_001295243.1"; Ontology_term "GO:0000160" "GO:0000155"; Parent "gene-C7A06_RS00195"; gbkey "CDS"; gene "uhpB"; go_function "phosphorelay sensor kinase activity|0000155||IEA"; go_process "phosphorelay signal transduction system|0000160||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418124.4"; locus_tag "C7A06_RS00195"; product "signal transduction histidine-protein kinase/phosphatase UhpB"; protein_id "WP_001295243.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 34890 36209 . + . gene_id "nbis-gene-35"; ID "nbis-gene-35"; Name "uhpC"; gbkey "Gene"; gene "uhpC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00200";
+NZ_CP027599.1 RefSeq transcript 34890 36209 . + . gene_id "nbis-gene-35"; transcript_id "gene-C7A06_RS00200"; ID "gene-C7A06_RS00200"; Name "uhpC"; Parent "nbis-gene-35"; gbkey "Gene"; gene "uhpC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00200"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 34890 36209 . + . gene_id "nbis-gene-35"; transcript_id "gene-C7A06_RS00200"; Dbxref "Genbank:WP_001341770.1"; ID "nbis-exon-36"; Name "WP_001341770.1"; Parent "gene-C7A06_RS00200"; gbkey "CDS"; gene "uhpC"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709527.2"; locus_tag "C7A06_RS00200"; product "MFS transporter family glucose-6-phosphate receptor UhpC"; protein_id "WP_001341770.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 34890 36209 . + 0 gene_id "nbis-gene-35"; transcript_id "gene-C7A06_RS00200"; Dbxref "Genbank:WP_001341770.1"; ID "cds-WP_001341770.1"; Name "WP_001341770.1"; Parent "gene-C7A06_RS00200"; gbkey "CDS"; gene "uhpC"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709527.2"; locus_tag "C7A06_RS00200"; product "MFS transporter family glucose-6-phosphate receptor UhpC"; protein_id "WP_001341770.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 36465 37856 . + . gene_id "nbis-gene-36"; ID "nbis-gene-36"; Name "uhpT"; gbkey "Gene"; gene "uhpT"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00205";
+NZ_CP027599.1 RefSeq transcript 36465 37856 . + . gene_id "nbis-gene-36"; transcript_id "gene-C7A06_RS00205"; ID "gene-C7A06_RS00205"; Name "uhpT"; Parent "nbis-gene-36"; gbkey "Gene"; gene "uhpT"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00205"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 36465 37856 . + . gene_id "nbis-gene-36"; transcript_id "gene-C7A06_RS00205"; Dbxref "Genbank:WP_000879194.1"; ID "nbis-exon-37"; Name "WP_000879194.1"; Ontology_term "GO:0055085" "GO:0022857"; Parent "gene-C7A06_RS00205"; gbkey "CDS"; gene "uhpT"; go_function "transmembrane transporter activity|0022857||IEA"; go_process "transmembrane transport|0055085||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312630.1"; locus_tag "C7A06_RS00205"; product "hexose-6-phosphate:phosphate antiporter"; protein_id "WP_000879194.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 36465 37856 . + 0 gene_id "nbis-gene-36"; transcript_id "gene-C7A06_RS00205"; Dbxref "Genbank:WP_000879194.1"; ID "cds-WP_000879194.1"; Name "WP_000879194.1"; Ontology_term "GO:0055085" "GO:0022857"; Parent "gene-C7A06_RS00205"; gbkey "CDS"; gene "uhpT"; go_function "transmembrane transporter activity|0022857||IEA"; go_process "transmembrane transport|0055085||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312630.1"; locus_tag "C7A06_RS00205"; product "hexose-6-phosphate:phosphate antiporter"; protein_id "WP_000879194.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 37901 39667 . - . gene_id "nbis-gene-37"; ID "nbis-gene-37"; Name "adeD"; gbkey "Gene"; gene "adeD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00210";
+NZ_CP027599.1 RefSeq transcript 37901 39667 . - . gene_id "nbis-gene-37"; transcript_id "gene-C7A06_RS00210"; ID "gene-C7A06_RS00210"; Name "adeD"; Parent "nbis-gene-37"; gbkey "Gene"; gene "adeD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00210"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 37901 39667 . - . gene_id "nbis-gene-37"; transcript_id "gene-C7A06_RS00210"; Dbxref "Genbank:WP_001065695.1"; ID "nbis-exon-38"; Name "WP_001065695.1"; Parent "gene-C7A06_RS00210"; gbkey "CDS"; gene "adeD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418121.1"; locus_tag "C7A06_RS00210"; product "adenine deaminase"; protein_id "WP_001065695.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 37901 39667 . - 0 gene_id "nbis-gene-37"; transcript_id "gene-C7A06_RS00210"; Dbxref "Genbank:WP_001065695.1"; ID "cds-WP_001065695.1"; Name "WP_001065695.1"; Parent "gene-C7A06_RS00210"; gbkey "CDS"; gene "adeD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418121.1"; locus_tag "C7A06_RS00210"; product "adenine deaminase"; protein_id "WP_001065695.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 39842 41176 . + . gene_id "nbis-gene-38"; ID "nbis-gene-38"; Name "adeQ"; gbkey "Gene"; gene "adeQ"; gene_biotype "protein_coding"; gene_synonym "yicO"; locus_tag "C7A06_RS00215";
+NZ_CP027599.1 RefSeq transcript 39842 41176 . + . gene_id "nbis-gene-38"; transcript_id "gene-C7A06_RS00215"; ID "gene-C7A06_RS00215"; Name "adeQ"; Parent "nbis-gene-38"; gbkey "Gene"; gene "adeQ"; gene_biotype "protein_coding"; gene_synonym "yicO"; locus_tag "C7A06_RS00215"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 39842 41176 . + . gene_id "nbis-gene-38"; transcript_id "gene-C7A06_RS00215"; Dbxref "Genbank:WP_001349999.1"; ID "nbis-exon-39"; Name "WP_001349999.1"; Parent "gene-C7A06_RS00215"; gbkey "CDS"; gene "adeQ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418120.2"; locus_tag "C7A06_RS00215"; product "adenine permease AdeQ"; protein_id "WP_001349999.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 39842 41176 . + 0 gene_id "nbis-gene-38"; transcript_id "gene-C7A06_RS00215"; Dbxref "Genbank:WP_001349999.1"; ID "cds-WP_001349999.1"; Name "WP_001349999.1"; Parent "gene-C7A06_RS00215"; gbkey "CDS"; gene "adeQ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418120.2"; locus_tag "C7A06_RS00215"; product "adenine permease AdeQ"; protein_id "WP_001349999.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 41229 41681 . + . gene_id "nbis-gene-39"; ID "nbis-gene-39"; Name "yicN"; gbkey "Gene"; gene "yicN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00220";
+NZ_CP027599.1 RefSeq transcript 41229 41681 . + . gene_id "nbis-gene-39"; transcript_id "gene-C7A06_RS00220"; ID "gene-C7A06_RS00220"; Name "yicN"; Parent "nbis-gene-39"; gbkey "Gene"; gene "yicN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00220"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 41229 41681 . + . gene_id "nbis-gene-39"; transcript_id "gene-C7A06_RS00220"; Dbxref "Genbank:WP_001295241.1"; ID "nbis-exon-40"; Name "WP_001295241.1"; Parent "gene-C7A06_RS00220"; gbkey "CDS"; gene "yicN"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418119.2"; locus_tag "C7A06_RS00220"; product "DUF1198 domain-containing protein"; protein_id "WP_001295241.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 41229 41681 . + 0 gene_id "nbis-gene-39"; transcript_id "gene-C7A06_RS00220"; Dbxref "Genbank:WP_001295241.1"; ID "cds-WP_001295241.1"; Name "WP_001295241.1"; Parent "gene-C7A06_RS00220"; gbkey "CDS"; gene "yicN"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418119.2"; locus_tag "C7A06_RS00220"; product "DUF1198 domain-containing protein"; protein_id "WP_001295241.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 41892 43082 . + . gene_id "nbis-gene-40"; ID "nbis-gene-40"; Name "nepI"; gbkey "Gene"; gene "nepI"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00230";
+NZ_CP027599.1 RefSeq transcript 41892 43082 . + . gene_id "nbis-gene-40"; transcript_id "gene-C7A06_RS00230"; ID "gene-C7A06_RS00230"; Name "nepI"; Parent "nbis-gene-40"; gbkey "Gene"; gene "nepI"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00230"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 41892 43082 . + . gene_id "nbis-gene-40"; transcript_id "gene-C7A06_RS00230"; Dbxref "Genbank:WP_001288553.1"; ID "nbis-exon-41"; Name "WP_001288553.1"; Ontology_term "GO:0015860" "GO:0015211" "GO:0016021"; Parent "gene-C7A06_RS00230"; gbkey "CDS"; gene "nepI"; go_component "integral component of membrane|0016021||IEA"; go_function "purine nucleoside transmembrane transporter activity|0015211||IEA"; go_process "purine nucleoside transmembrane transport|0015860||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418118.2"; locus_tag "C7A06_RS00230"; product "purine ribonucleoside efflux pump NepI"; protein_id "WP_001288553.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 41892 43082 . + 0 gene_id "nbis-gene-40"; transcript_id "gene-C7A06_RS00230"; Dbxref "Genbank:WP_001288553.1"; ID "cds-WP_001288553.1"; Name "WP_001288553.1"; Ontology_term "GO:0015860" "GO:0015211" "GO:0016021"; Parent "gene-C7A06_RS00230"; gbkey "CDS"; gene "nepI"; go_component "integral component of membrane|0016021||IEA"; go_function "purine nucleoside transmembrane transporter activity|0015211||IEA"; go_process "purine nucleoside transmembrane transport|0015860||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418118.2"; locus_tag "C7A06_RS00230"; product "purine ribonucleoside efflux pump NepI"; protein_id "WP_001288553.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 43123 43416 . - . gene_id "nbis-gene-41"; ID "nbis-gene-41"; Name "C7A06_RS00235"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00235";
+NZ_CP027599.1 RefSeq transcript 43123 43416 . - . gene_id "nbis-gene-41"; transcript_id "gene-C7A06_RS00235"; ID "gene-C7A06_RS00235"; Name "C7A06_RS00235"; Parent "nbis-gene-41"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00235"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 43123 43416 . - . gene_id "nbis-gene-41"; transcript_id "gene-C7A06_RS00235"; Dbxref "Genbank:WP_000805507.1"; ID "nbis-exon-42"; Name "WP_000805507.1"; Parent "gene-C7A06_RS00235"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_588471.1"; locus_tag "C7A06_RS00235"; product "hypothetical protein"; protein_id "WP_000805507.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 43123 43416 . - 0 gene_id "nbis-gene-41"; transcript_id "gene-C7A06_RS00235"; Dbxref "Genbank:WP_000805507.1"; ID "cds-WP_000805507.1"; Name "WP_000805507.1"; Parent "gene-C7A06_RS00235"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_588471.1"; locus_tag "C7A06_RS00235"; product "hypothetical protein"; protein_id "WP_000805507.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 43638 44456 . + . gene_id "nbis-gene-42"; ID "nbis-gene-42"; Name "nlpA"; gbkey "Gene"; gene "nlpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00245";
+NZ_CP027599.1 RefSeq transcript 43638 44456 . + . gene_id "nbis-gene-42"; transcript_id "gene-C7A06_RS00245"; ID "gene-C7A06_RS00245"; Name "nlpA"; Parent "nbis-gene-42"; gbkey "Gene"; gene "nlpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00245"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 43638 44456 . + . gene_id "nbis-gene-42"; transcript_id "gene-C7A06_RS00245"; Dbxref "Genbank:WP_000779426.1"; ID "nbis-exon-43"; Name "WP_000779426.1"; Parent "gene-C7A06_RS00245"; gbkey "CDS"; gene "nlpA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418117.1"; locus_tag "C7A06_RS00245"; product "lipoprotein NlpA"; protein_id "WP_000779426.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 43638 44456 . + 0 gene_id "nbis-gene-42"; transcript_id "gene-C7A06_RS00245"; Dbxref "Genbank:WP_000779426.1"; ID "cds-WP_000779426.1"; Name "WP_000779426.1"; Parent "gene-C7A06_RS00245"; gbkey "CDS"; gene "nlpA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418117.1"; locus_tag "C7A06_RS00245"; product "lipoprotein NlpA"; protein_id "WP_000779426.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 44460 45383 . - . gene_id "nbis-gene-43"; ID "nbis-gene-43"; Name "yicL"; gbkey "Gene"; gene "yicL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00250";
+NZ_CP027599.1 RefSeq transcript 44460 45383 . - . gene_id "nbis-gene-43"; transcript_id "gene-C7A06_RS00250"; ID "gene-C7A06_RS00250"; Name "yicL"; Parent "nbis-gene-43"; gbkey "Gene"; gene "yicL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00250"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 44460 45383 . - . gene_id "nbis-gene-43"; transcript_id "gene-C7A06_RS00250"; Dbxref "Genbank:WP_000535958.1"; ID "nbis-exon-44"; Name "WP_000535958.1"; Ontology_term "GO:0016021"; Parent "gene-C7A06_RS00250"; gbkey "CDS"; gene "yicL"; go_component "integral component of membrane|0016021||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418116.1"; locus_tag "C7A06_RS00250"; product "carboxylate/amino acid/amine transporter"; protein_id "WP_000535958.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 44460 45383 . - 0 gene_id "nbis-gene-43"; transcript_id "gene-C7A06_RS00250"; Dbxref "Genbank:WP_000535958.1"; ID "cds-WP_000535958.1"; Name "WP_000535958.1"; Ontology_term "GO:0016021"; Parent "gene-C7A06_RS00250"; gbkey "CDS"; gene "yicL"; go_component "integral component of membrane|0016021||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418116.1"; locus_tag "C7A06_RS00250"; product "carboxylate/amino acid/amine transporter"; protein_id "WP_000535958.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 45494 46678 . - . gene_id "nbis-gene-44"; ID "nbis-gene-44"; Name "setC"; gbkey "Gene"; gene "setC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00255";
+NZ_CP027599.1 RefSeq transcript 45494 46678 . - . gene_id "nbis-gene-44"; transcript_id "gene-C7A06_RS00255"; ID "gene-C7A06_RS00255"; Name "setC"; Parent "nbis-gene-44"; gbkey "Gene"; gene "setC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00255"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 45494 46678 . - . gene_id "nbis-gene-44"; transcript_id "gene-C7A06_RS00255"; Dbxref "Genbank:WP_001172895.1"; ID "nbis-exon-45"; Name "WP_001172895.1"; Ontology_term "GO:0008643" "GO:0005351"; Parent "gene-C7A06_RS00255"; gbkey "CDS"; gene "setC"; go_function "carbohydrate:proton symporter activity|0005351||IEA"; go_process "carbohydrate transport|0008643||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418115.1"; locus_tag "C7A06_RS00255"; product "sugar efflux transporter"; protein_id "WP_001172895.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 45494 46678 . - 0 gene_id "nbis-gene-44"; transcript_id "gene-C7A06_RS00255"; Dbxref "Genbank:WP_001172895.1"; ID "cds-WP_001172895.1"; Name "WP_001172895.1"; Ontology_term "GO:0008643" "GO:0005351"; Parent "gene-C7A06_RS00255"; gbkey "CDS"; gene "setC"; go_function "carbohydrate:proton symporter activity|0005351||IEA"; go_process "carbohydrate transport|0008643||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418115.1"; locus_tag "C7A06_RS00255"; product "sugar efflux transporter"; protein_id "WP_001172895.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 47107 47235 . - . gene_id "nbis-pseudogene-2"; ID "nbis-pseudogene-2"; Name "C7A06_RS00260"; end_range "47235" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00260"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "47107";
+NZ_CP027599.1 RefSeq transcript 47107 47235 . - . gene_id "nbis-pseudogene-2"; transcript_id "gene-C7A06_RS00260"; ID "gene-C7A06_RS00260"; Name "C7A06_RS00260"; Parent "nbis-pseudogene-2"; end_range "47235" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00260"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "47107";
+NZ_CP027599.1 Protein Homology exon 47107 47235 . - . gene_id "nbis-pseudogene-2"; transcript_id "gene-C7A06_RS00260"; ID "nbis-exon-46"; Note "internal stop; incomplete; partial in the middle of a contig; missing N-terminus and C-terminus"; Parent "gene-C7A06_RS00260"; end_range "47235" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_462654.1"; locus_tag "C7A06_RS00260"; partial "true"; product "virulence RhuM family protein"; pseudo "true"; start_range "." "47107"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 47107 47235 . - 0 gene_id "nbis-pseudogene-2"; transcript_id "gene-C7A06_RS00260"; ID "cds-C7A06_RS00260"; Note "internal stop; incomplete; partial in the middle of a contig; missing N-terminus and C-terminus"; Parent "gene-C7A06_RS00260"; end_range "47235" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_462654.1"; locus_tag "C7A06_RS00260"; partial "true"; product "virulence RhuM family protein"; pseudo "true"; start_range "." "47107"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 47473 48315 . - . gene_id "nbis-gene-45"; ID "nbis-gene-45"; Name "C7A06_RS00270"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00270";
+NZ_CP027599.1 RefSeq transcript 47473 48315 . - . gene_id "nbis-gene-45"; transcript_id "gene-C7A06_RS00270"; ID "gene-C7A06_RS00270"; Name "C7A06_RS00270"; Parent "nbis-gene-45"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00270"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 47473 48315 . - . gene_id "nbis-gene-45"; transcript_id "gene-C7A06_RS00270"; Dbxref "Genbank:WP_032348719.1"; ID "nbis-exon-47"; Name "WP_032348719.1"; Parent "gene-C7A06_RS00270"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001696593.1"; locus_tag "C7A06_RS00270"; product "DUF4942 domain-containing protein"; protein_id "WP_032348719.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 47473 48315 . - 0 gene_id "nbis-gene-45"; transcript_id "gene-C7A06_RS00270"; Dbxref "Genbank:WP_032348719.1"; ID "cds-WP_032348719.1"; Name "WP_032348719.1"; Parent "gene-C7A06_RS00270"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001696593.1"; locus_tag "C7A06_RS00270"; product "DUF4942 domain-containing protein"; protein_id "WP_032348719.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 48400 48597 . - . gene_id "nbis-gene-46"; ID "nbis-gene-46"; Name "C7A06_RS00275"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00275";
+NZ_CP027599.1 RefSeq transcript 48400 48597 . - . gene_id "nbis-gene-46"; transcript_id "gene-C7A06_RS00275"; ID "gene-C7A06_RS00275"; Name "C7A06_RS00275"; Parent "nbis-gene-46"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00275"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 48400 48597 . - . gene_id "nbis-gene-46"; transcript_id "gene-C7A06_RS00275"; Dbxref "Genbank:WP_086795284.1"; ID "nbis-exon-48"; Name "WP_086795284.1"; Parent "gene-C7A06_RS00275"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_708775.1"; locus_tag "C7A06_RS00275"; product "DUF957 domain-containing protein"; protein_id "WP_086795284.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 48400 48597 . - 0 gene_id "nbis-gene-46"; transcript_id "gene-C7A06_RS00275"; Dbxref "Genbank:WP_086795284.1"; ID "cds-WP_086795284.1"; Name "WP_086795284.1"; Parent "gene-C7A06_RS00275"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_708775.1"; locus_tag "C7A06_RS00275"; product "DUF957 domain-containing protein"; protein_id "WP_086795284.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 48673 48822 . - . gene_id "nbis-pseudogene-3"; ID "nbis-pseudogene-3"; Name "C7A06_RS00280"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00280"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "48673";
+NZ_CP027599.1 RefSeq transcript 48673 48822 . - . gene_id "nbis-pseudogene-3"; transcript_id "gene-C7A06_RS00280"; ID "gene-C7A06_RS00280"; Name "C7A06_RS00280"; Parent "nbis-pseudogene-3"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00280"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "48673";
+NZ_CP027599.1 Protein Homology exon 48673 48822 . - . gene_id "nbis-pseudogene-3"; transcript_id "gene-C7A06_RS00280"; ID "nbis-exon-49"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS00280"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_708774.1"; locus_tag "C7A06_RS00280"; partial "true"; product "DUF5983 family protein"; pseudo "true"; start_range "." "48673"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 48673 48822 . - 0 gene_id "nbis-pseudogene-3"; transcript_id "gene-C7A06_RS00280"; ID "cds-C7A06_RS00280"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS00280"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_708774.1"; locus_tag "C7A06_RS00280"; partial "true"; product "DUF5983 family protein"; pseudo "true"; start_range "." "48673"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 48819 49196 . - . gene_id "nbis-gene-47"; ID "nbis-gene-47"; Name "cbtA"; gbkey "Gene"; gene "cbtA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00285";
+NZ_CP027599.1 RefSeq transcript 48819 49196 . - . gene_id "nbis-gene-47"; transcript_id "gene-C7A06_RS00285"; ID "gene-C7A06_RS00285"; Name "cbtA"; Parent "nbis-gene-47"; gbkey "Gene"; gene "cbtA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00285"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 48819 49196 . - . gene_id "nbis-gene-47"; transcript_id "gene-C7A06_RS00285"; Dbxref "Genbank:WP_000854821.1"; ID "nbis-exon-50"; Name "WP_000854821.1"; Parent "gene-C7A06_RS00285"; gbkey "CDS"; gene "cbtA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000854828.1"; locus_tag "C7A06_RS00285"; product "type IV toxin-antitoxin system toxin CbtA"; protein_id "WP_000854821.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 48819 49196 . - 0 gene_id "nbis-gene-47"; transcript_id "gene-C7A06_RS00285"; Dbxref "Genbank:WP_000854821.1"; ID "cds-WP_000854821.1"; Name "WP_000854821.1"; Parent "gene-C7A06_RS00285"; gbkey "CDS"; gene "cbtA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000854828.1"; locus_tag "C7A06_RS00285"; product "type IV toxin-antitoxin system toxin CbtA"; protein_id "WP_000854821.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 49286 49654 . - . gene_id "nbis-gene-48"; ID "nbis-gene-48"; Name "C7A06_RS00290"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00290";
+NZ_CP027599.1 RefSeq transcript 49286 49654 . - . gene_id "nbis-gene-48"; transcript_id "gene-C7A06_RS00290"; ID "gene-C7A06_RS00290"; Name "C7A06_RS00290"; Parent "nbis-gene-48"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00290"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 49286 49654 . - . gene_id "nbis-gene-48"; transcript_id "gene-C7A06_RS00290"; Dbxref "Genbank:WP_001285609.1"; ID "nbis-exon-51"; Name "WP_001285609.1"; Parent "gene-C7A06_RS00290"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001443430.1"; locus_tag "C7A06_RS00290"; product "type IV toxin-antitoxin system YeeU family antitoxin"; protein_id "WP_001285609.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 49286 49654 . - 0 gene_id "nbis-gene-48"; transcript_id "gene-C7A06_RS00290"; Dbxref "Genbank:WP_001285609.1"; ID "cds-WP_001285609.1"; Name "WP_001285609.1"; Parent "gene-C7A06_RS00290"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001443430.1"; locus_tag "C7A06_RS00290"; product "type IV toxin-antitoxin system YeeU family antitoxin"; protein_id "WP_001285609.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 49734 49955 . - . gene_id "nbis-pseudogene-4"; ID "nbis-pseudogene-4"; Name "C7A06_RS00295"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00295"; original_biotype "pseudogene"; pseudo "true";
+NZ_CP027599.1 RefSeq transcript 49734 49955 . - . gene_id "nbis-pseudogene-4"; transcript_id "gene-C7A06_RS00295"; ID "gene-C7A06_RS00295"; Name "C7A06_RS00295"; Parent "nbis-pseudogene-4"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00295"; original_biotype "mrna"; pseudo "true";
+NZ_CP027599.1 Protein Homology exon 49734 49955 . - . gene_id "nbis-pseudogene-4"; transcript_id "gene-C7A06_RS00295"; ID "nbis-exon-52"; Note "internal stop"; Parent "gene-C7A06_RS00295"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_708771.1"; locus_tag "C7A06_RS00295"; product "DUF987 domain-containing protein"; pseudo "true"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 49734 49955 . - 0 gene_id "nbis-pseudogene-4"; transcript_id "gene-C7A06_RS00295"; ID "cds-C7A06_RS00295"; Note "internal stop"; Parent "gene-C7A06_RS00295"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_708771.1"; locus_tag "C7A06_RS00295"; product "DUF987 domain-containing protein"; pseudo "true"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 50042 50518 . - . gene_id "nbis-gene-49"; ID "nbis-gene-49"; Name "C7A06_RS00300"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00300";
+NZ_CP027599.1 RefSeq transcript 50042 50518 . - . gene_id "nbis-gene-49"; transcript_id "gene-C7A06_RS00300"; ID "gene-C7A06_RS00300"; Name "C7A06_RS00300"; Parent "nbis-gene-49"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00300"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 50042 50518 . - . gene_id "nbis-gene-49"; transcript_id "gene-C7A06_RS00300"; Dbxref "Genbank:WP_001186768.1"; ID "nbis-exon-53"; Name "WP_001186768.1"; Parent "gene-C7A06_RS00300"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_310830.1"; locus_tag "C7A06_RS00300"; product "RadC family protein"; protein_id "WP_001186768.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 50042 50518 . - 0 gene_id "nbis-gene-49"; transcript_id "gene-C7A06_RS00300"; Dbxref "Genbank:WP_001186768.1"; ID "cds-WP_001186768.1"; Name "WP_001186768.1"; Parent "gene-C7A06_RS00300"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_310830.1"; locus_tag "C7A06_RS00300"; product "RadC family protein"; protein_id "WP_001186768.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 50533 51012 . - . gene_id "nbis-gene-50"; ID "nbis-gene-50"; Name "C7A06_RS00305"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00305";
+NZ_CP027599.1 RefSeq transcript 50533 51012 . - . gene_id "nbis-gene-50"; transcript_id "gene-C7A06_RS00305"; ID "gene-C7A06_RS00305"; Name "C7A06_RS00305"; Parent "nbis-gene-50"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00305"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 50533 51012 . - . gene_id "nbis-gene-50"; transcript_id "gene-C7A06_RS00305"; Dbxref "Genbank:WP_000706979.1"; ID "nbis-exon-54"; Name "WP_000706979.1"; Parent "gene-C7A06_RS00305"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_708769.2"; locus_tag "C7A06_RS00305"; product "antirestriction protein"; protein_id "WP_000706979.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 50533 51012 . - 0 gene_id "nbis-gene-50"; transcript_id "gene-C7A06_RS00305"; Dbxref "Genbank:WP_000706979.1"; ID "cds-WP_000706979.1"; Name "WP_000706979.1"; Parent "gene-C7A06_RS00305"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_708769.2"; locus_tag "C7A06_RS00305"; product "antirestriction protein"; protein_id "WP_000706979.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 51112 51252 . + . gene_id "nbis-gene-5706"; ID "nbis-gene-5706"; Name "C7A06_RS33905"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33905";
+NZ_CP027599.1 RefSeq transcript 51112 51252 . + . gene_id "nbis-gene-5706"; transcript_id "gene-C7A06_RS33905"; ID "gene-C7A06_RS33905"; Name "C7A06_RS33905"; Parent "nbis-gene-5706"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33905"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 51112 51252 . + . gene_id "nbis-gene-5706"; transcript_id "gene-C7A06_RS33905"; Dbxref "Genbank:WP_000997937.1"; ID "nbis-exon-5987"; Name "WP_000997937.1"; Parent "gene-C7A06_RS33905"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000997937.1"; locus_tag "C7A06_RS33905"; product "hypothetical protein"; protein_id "WP_000997937.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 51112 51252 . + 0 gene_id "nbis-gene-5706"; transcript_id "gene-C7A06_RS33905"; Dbxref "Genbank:WP_000997937.1"; ID "cds-WP_000997937.1"; Name "WP_000997937.1"; Parent "gene-C7A06_RS33905"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000997937.1"; locus_tag "C7A06_RS33905"; product "hypothetical protein"; protein_id "WP_000997937.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 51290 52096 . - . gene_id "nbis-gene-51"; ID "nbis-gene-51"; Name "C7A06_RS00310"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00310";
+NZ_CP027599.1 RefSeq transcript 51290 52096 . - . gene_id "nbis-gene-51"; transcript_id "gene-C7A06_RS00310"; ID "gene-C7A06_RS00310"; Name "C7A06_RS00310"; Parent "nbis-gene-51"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00310"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 51290 52096 . - . gene_id "nbis-gene-51"; transcript_id "gene-C7A06_RS00310"; Dbxref "Genbank:WP_001175154.1"; ID "nbis-exon-55"; Name "WP_001175154.1"; Parent "gene-C7A06_RS00310"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_309428.1"; locus_tag "C7A06_RS00310"; product "DUF945 domain-containing protein"; protein_id "WP_001175154.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 51290 52096 . - 0 gene_id "nbis-gene-51"; transcript_id "gene-C7A06_RS00310"; Dbxref "Genbank:WP_001175154.1"; ID "cds-WP_001175154.1"; Name "WP_001175154.1"; Parent "gene-C7A06_RS00310"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_309428.1"; locus_tag "C7A06_RS00310"; product "DUF945 domain-containing protein"; protein_id "WP_001175154.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 52186 52419 . - . gene_id "nbis-gene-52"; ID "nbis-gene-52"; Name "C7A06_RS00315"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00315";
+NZ_CP027599.1 RefSeq transcript 52186 52419 . - . gene_id "nbis-gene-52"; transcript_id "gene-C7A06_RS00315"; ID "gene-C7A06_RS00315"; Name "C7A06_RS00315"; Parent "nbis-gene-52"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00315"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 52186 52419 . - . gene_id "nbis-gene-52"; transcript_id "gene-C7A06_RS00315"; Dbxref "Genbank:WP_001278287.1"; ID "nbis-exon-56"; Name "WP_001278287.1"; Parent "gene-C7A06_RS00315"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001278287.1"; locus_tag "C7A06_RS00315"; product "DUF905 family protein"; protein_id "WP_001278287.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 52186 52419 . - 0 gene_id "nbis-gene-52"; transcript_id "gene-C7A06_RS00315"; Dbxref "Genbank:WP_001278287.1"; ID "cds-WP_001278287.1"; Name "WP_001278287.1"; Parent "gene-C7A06_RS00315"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001278287.1"; locus_tag "C7A06_RS00315"; product "DUF905 family protein"; protein_id "WP_001278287.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 52425 53102 . - . gene_id "nbis-gene-53"; ID "nbis-gene-53"; Name "C7A06_RS00320"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00320";
+NZ_CP027599.1 RefSeq transcript 52425 53102 . - . gene_id "nbis-gene-53"; transcript_id "gene-C7A06_RS00320"; ID "gene-C7A06_RS00320"; Name "C7A06_RS00320"; Parent "nbis-gene-53"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00320"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 52425 53102 . - . gene_id "nbis-gene-53"; transcript_id "gene-C7A06_RS00320"; Dbxref "Genbank:WP_001097301.1"; ID "nbis-exon-57"; Name "WP_001097301.1"; Parent "gene-C7A06_RS00320"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001097314.1"; locus_tag "C7A06_RS00320"; product "hypothetical protein"; protein_id "WP_001097301.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 52425 53102 . - 0 gene_id "nbis-gene-53"; transcript_id "gene-C7A06_RS00320"; Dbxref "Genbank:WP_001097301.1"; ID "cds-WP_001097301.1"; Name "WP_001097301.1"; Parent "gene-C7A06_RS00320"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001097314.1"; locus_tag "C7A06_RS00320"; product "hypothetical protein"; protein_id "WP_001097301.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 53250 53930 . - . gene_id "nbis-gene-54"; ID "nbis-gene-54"; Name "C7A06_RS00325"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00325";
+NZ_CP027599.1 RefSeq transcript 53250 53930 . - . gene_id "nbis-gene-54"; transcript_id "gene-C7A06_RS00325"; ID "gene-C7A06_RS00325"; Name "C7A06_RS00325"; Parent "nbis-gene-54"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00325"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 53250 53930 . - . gene_id "nbis-gene-54"; transcript_id "gene-C7A06_RS00325"; Dbxref "Genbank:WP_001282919.1"; ID "nbis-exon-58"; Name "WP_001282919.1"; Parent "gene-C7A06_RS00325"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001278649.1"; locus_tag "C7A06_RS00325"; product "WYL domain-containing protein"; protein_id "WP_001282919.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 53250 53930 . - 0 gene_id "nbis-gene-54"; transcript_id "gene-C7A06_RS00325"; Dbxref "Genbank:WP_001282919.1"; ID "cds-WP_001282919.1"; Name "WP_001282919.1"; Parent "gene-C7A06_RS00325"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001278649.1"; locus_tag "C7A06_RS00325"; product "WYL domain-containing protein"; protein_id "WP_001282919.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 54133 55017 . - . gene_id "nbis-gene-55"; ID "nbis-gene-55"; Name "C7A06_RS00330"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00330";
+NZ_CP027599.1 RefSeq transcript 54133 55017 . - . gene_id "nbis-gene-55"; transcript_id "gene-C7A06_RS00330"; ID "gene-C7A06_RS00330"; Name "C7A06_RS00330"; Parent "nbis-gene-55"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00330"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 54133 55017 . - . gene_id "nbis-gene-55"; transcript_id "gene-C7A06_RS00330"; Dbxref "Genbank:WP_000010408.1"; ID "nbis-exon-59"; Name "WP_000010408.1"; Ontology_term "GO:0005525"; Parent "gene-C7A06_RS00330"; gbkey "CDS"; go_function "GTP binding|0005525||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001557377.1"; locus_tag "C7A06_RS00330"; product "50S ribosome-binding GTPase"; protein_id "WP_000010408.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 54133 55017 . - 0 gene_id "nbis-gene-55"; transcript_id "gene-C7A06_RS00330"; Dbxref "Genbank:WP_000010408.1"; ID "cds-WP_000010408.1"; Name "WP_000010408.1"; Ontology_term "GO:0005525"; Parent "gene-C7A06_RS00330"; gbkey "CDS"; go_function "GTP binding|0005525||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001557377.1"; locus_tag "C7A06_RS00330"; product "50S ribosome-binding GTPase"; protein_id "WP_000010408.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 55202 56332 . + . gene_id "nbis-gene-56"; ID "nbis-gene-56"; Name "C7A06_RS00335"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00335";
+NZ_CP027599.1 RefSeq transcript 55202 56332 . + . gene_id "nbis-gene-56"; transcript_id "gene-C7A06_RS00335"; ID "gene-C7A06_RS00335"; Name "C7A06_RS00335"; Parent "nbis-gene-56"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00335"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 55202 56332 . + . gene_id "nbis-gene-56"; transcript_id "gene-C7A06_RS00335"; Dbxref "Genbank:WP_000147741.1"; ID "nbis-exon-60"; Name "WP_000147741.1"; Parent "gene-C7A06_RS00335"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000147750.1"; locus_tag "C7A06_RS00335"; product "hypothetical protein"; protein_id "WP_000147741.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 55202 56332 . + 0 gene_id "nbis-gene-56"; transcript_id "gene-C7A06_RS00335"; Dbxref "Genbank:WP_000147741.1"; ID "cds-WP_000147741.1"; Name "WP_000147741.1"; Parent "gene-C7A06_RS00335"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000147750.1"; locus_tag "C7A06_RS00335"; product "hypothetical protein"; protein_id "WP_000147741.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 57825 58556 . + . gene_id "nbis-gene-57"; ID "nbis-gene-57"; Name "C7A06_RS00340"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00340";
+NZ_CP027599.1 RefSeq transcript 57825 58556 . + . gene_id "nbis-gene-57"; transcript_id "gene-C7A06_RS00340"; ID "gene-C7A06_RS00340"; Name "C7A06_RS00340"; Parent "nbis-gene-57"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00340"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 57825 58556 . + . gene_id "nbis-gene-57"; transcript_id "gene-C7A06_RS00340"; Dbxref "Genbank:WP_001075456.1"; ID "nbis-exon-61"; Name "WP_001075456.1"; Parent "gene-C7A06_RS00340"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001075464.1"; locus_tag "C7A06_RS00340"; product "inovirus Gp2 family protein"; protein_id "WP_001075456.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 57825 58556 . + 0 gene_id "nbis-gene-57"; transcript_id "gene-C7A06_RS00340"; Dbxref "Genbank:WP_001075456.1"; ID "cds-WP_001075456.1"; Name "WP_001075456.1"; Parent "gene-C7A06_RS00340"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001075464.1"; locus_tag "C7A06_RS00340"; product "inovirus Gp2 family protein"; protein_id "WP_001075456.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 58884 59762 . + . gene_id "nbis-gene-58"; ID "nbis-gene-58"; Name "C7A06_RS00345"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00345";
+NZ_CP027599.1 RefSeq transcript 58884 59762 . + . gene_id "nbis-gene-58"; transcript_id "gene-C7A06_RS00345"; ID "gene-C7A06_RS00345"; Name "C7A06_RS00345"; Parent "nbis-gene-58"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00345"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 58884 59762 . + . gene_id "nbis-gene-58"; transcript_id "gene-C7A06_RS00345"; Dbxref "Genbank:WP_000769115.1"; ID "nbis-exon-62"; Name "WP_000769115.1"; Parent "gene-C7A06_RS00345"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_008786839.1"; locus_tag "C7A06_RS00345"; product "restriction endonuclease"; protein_id "WP_000769115.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 58884 59762 . + 0 gene_id "nbis-gene-58"; transcript_id "gene-C7A06_RS00345"; Dbxref "Genbank:WP_000769115.1"; ID "cds-WP_000769115.1"; Name "WP_000769115.1"; Parent "gene-C7A06_RS00345"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_008786839.1"; locus_tag "C7A06_RS00345"; product "restriction endonuclease"; protein_id "WP_000769115.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 59816 60369 . + . gene_id "nbis-pseudogene-5"; ID "nbis-pseudogene-5"; Name "C7A06_RS00350"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00350"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "59816";
+NZ_CP027599.1 RefSeq transcript 59816 60369 . + . gene_id "nbis-pseudogene-5"; transcript_id "gene-C7A06_RS00350"; ID "gene-C7A06_RS00350"; Name "C7A06_RS00350"; Parent "nbis-pseudogene-5"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00350"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "59816";
+NZ_CP027599.1 Protein Homology exon 59816 60369 . + . gene_id "nbis-pseudogene-5"; transcript_id "gene-C7A06_RS00350"; ID "nbis-exon-63"; Note "frameshifted; internal stop; incomplete; partial in the middle of a contig; missing N-terminus"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS00350"; gbkey "CDS"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000343613.1"; locus_tag "C7A06_RS00350"; partial "true"; product "transposase"; pseudo "true"; start_range "." "59816"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 59816 60369 . + 0 gene_id "nbis-pseudogene-5"; transcript_id "gene-C7A06_RS00350"; ID "cds-C7A06_RS00350"; Note "frameshifted; internal stop; incomplete; partial in the middle of a contig; missing N-terminus"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS00350"; gbkey "CDS"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000343613.1"; locus_tag "C7A06_RS00350"; partial "true"; product "transposase"; pseudo "true"; start_range "." "59816"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 61437 62003 . + . gene_id "nbis-gene-59"; ID "nbis-gene-59"; Name "C7A06_RS00355"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00355";
+NZ_CP027599.1 RefSeq transcript 61437 62003 . + . gene_id "nbis-gene-59"; transcript_id "gene-C7A06_RS00355"; ID "gene-C7A06_RS00355"; Name "C7A06_RS00355"; Parent "nbis-gene-59"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00355"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 61437 62003 . + . gene_id "nbis-gene-59"; transcript_id "gene-C7A06_RS00355"; Dbxref "Genbank:WP_001126817.1"; ID "nbis-exon-64"; Name "WP_001126817.1"; Parent "gene-C7A06_RS00355"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001126805.1"; locus_tag "C7A06_RS00355"; product "inovirus-type Gp2 protein"; protein_id "WP_001126817.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 61437 62003 . + 0 gene_id "nbis-gene-59"; transcript_id "gene-C7A06_RS00355"; Dbxref "Genbank:WP_001126817.1"; ID "cds-WP_001126817.1"; Name "WP_001126817.1"; Parent "gene-C7A06_RS00355"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001126805.1"; locus_tag "C7A06_RS00355"; product "inovirus-type Gp2 protein"; protein_id "WP_001126817.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 62250 62822 . + . gene_id "nbis-gene-60"; ID "nbis-gene-60"; Name "C7A06_RS00360"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00360";
+NZ_CP027599.1 RefSeq transcript 62250 62822 . + . gene_id "nbis-gene-60"; transcript_id "gene-C7A06_RS00360"; ID "gene-C7A06_RS00360"; Name "C7A06_RS00360"; Parent "nbis-gene-60"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00360"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 62250 62822 . + . gene_id "nbis-gene-60"; transcript_id "gene-C7A06_RS00360"; Dbxref "Genbank:WP_000991590.1"; ID "nbis-exon-65"; Name "WP_000991590.1"; Parent "gene-C7A06_RS00360"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012602601.1"; locus_tag "C7A06_RS00360"; product "hypothetical protein"; protein_id "WP_000991590.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 62250 62822 . + 0 gene_id "nbis-gene-60"; transcript_id "gene-C7A06_RS00360"; Dbxref "Genbank:WP_000991590.1"; ID "cds-WP_000991590.1"; Name "WP_000991590.1"; Parent "gene-C7A06_RS00360"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012602601.1"; locus_tag "C7A06_RS00360"; product "hypothetical protein"; protein_id "WP_000991590.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 62891 63127 . + . gene_id "nbis-gene-61"; ID "nbis-gene-61"; Name "C7A06_RS00365"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00365";
+NZ_CP027599.1 RefSeq transcript 62891 63127 . + . gene_id "nbis-gene-61"; transcript_id "gene-C7A06_RS00365"; ID "gene-C7A06_RS00365"; Name "C7A06_RS00365"; Parent "nbis-gene-61"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00365"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 62891 63127 . + . gene_id "nbis-gene-61"; transcript_id "gene-C7A06_RS00365"; Dbxref "Genbank:WP_000958094.1"; ID "nbis-exon-66"; Name "WP_000958094.1"; Parent "gene-C7A06_RS00365"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000958092.1"; locus_tag "C7A06_RS00365"; product "AlpA family transcriptional regulator"; protein_id "WP_000958094.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 62891 63127 . + 0 gene_id "nbis-gene-61"; transcript_id "gene-C7A06_RS00365"; Dbxref "Genbank:WP_000958094.1"; ID "cds-WP_000958094.1"; Name "WP_000958094.1"; Parent "gene-C7A06_RS00365"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000958092.1"; locus_tag "C7A06_RS00365"; product "AlpA family transcriptional regulator"; protein_id "WP_000958094.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 63762 64880 . + . gene_id "nbis-gene-62"; ID "nbis-gene-62"; Name "C7A06_RS00375"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00375";
+NZ_CP027599.1 RefSeq transcript 63762 64880 . + . gene_id "nbis-gene-62"; transcript_id "gene-C7A06_RS00375"; ID "gene-C7A06_RS00375"; Name "C7A06_RS00375"; Parent "nbis-gene-62"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00375"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 63762 64880 . + . gene_id "nbis-gene-62"; transcript_id "gene-C7A06_RS00375"; Dbxref "Genbank:WP_001231527.1"; ID "nbis-exon-67"; Name "WP_001231527.1"; Parent "gene-C7A06_RS00375"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001231518.1"; locus_tag "C7A06_RS00375"; product "glycosyltransferase"; protein_id "WP_001231527.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 63762 64880 . + 0 gene_id "nbis-gene-62"; transcript_id "gene-C7A06_RS00375"; Dbxref "Genbank:WP_001231527.1"; ID "cds-WP_001231527.1"; Name "WP_001231527.1"; Parent "gene-C7A06_RS00375"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001231518.1"; locus_tag "C7A06_RS00375"; product "glycosyltransferase"; protein_id "WP_001231527.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 65029 66294 . - . gene_id "nbis-gene-63"; ID "nbis-gene-63"; Name "C7A06_RS00380"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00380";
+NZ_CP027599.1 RefSeq transcript 65029 66294 . - . gene_id "nbis-gene-63"; transcript_id "gene-C7A06_RS00380"; ID "gene-C7A06_RS00380"; Name "C7A06_RS00380"; Parent "nbis-gene-63"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00380"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 65029 66294 . - . gene_id "nbis-gene-63"; transcript_id "gene-C7A06_RS00380"; Dbxref "Genbank:WP_000800845.1"; ID "nbis-exon-68"; Name "WP_000800845.1"; Parent "gene-C7A06_RS00380"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000800843.1"; locus_tag "C7A06_RS00380"; product "alpha/beta hydrolase-fold protein"; protein_id "WP_000800845.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 65029 66294 . - 0 gene_id "nbis-gene-63"; transcript_id "gene-C7A06_RS00380"; Dbxref "Genbank:WP_000800845.1"; ID "cds-WP_000800845.1"; Name "WP_000800845.1"; Parent "gene-C7A06_RS00380"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000800843.1"; locus_tag "C7A06_RS00380"; product "alpha/beta hydrolase-fold protein"; protein_id "WP_000800845.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 66842 67276 . - . gene_id "nbis-gene-64"; ID "nbis-gene-64"; Name "C7A06_RS00390"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00390";
+NZ_CP027599.1 RefSeq transcript 66842 67276 . - . gene_id "nbis-gene-64"; transcript_id "gene-C7A06_RS00390"; ID "gene-C7A06_RS00390"; Name "C7A06_RS00390"; Parent "nbis-gene-64"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00390"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 66842 67276 . - . gene_id "nbis-gene-64"; transcript_id "gene-C7A06_RS00390"; Dbxref "Genbank:WP_000281561.1"; ID "nbis-exon-69"; Name "WP_000281561.1"; Parent "gene-C7A06_RS00390"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001554632.1"; locus_tag "C7A06_RS00390"; product "hypothetical protein"; protein_id "WP_000281561.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 66842 67276 . - 0 gene_id "nbis-gene-64"; transcript_id "gene-C7A06_RS00390"; Dbxref "Genbank:WP_000281561.1"; ID "cds-WP_000281561.1"; Name "WP_000281561.1"; Parent "gene-C7A06_RS00390"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001554632.1"; locus_tag "C7A06_RS00390"; product "hypothetical protein"; protein_id "WP_000281561.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 68088 68297 . + . gene_id "nbis-gene-65"; ID "nbis-gene-65"; Name "mchI"; gbkey "Gene"; gene "mchI"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00395";
+NZ_CP027599.1 RefSeq transcript 68088 68297 . + . gene_id "nbis-gene-65"; transcript_id "gene-C7A06_RS00395"; ID "gene-C7A06_RS00395"; Name "mchI"; Parent "nbis-gene-65"; gbkey "Gene"; gene "mchI"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00395"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 68088 68297 . + . gene_id "nbis-gene-65"; transcript_id "gene-C7A06_RS00395"; Dbxref "Genbank:WP_000120664.1"; ID "nbis-exon-70"; Name "WP_000120664.1"; Parent "gene-C7A06_RS00395"; gbkey "CDS"; gene "mchI"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000120664.1"; locus_tag "C7A06_RS00395"; product "microcin H47 immunity protein MchI"; protein_id "WP_000120664.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 68088 68297 . + 0 gene_id "nbis-gene-65"; transcript_id "gene-C7A06_RS00395"; Dbxref "Genbank:WP_000120664.1"; ID "cds-WP_000120664.1"; Name "WP_000120664.1"; Parent "gene-C7A06_RS00395"; gbkey "CDS"; gene "mchI"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000120664.1"; locus_tag "C7A06_RS00395"; product "microcin H47 immunity protein MchI"; protein_id "WP_000120664.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 68314 68541 . + . gene_id "nbis-gene-66"; ID "nbis-gene-66"; Name "mchB"; gbkey "Gene"; gene "mchB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00400";
+NZ_CP027599.1 RefSeq transcript 68314 68541 . + . gene_id "nbis-gene-66"; transcript_id "gene-C7A06_RS00400"; ID "gene-C7A06_RS00400"; Name "mchB"; Parent "nbis-gene-66"; gbkey "Gene"; gene "mchB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00400"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 68314 68541 . + . gene_id "nbis-gene-66"; transcript_id "gene-C7A06_RS00400"; Dbxref "Genbank:WP_001375214.1"; ID "nbis-exon-71"; Name "WP_001375214.1"; Parent "gene-C7A06_RS00400"; gbkey "CDS"; gene "mchB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001375214.1"; locus_tag "C7A06_RS00400"; product "microcin H47"; protein_id "WP_001375214.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 68314 68541 . + 0 gene_id "nbis-gene-66"; transcript_id "gene-C7A06_RS00400"; Dbxref "Genbank:WP_001375214.1"; ID "cds-WP_001375214.1"; Name "WP_001375214.1"; Parent "gene-C7A06_RS00400"; gbkey "CDS"; gene "mchB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001375214.1"; locus_tag "C7A06_RS00400"; product "microcin H47"; protein_id "WP_001375214.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 68812 70362 . + . gene_id "nbis-gene-67"; ID "nbis-gene-67"; Name "C7A06_RS00405"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00405";
+NZ_CP027599.1 RefSeq transcript 68812 70362 . + . gene_id "nbis-gene-67"; transcript_id "gene-C7A06_RS00405"; ID "gene-C7A06_RS00405"; Name "C7A06_RS00405"; Parent "nbis-gene-67"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00405"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 68812 70362 . + . gene_id "nbis-gene-67"; transcript_id "gene-C7A06_RS00405"; Dbxref "Genbank:WP_000019329.1"; ID "nbis-exon-72"; Name "WP_000019329.1"; Parent "gene-C7A06_RS00405"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000019324.1"; locus_tag "C7A06_RS00405"; product "hypothetical protein"; protein_id "WP_000019329.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 68812 70362 . + 0 gene_id "nbis-gene-67"; transcript_id "gene-C7A06_RS00405"; Dbxref "Genbank:WP_000019329.1"; ID "cds-WP_000019329.1"; Name "WP_000019329.1"; Parent "gene-C7A06_RS00405"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000019324.1"; locus_tag "C7A06_RS00405"; product "hypothetical protein"; protein_id "WP_000019329.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 70466 70840 . + . gene_id "nbis-gene-68"; ID "nbis-gene-68"; Name "C7A06_RS00410"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00410";
+NZ_CP027599.1 RefSeq transcript 70466 70840 . + . gene_id "nbis-gene-68"; transcript_id "gene-C7A06_RS00410"; ID "gene-C7A06_RS00410"; Name "C7A06_RS00410"; Parent "nbis-gene-68"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00410"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 70466 70840 . + . gene_id "nbis-gene-68"; transcript_id "gene-C7A06_RS00410"; Dbxref "Genbank:WP_001391575.1"; ID "nbis-exon-73"; Name "WP_001391575.1"; Ontology_term "GO:0009404" "GO:0016746" "GO:0005737"; Parent "gene-C7A06_RS00410"; gbkey "CDS"; go_component "cytoplasm|0005737||IEA"; go_function "acyltransferase activity|0016746||IEA"; go_process "toxin metabolic process|0009404||IEA"; inference "COORDINATES: protein motif:HMM:NF014813.2"; locus_tag "C7A06_RS00410"; product "toxin-activating lysine-acyltransferase"; protein_id "WP_001391575.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 70466 70840 . + 0 gene_id "nbis-gene-68"; transcript_id "gene-C7A06_RS00410"; Dbxref "Genbank:WP_001391575.1"; ID "cds-WP_001391575.1"; Name "WP_001391575.1"; Ontology_term "GO:0009404" "GO:0016746" "GO:0005737"; Parent "gene-C7A06_RS00410"; gbkey "CDS"; go_component "cytoplasm|0005737||IEA"; go_function "acyltransferase activity|0016746||IEA"; go_process "toxin metabolic process|0009404||IEA"; inference "COORDINATES: protein motif:HMM:NF014813.2"; locus_tag "C7A06_RS00410"; product "toxin-activating lysine-acyltransferase"; protein_id "WP_001391575.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 70993 72267 . + . gene_id "nbis-gene-69"; ID "nbis-gene-69"; Name "C7A06_RS00415"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00415";
+NZ_CP027599.1 RefSeq transcript 70993 72267 . + . gene_id "nbis-gene-69"; transcript_id "gene-C7A06_RS00415"; ID "gene-C7A06_RS00415"; Name "C7A06_RS00415"; Parent "nbis-gene-69"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00415"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 70993 72267 . + . gene_id "nbis-gene-69"; transcript_id "gene-C7A06_RS00415"; Dbxref "Genbank:WP_000489612.1"; ID "nbis-exon-74"; Name "WP_000489612.1"; Parent "gene-C7A06_RS00415"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000489618.1"; locus_tag "C7A06_RS00415"; product "HlyD family secretion protein"; protein_id "WP_000489612.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 70993 72267 . + 0 gene_id "nbis-gene-69"; transcript_id "gene-C7A06_RS00415"; Dbxref "Genbank:WP_000489612.1"; ID "cds-WP_000489612.1"; Name "WP_000489612.1"; Parent "gene-C7A06_RS00415"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000489618.1"; locus_tag "C7A06_RS00415"; product "HlyD family secretion protein"; protein_id "WP_000489612.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 72260 74356 . + . gene_id "nbis-gene-70"; ID "nbis-gene-70"; Name "mchF"; gbkey "Gene"; gene "mchF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00420";
+NZ_CP027599.1 RefSeq transcript 72260 74356 . + . gene_id "nbis-gene-70"; transcript_id "gene-C7A06_RS00420"; ID "gene-C7A06_RS00420"; Name "mchF"; Parent "nbis-gene-70"; gbkey "Gene"; gene "mchF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00420"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 72260 74356 . + . gene_id "nbis-gene-70"; transcript_id "gene-C7A06_RS00420"; Dbxref "Genbank:WP_000181294.1"; ID "nbis-exon-75"; Name "WP_000181294.1"; Parent "gene-C7A06_RS00420"; gbkey "CDS"; gene "mchF"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001529577.1"; locus_tag "C7A06_RS00420"; product "microcin export transporter peptidase/ATP-binding subunit MchF"; protein_id "WP_000181294.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 72260 74356 . + 0 gene_id "nbis-gene-70"; transcript_id "gene-C7A06_RS00420"; Dbxref "Genbank:WP_000181294.1"; ID "cds-WP_000181294.1"; Name "WP_000181294.1"; Parent "gene-C7A06_RS00420"; gbkey "CDS"; gene "mchF"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001529577.1"; locus_tag "C7A06_RS00420"; product "microcin export transporter peptidase/ATP-binding subunit MchF"; protein_id "WP_000181294.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 74610 74888 . + . gene_id "nbis-gene-71"; ID "nbis-gene-71"; Name "mcmA"; gbkey "Gene"; gene "mcmA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00430";
+NZ_CP027599.1 RefSeq transcript 74610 74888 . + . gene_id "nbis-gene-71"; transcript_id "gene-C7A06_RS00430"; ID "gene-C7A06_RS00430"; Name "mcmA"; Parent "nbis-gene-71"; gbkey "Gene"; gene "mcmA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00430"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 74610 74888 . + . gene_id "nbis-gene-71"; transcript_id "gene-C7A06_RS00430"; Dbxref "Genbank:WP_071531329.1"; ID "nbis-exon-76"; Name "WP_071531329.1"; Parent "gene-C7A06_RS00430"; gbkey "CDS"; gene "mcmA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001466656.1"; locus_tag "C7A06_RS00430"; product "microcin McmA"; protein_id "WP_071531329.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 74610 74888 . + 0 gene_id "nbis-gene-71"; transcript_id "gene-C7A06_RS00430"; Dbxref "Genbank:WP_071531329.1"; ID "cds-WP_071531329.1"; Name "WP_071531329.1"; Parent "gene-C7A06_RS00430"; gbkey "CDS"; gene "mcmA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001466656.1"; locus_tag "C7A06_RS00430"; product "microcin McmA"; protein_id "WP_071531329.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 75027 75203 . - . gene_id "nbis-gene-5829"; ID "nbis-gene-5829"; Name "C7A06_RS34795"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34795";
+NZ_CP027599.1 RefSeq transcript 75027 75203 . - . gene_id "nbis-gene-5829"; transcript_id "gene-C7A06_RS34795"; ID "gene-C7A06_RS34795"; Name "C7A06_RS34795"; Parent "nbis-gene-5829"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34795"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 75027 75203 . - . gene_id "nbis-gene-5829"; transcript_id "gene-C7A06_RS34795"; Dbxref "Genbank:WP_231360822.1"; ID "nbis-exon-6139"; Name "WP_231360822.1"; Parent "gene-C7A06_RS34795"; gbkey "CDS"; inference "COORDINATES: protein motif:HMM:NF014566.2"; locus_tag "C7A06_RS34795"; product "hypothetical protein"; protein_id "WP_231360822.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 75027 75203 . - 0 gene_id "nbis-gene-5829"; transcript_id "gene-C7A06_RS34795"; Dbxref "Genbank:WP_231360822.1"; ID "cds-WP_231360822.1"; Name "WP_231360822.1"; Parent "gene-C7A06_RS34795"; gbkey "CDS"; inference "COORDINATES: protein motif:HMM:NF014566.2"; locus_tag "C7A06_RS34795"; product "hypothetical protein"; protein_id "WP_231360822.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 75790 76101 . - . gene_id "nbis-pseudogene-310"; ID "nbis-pseudogene-310"; Name "C7A06_RS34800"; end_range "76101" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34800"; original_biotype "pseudogene"; partial "true"; pseudo "true";
+NZ_CP027599.1 RefSeq transcript 75790 76101 . - . gene_id "nbis-pseudogene-310"; transcript_id "gene-C7A06_RS34800"; ID "gene-C7A06_RS34800"; Name "C7A06_RS34800"; Parent "nbis-pseudogene-310"; end_range "76101" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34800"; original_biotype "mrna"; partial "true"; pseudo "true";
+NZ_CP027599.1 Protein Homology exon 75790 76101 . - . gene_id "nbis-pseudogene-310"; transcript_id "gene-C7A06_RS34800"; ID "nbis-exon-6140"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS34800"; end_range "76101" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_309401.1"; locus_tag "C7A06_RS34800"; partial "true"; product "hypothetical protein"; pseudo "true"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 75790 76101 . - 0 gene_id "nbis-pseudogene-310"; transcript_id "gene-C7A06_RS34800"; ID "cds-C7A06_RS34800"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS34800"; end_range "76101" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_309401.1"; locus_tag "C7A06_RS34800"; partial "true"; product "hypothetical protein"; pseudo "true"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 76178 76726 . + . gene_id "nbis-gene-72"; ID "nbis-gene-72"; Name "C7A06_RS00450"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00450";
+NZ_CP027599.1 RefSeq transcript 76178 76726 . + . gene_id "nbis-gene-72"; transcript_id "gene-C7A06_RS00450"; ID "gene-C7A06_RS00450"; Name "C7A06_RS00450"; Parent "nbis-gene-72"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00450"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 76178 76726 . + . gene_id "nbis-gene-72"; transcript_id "gene-C7A06_RS00450"; Dbxref "Genbank:WP_001167431.1"; ID "nbis-exon-77"; Name "WP_001167431.1"; Parent "gene-C7A06_RS00450"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001167424.1"; locus_tag "C7A06_RS00450"; product "hypothetical protein"; protein_id "WP_001167431.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 76178 76726 . + 0 gene_id "nbis-gene-72"; transcript_id "gene-C7A06_RS00450"; Dbxref "Genbank:WP_001167431.1"; ID "cds-WP_001167431.1"; Name "WP_001167431.1"; Parent "gene-C7A06_RS00450"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001167424.1"; locus_tag "C7A06_RS00450"; product "hypothetical protein"; protein_id "WP_001167431.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 76745 77089 . - . gene_id "nbis-gene-73"; ID "nbis-gene-73"; Name "C7A06_RS00455"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00455";
+NZ_CP027599.1 RefSeq transcript 76745 77089 . - . gene_id "nbis-gene-73"; transcript_id "gene-C7A06_RS00455"; ID "gene-C7A06_RS00455"; Name "C7A06_RS00455"; Parent "nbis-gene-73"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00455"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 76745 77089 . - . gene_id "nbis-gene-73"; transcript_id "gene-C7A06_RS00455"; Dbxref "Genbank:WP_000166948.1"; ID "nbis-exon-78"; Name "WP_000166948.1"; Parent "gene-C7A06_RS00455"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000166950.1"; locus_tag "C7A06_RS00455"; product "ProQ/FinO family protein"; protein_id "WP_000166948.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 76745 77089 . - 0 gene_id "nbis-gene-73"; transcript_id "gene-C7A06_RS00455"; Dbxref "Genbank:WP_000166948.1"; ID "cds-WP_000166948.1"; Name "WP_000166948.1"; Parent "gene-C7A06_RS00455"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000166950.1"; locus_tag "C7A06_RS00455"; product "ProQ/FinO family protein"; protein_id "WP_000166948.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 77086 77259 . - . gene_id "nbis-gene-74"; ID "nbis-gene-74"; Name "C7A06_RS00460"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00460";
+NZ_CP027599.1 RefSeq transcript 77086 77259 . - . gene_id "nbis-gene-74"; transcript_id "gene-C7A06_RS00460"; ID "gene-C7A06_RS00460"; Name "C7A06_RS00460"; Parent "nbis-gene-74"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00460"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 77086 77259 . - . gene_id "nbis-gene-74"; transcript_id "gene-C7A06_RS00460"; Dbxref "Genbank:WP_000258194.1"; ID "nbis-exon-79"; Name "WP_000258194.1"; Parent "gene-C7A06_RS00460"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000258194.1"; locus_tag "C7A06_RS00460"; product "hypothetical protein"; protein_id "WP_000258194.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 77086 77259 . - 0 gene_id "nbis-gene-74"; transcript_id "gene-C7A06_RS00460"; Dbxref "Genbank:WP_000258194.1"; ID "cds-WP_000258194.1"; Name "WP_000258194.1"; Parent "gene-C7A06_RS00460"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000258194.1"; locus_tag "C7A06_RS00460"; product "hypothetical protein"; protein_id "WP_000258194.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 77395 77568 . + . gene_id "nbis-gene-75"; ID "nbis-gene-75"; Name "C7A06_RS00465"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00465";
+NZ_CP027599.1 RefSeq transcript 77395 77568 . + . gene_id "nbis-gene-75"; transcript_id "gene-C7A06_RS00465"; ID "gene-C7A06_RS00465"; Name "C7A06_RS00465"; Parent "nbis-gene-75"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00465"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 77395 77568 . + . gene_id "nbis-gene-75"; transcript_id "gene-C7A06_RS00465"; Dbxref "Genbank:WP_153274857.1"; ID "nbis-exon-80"; Name "WP_153274857.1"; Parent "gene-C7A06_RS00465"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000130014.1"; locus_tag "C7A06_RS00465"; product "hypothetical protein"; protein_id "WP_153274857.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 77395 77568 . + 0 gene_id "nbis-gene-75"; transcript_id "gene-C7A06_RS00465"; Dbxref "Genbank:WP_153274857.1"; ID "cds-WP_153274857.1"; Name "WP_153274857.1"; Parent "gene-C7A06_RS00465"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000130014.1"; locus_tag "C7A06_RS00465"; product "hypothetical protein"; protein_id "WP_153274857.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 77982 78416 . + . gene_id "nbis-gene-76"; ID "nbis-gene-76"; Name "C7A06_RS00475"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00475";
+NZ_CP027599.1 RefSeq transcript 77982 78416 . + . gene_id "nbis-gene-76"; transcript_id "gene-C7A06_RS00475"; ID "gene-C7A06_RS00475"; Name "C7A06_RS00475"; Parent "nbis-gene-76"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00475"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 77982 78416 . + . gene_id "nbis-gene-76"; transcript_id "gene-C7A06_RS00475"; Dbxref "Genbank:WP_000038249.1"; ID "nbis-exon-81"; Name "WP_000038249.1"; Ontology_term "GO:0006355" "GO:0003677"; Parent "gene-C7A06_RS00475"; gbkey "CDS"; go_function "DNA binding|0003677||IEA"; go_process "regulation of transcription, DNA-templated|0006355||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000038245.1"; locus_tag "C7A06_RS00475"; product "H-NS histone family protein"; protein_id "WP_000038249.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 77982 78416 . + 0 gene_id "nbis-gene-76"; transcript_id "gene-C7A06_RS00475"; Dbxref "Genbank:WP_000038249.1"; ID "cds-WP_000038249.1"; Name "WP_000038249.1"; Ontology_term "GO:0006355" "GO:0003677"; Parent "gene-C7A06_RS00475"; gbkey "CDS"; go_function "DNA binding|0003677||IEA"; go_process "regulation of transcription, DNA-templated|0006355||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000038245.1"; locus_tag "C7A06_RS00475"; product "H-NS histone family protein"; protein_id "WP_000038249.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 78833 79402 . - . gene_id "nbis-gene-77"; ID "nbis-gene-77"; Name "C7A06_RS00480"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00480";
+NZ_CP027599.1 RefSeq transcript 78833 79402 . - . gene_id "nbis-gene-77"; transcript_id "gene-C7A06_RS00480"; ID "gene-C7A06_RS00480"; Name "C7A06_RS00480"; Parent "nbis-gene-77"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00480"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 78833 79402 . - . gene_id "nbis-gene-77"; transcript_id "gene-C7A06_RS00480"; Dbxref "Genbank:WP_000517678.1"; ID "nbis-exon-82"; Name "WP_000517678.1"; Parent "gene-C7A06_RS00480"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000517641.1"; locus_tag "C7A06_RS00480"; product "hypothetical protein"; protein_id "WP_000517678.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 78833 79402 . - 0 gene_id "nbis-gene-77"; transcript_id "gene-C7A06_RS00480"; Dbxref "Genbank:WP_000517678.1"; ID "cds-WP_000517678.1"; Name "WP_000517678.1"; Parent "gene-C7A06_RS00480"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000517641.1"; locus_tag "C7A06_RS00480"; product "hypothetical protein"; protein_id "WP_000517678.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 79502 80734 . - . gene_id "nbis-gene-78"; ID "nbis-gene-78"; Name "dgt"; gbkey "Gene"; gene "dgt"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00485";
+NZ_CP027599.1 RefSeq transcript 79502 80734 . - . gene_id "nbis-gene-78"; transcript_id "gene-C7A06_RS00485"; ID "gene-C7A06_RS00485"; Name "dgt"; Parent "nbis-gene-78"; gbkey "Gene"; gene "dgt"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00485"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 79502 80734 . - . gene_id "nbis-gene-78"; transcript_id "gene-C7A06_RS00485"; Dbxref "Genbank:WP_000271619.1"; ID "nbis-exon-83"; Name "WP_000271619.1"; Ontology_term "GO:0015949" "GO:0008832"; Parent "gene-C7A06_RS00485"; gbkey "CDS"; gene "dgt"; go_function "dGTPase activity|0008832||IEA"; go_process "nucleobase-containing small molecule interconversion|0015949||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001566974.1"; locus_tag "C7A06_RS00485"; product "dNTP triphosphohydrolase"; protein_id "WP_000271619.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 79502 80734 . - 0 gene_id "nbis-gene-78"; transcript_id "gene-C7A06_RS00485"; Dbxref "Genbank:WP_000271619.1"; ID "cds-WP_000271619.1"; Name "WP_000271619.1"; Ontology_term "GO:0015949" "GO:0008832"; Parent "gene-C7A06_RS00485"; gbkey "CDS"; gene "dgt"; go_function "dGTPase activity|0008832||IEA"; go_process "nucleobase-containing small molecule interconversion|0015949||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001566974.1"; locus_tag "C7A06_RS00485"; product "dNTP triphosphohydrolase"; protein_id "WP_000271619.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 80885 82047 . - . gene_id "nbis-gene-79"; ID "nbis-gene-79"; Name "C7A06_RS00490"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00490";
+NZ_CP027599.1 RefSeq transcript 80885 82047 . - . gene_id "nbis-gene-79"; transcript_id "gene-C7A06_RS00490"; ID "gene-C7A06_RS00490"; Name "C7A06_RS00490"; Parent "nbis-gene-79"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00490"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 80885 82047 . - . gene_id "nbis-gene-79"; transcript_id "gene-C7A06_RS00490"; Dbxref "Genbank:WP_106904140.1"; ID "nbis-exon-84"; Name "WP_106904140.1"; Note "programmed frameshift"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS00490"; exception "ribosomal slippage"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012477168.1"; locus_tag "C7A06_RS00490"; product "IS3 family transposase"; protein_id "WP_106904140.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 80885 82047 . - 2 gene_id "nbis-gene-79"; transcript_id "gene-C7A06_RS00490"; Dbxref "Genbank:WP_106904140.1"; ID "cds-WP_106904140.1"; Name "WP_106904140.1"; Note "programmed frameshift"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS00490"; exception "ribosomal slippage"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012477168.1"; locus_tag "C7A06_RS00490"; product "IS3 family transposase"; protein_id "WP_106904140.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 82610 83124 . - . gene_id "nbis-pseudogene-6"; ID "nbis-pseudogene-6"; Name "C7A06_RS00500"; end_range "83124" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00500"; original_biotype "pseudogene"; partial "true"; pseudo "true";
+NZ_CP027599.1 RefSeq transcript 82610 83124 . - . gene_id "nbis-pseudogene-6"; transcript_id "gene-C7A06_RS00500"; ID "gene-C7A06_RS00500"; Name "C7A06_RS00500"; Parent "nbis-pseudogene-6"; end_range "83124" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00500"; original_biotype "mrna"; partial "true"; pseudo "true";
+NZ_CP027599.1 Protein Homology exon 82610 83124 . - . gene_id "nbis-pseudogene-6"; transcript_id "gene-C7A06_RS00500"; ID "nbis-exon-85"; Note "frameshifted; incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS00500"; end_range "83124" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001368704.1"; locus_tag "C7A06_RS00500"; partial "true"; product "transposase"; pseudo "true"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 82610 83124 . - 0 gene_id "nbis-pseudogene-6"; transcript_id "gene-C7A06_RS00500"; ID "cds-C7A06_RS00500"; Note "frameshifted; incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS00500"; end_range "83124" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001368704.1"; locus_tag "C7A06_RS00500"; partial "true"; product "transposase"; pseudo "true"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 83732 87145 . + . gene_id "nbis-gene-80"; ID "nbis-gene-80"; Name "C7A06_RS00510"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00510";
+NZ_CP027599.1 RefSeq transcript 83732 87145 . + . gene_id "nbis-gene-80"; transcript_id "gene-C7A06_RS00510"; ID "gene-C7A06_RS00510"; Name "C7A06_RS00510"; Parent "nbis-gene-80"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00510"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 83732 87145 . + . gene_id "nbis-gene-80"; transcript_id "gene-C7A06_RS00510"; Dbxref "Genbank:WP_000438167.1"; ID "nbis-exon-86"; Name "WP_000438167.1"; Ontology_term "GO:0003677" "GO:0005524" "GO:0016787"; Parent "gene-C7A06_RS00510"; gbkey "CDS"; go_function "DNA binding|0003677||IEA" "ATP binding|0005524||IEA" "hydrolase activity|0016787||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000438152.1"; locus_tag "C7A06_RS00510"; product "DEAD/DEAH box helicase family protein"; protein_id "WP_000438167.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 83732 87145 . + 0 gene_id "nbis-gene-80"; transcript_id "gene-C7A06_RS00510"; Dbxref "Genbank:WP_000438167.1"; ID "cds-WP_000438167.1"; Name "WP_000438167.1"; Ontology_term "GO:0003677" "GO:0005524" "GO:0016787"; Parent "gene-C7A06_RS00510"; gbkey "CDS"; go_function "DNA binding|0003677||IEA" "ATP binding|0005524||IEA" "hydrolase activity|0016787||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000438152.1"; locus_tag "C7A06_RS00510"; product "DEAD/DEAH box helicase family protein"; protein_id "WP_000438167.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 87209 88843 . + . gene_id "nbis-gene-81"; ID "nbis-gene-81"; Name "C7A06_RS00515"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00515";
+NZ_CP027599.1 RefSeq transcript 87209 88843 . + . gene_id "nbis-gene-81"; transcript_id "gene-C7A06_RS00515"; ID "gene-C7A06_RS00515"; Name "C7A06_RS00515"; Parent "nbis-gene-81"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00515"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 87209 88843 . + . gene_id "nbis-gene-81"; transcript_id "gene-C7A06_RS00515"; Dbxref "Genbank:WP_000627719.1"; ID "nbis-exon-87"; Name "WP_000627719.1"; Parent "gene-C7A06_RS00515"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000627727.1"; locus_tag "C7A06_RS00515"; product "type I restriction-modification system subunit M"; protein_id "WP_000627719.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 87209 88843 . + 0 gene_id "nbis-gene-81"; transcript_id "gene-C7A06_RS00515"; Dbxref "Genbank:WP_000627719.1"; ID "cds-WP_000627719.1"; Name "WP_000627719.1"; Parent "gene-C7A06_RS00515"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000627727.1"; locus_tag "C7A06_RS00515"; product "type I restriction-modification system subunit M"; protein_id "WP_000627719.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 88840 89982 . + . gene_id "nbis-gene-82"; ID "nbis-gene-82"; Name "C7A06_RS00520"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00520";
+NZ_CP027599.1 RefSeq transcript 88840 89982 . + . gene_id "nbis-gene-82"; transcript_id "gene-C7A06_RS00520"; ID "gene-C7A06_RS00520"; Name "C7A06_RS00520"; Parent "nbis-gene-82"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00520"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 88840 89982 . + . gene_id "nbis-gene-82"; transcript_id "gene-C7A06_RS00520"; Dbxref "Genbank:WP_001680721.1"; ID "nbis-exon-88"; Name "WP_001680721.1"; Ontology_term "GO:0006304" "GO:0003677"; Parent "gene-C7A06_RS00520"; gbkey "CDS"; go_function "DNA binding|0003677||IEA"; go_process "DNA modification|0006304||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001680721.1"; locus_tag "C7A06_RS00520"; product "restriction endonuclease subunit S"; protein_id "WP_001680721.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 88840 89982 . + 0 gene_id "nbis-gene-82"; transcript_id "gene-C7A06_RS00520"; Dbxref "Genbank:WP_001680721.1"; ID "cds-WP_001680721.1"; Name "WP_001680721.1"; Ontology_term "GO:0006304" "GO:0003677"; Parent "gene-C7A06_RS00520"; gbkey "CDS"; go_function "DNA binding|0003677||IEA"; go_process "DNA modification|0006304||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001680721.1"; locus_tag "C7A06_RS00520"; product "restriction endonuclease subunit S"; protein_id "WP_001680721.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 89991 91613 . + . gene_id "nbis-gene-83"; ID "nbis-gene-83"; Name "C7A06_RS00525"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00525";
+NZ_CP027599.1 RefSeq transcript 89991 91613 . + . gene_id "nbis-gene-83"; transcript_id "gene-C7A06_RS00525"; ID "gene-C7A06_RS00525"; Name "C7A06_RS00525"; Parent "nbis-gene-83"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00525"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 89991 91613 . + . gene_id "nbis-gene-83"; transcript_id "gene-C7A06_RS00525"; Dbxref "Genbank:WP_000778953.1"; ID "nbis-exon-89"; Name "WP_000778953.1"; Parent "gene-C7A06_RS00525"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000778955.1"; locus_tag "C7A06_RS00525"; product "AAA family ATPase"; protein_id "WP_000778953.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 89991 91613 . + 0 gene_id "nbis-gene-83"; transcript_id "gene-C7A06_RS00525"; Dbxref "Genbank:WP_000778953.1"; ID "cds-WP_000778953.1"; Name "WP_000778953.1"; Parent "gene-C7A06_RS00525"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000778955.1"; locus_tag "C7A06_RS00525"; product "AAA family ATPase"; protein_id "WP_000778953.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 91613 92509 . + . gene_id "nbis-gene-84"; ID "nbis-gene-84"; Name "C7A06_RS00530"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00530";
+NZ_CP027599.1 RefSeq transcript 91613 92509 . + . gene_id "nbis-gene-84"; transcript_id "gene-C7A06_RS00530"; ID "gene-C7A06_RS00530"; Name "C7A06_RS00530"; Parent "nbis-gene-84"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00530"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 91613 92509 . + . gene_id "nbis-gene-84"; transcript_id "gene-C7A06_RS00530"; Dbxref "Genbank:WP_001680722.1"; ID "nbis-exon-90"; Name "WP_001680722.1"; Parent "gene-C7A06_RS00530"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001680722.1"; locus_tag "C7A06_RS00530"; product "hypothetical protein"; protein_id "WP_001680722.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 91613 92509 . + 0 gene_id "nbis-gene-84"; transcript_id "gene-C7A06_RS00530"; Dbxref "Genbank:WP_001680722.1"; ID "cds-WP_001680722.1"; Name "WP_001680722.1"; Parent "gene-C7A06_RS00530"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001680722.1"; locus_tag "C7A06_RS00530"; product "hypothetical protein"; protein_id "WP_001680722.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 92732 92910 . - . gene_id "nbis-pseudogene-7"; ID "nbis-pseudogene-7"; Name "C7A06_RS00535"; end_range "92910" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00535"; original_biotype "pseudogene"; partial "true"; pseudo "true";
+NZ_CP027599.1 RefSeq transcript 92732 92910 . - . gene_id "nbis-pseudogene-7"; transcript_id "gene-C7A06_RS00535"; ID "gene-C7A06_RS00535"; Name "C7A06_RS00535"; Parent "nbis-pseudogene-7"; end_range "92910" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00535"; original_biotype "mrna"; partial "true"; pseudo "true";
+NZ_CP027599.1 Protein Homology exon 92732 92910 . - . gene_id "nbis-pseudogene-7"; transcript_id "gene-C7A06_RS00535"; ID "nbis-exon-91"; Note "frameshifted; incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS00535"; end_range "92910" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012421665.1"; locus_tag "C7A06_RS00535"; partial "true"; product "integrase"; pseudo "true"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 92732 92910 . - 0 gene_id "nbis-pseudogene-7"; transcript_id "gene-C7A06_RS00535"; ID "cds-C7A06_RS00535"; Note "frameshifted; incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS00535"; end_range "92910" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012421665.1"; locus_tag "C7A06_RS00535"; partial "true"; product "integrase"; pseudo "true"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 93193 93561 . + . gene_id "nbis-gene-85"; ID "nbis-gene-85"; Name "C7A06_RS00540"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00540";
+NZ_CP027599.1 RefSeq transcript 93193 93561 . + . gene_id "nbis-gene-85"; transcript_id "gene-C7A06_RS00540"; ID "gene-C7A06_RS00540"; Name "C7A06_RS00540"; Parent "nbis-gene-85"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00540"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 93193 93561 . + . gene_id "nbis-gene-85"; transcript_id "gene-C7A06_RS00540"; Dbxref "Genbank:WP_001275820.1"; ID "nbis-exon-92"; Name "WP_001275820.1"; Parent "gene-C7A06_RS00540"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001275822.1"; locus_tag "C7A06_RS00540"; product "hypothetical protein"; protein_id "WP_001275820.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 93193 93561 . + 0 gene_id "nbis-gene-85"; transcript_id "gene-C7A06_RS00540"; Dbxref "Genbank:WP_001275820.1"; ID "cds-WP_001275820.1"; Name "WP_001275820.1"; Parent "gene-C7A06_RS00540"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001275822.1"; locus_tag "C7A06_RS00540"; product "hypothetical protein"; protein_id "WP_001275820.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 93779 94525 . + . gene_id "nbis-gene-86"; ID "nbis-gene-86"; Name "C7A06_RS00545"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00545";
+NZ_CP027599.1 RefSeq transcript 93779 94525 . + . gene_id "nbis-gene-86"; transcript_id "gene-C7A06_RS00545"; ID "gene-C7A06_RS00545"; Name "C7A06_RS00545"; Parent "nbis-gene-86"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00545"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 93779 94525 . + . gene_id "nbis-gene-86"; transcript_id "gene-C7A06_RS00545"; Dbxref "Genbank:WP_000755107.1"; ID "nbis-exon-93"; Name "WP_000755107.1"; Parent "gene-C7A06_RS00545"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001536427.1"; locus_tag "C7A06_RS00545"; product "porin family protein"; protein_id "WP_000755107.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 93779 94525 . + 0 gene_id "nbis-gene-86"; transcript_id "gene-C7A06_RS00545"; Dbxref "Genbank:WP_000755107.1"; ID "cds-WP_000755107.1"; Name "WP_000755107.1"; Parent "gene-C7A06_RS00545"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001536427.1"; locus_tag "C7A06_RS00545"; product "porin family protein"; protein_id "WP_000755107.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 94710 96211 . + . gene_id "nbis-pseudogene-8"; ID "nbis-pseudogene-8"; Name "C7A06_RS00550"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00550"; original_biotype "pseudogene"; pseudo "true";
+NZ_CP027599.1 RefSeq transcript 94710 96211 . + . gene_id "nbis-pseudogene-8"; transcript_id "gene-C7A06_RS00550"; ID "gene-C7A06_RS00550"; Name "C7A06_RS00550"; Parent "nbis-pseudogene-8"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00550"; original_biotype "mrna"; pseudo "true";
+NZ_CP027599.1 Protein Homology exon 94710 96211 . + . gene_id "nbis-pseudogene-8"; transcript_id "gene-C7A06_RS00550"; ID "nbis-exon-94"; Note "frameshifted"; Parent "gene-C7A06_RS00550"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001608786.1"; locus_tag "C7A06_RS00550"; product "phosphoethanolamine transferase"; pseudo "true"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 94710 96211 . + 0 gene_id "nbis-pseudogene-8"; transcript_id "gene-C7A06_RS00550"; ID "cds-C7A06_RS00550"; Note "frameshifted"; Parent "gene-C7A06_RS00550"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001608786.1"; locus_tag "C7A06_RS00550"; product "phosphoethanolamine transferase"; pseudo "true"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 96571 97614 . - . gene_id "nbis-gene-87"; ID "nbis-gene-87"; Name "C7A06_RS00560"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00560";
+NZ_CP027599.1 RefSeq transcript 96571 97614 . - . gene_id "nbis-gene-87"; transcript_id "gene-C7A06_RS00560"; ID "gene-C7A06_RS00560"; Name "C7A06_RS00560"; Parent "nbis-gene-87"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00560"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 96571 97614 . - . gene_id "nbis-gene-87"; transcript_id "gene-C7A06_RS00560"; Dbxref "Genbank:WP_000999846.1"; ID "nbis-exon-95"; Name "WP_000999846.1"; Parent "gene-C7A06_RS00560"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709438.1"; locus_tag "C7A06_RS00560"; product "hypothetical protein"; protein_id "WP_000999846.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 96571 97614 . - 0 gene_id "nbis-gene-87"; transcript_id "gene-C7A06_RS00560"; Dbxref "Genbank:WP_000999846.1"; ID "cds-WP_000999846.1"; Name "WP_000999846.1"; Parent "gene-C7A06_RS00560"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709438.1"; locus_tag "C7A06_RS00560"; product "hypothetical protein"; protein_id "WP_000999846.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 98026 99210 . - . gene_id "nbis-gene-88"; ID "nbis-gene-88"; Name "C7A06_RS00565"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00565";
+NZ_CP027599.1 RefSeq transcript 98026 99210 . - . gene_id "nbis-gene-88"; transcript_id "gene-C7A06_RS00565"; ID "gene-C7A06_RS00565"; Name "C7A06_RS00565"; Parent "nbis-gene-88"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00565"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 98026 99210 . - . gene_id "nbis-gene-88"; transcript_id "gene-C7A06_RS00565"; Dbxref "Genbank:WP_001218900.1"; ID "nbis-exon-96"; Name "WP_001218900.1"; Ontology_term "GO:0006310" "GO:0015074" "GO:0003677"; Parent "gene-C7A06_RS00565"; gbkey "CDS"; go_function "DNA binding|0003677||IEA"; go_process "DNA recombination|0006310||IEA" "DNA integration|0015074||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001218899.1"; locus_tag "C7A06_RS00565"; product "tyrosine-type recombinase/integrase"; protein_id "WP_001218900.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 98026 99210 . - 0 gene_id "nbis-gene-88"; transcript_id "gene-C7A06_RS00565"; Dbxref "Genbank:WP_001218900.1"; ID "cds-WP_001218900.1"; Name "WP_001218900.1"; Ontology_term "GO:0006310" "GO:0015074" "GO:0003677"; Parent "gene-C7A06_RS00565"; gbkey "CDS"; go_function "DNA binding|0003677||IEA"; go_process "DNA recombination|0006310||IEA" "DNA integration|0015074||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001218899.1"; locus_tag "C7A06_RS00565"; product "tyrosine-type recombinase/integrase"; protein_id "WP_001218900.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 99510 99604 . - . gene_id "gene-C7A06_RS00570"; ID "gene-C7A06_RS00570"; Name "C7A06_RS00570"; gbkey "Gene"; gene_biotype "tRNA"; locus_tag "C7A06_RS00570";
+NZ_CP027599.1 tRNAscan-SE transcript 99510 99604 . - . gene_id "gene-C7A06_RS00570"; transcript_id "rna-C7A06_RS00570"; ID "rna-C7A06_RS00570"; Parent "gene-C7A06_RS00570"; anticodon "(pos:complement(99568..99570))"; gbkey "tRNA"; inference "COORDINATES: profile:tRNAscan-SE:2.0.7"; locus_tag "C7A06_RS00570"; original_biotype "trna"; product "tRNA-Sec";
+NZ_CP027599.1 tRNAscan-SE exon 99510 99604 . - . gene_id "gene-C7A06_RS00570"; transcript_id "rna-C7A06_RS00570"; ID "exon-C7A06_RS00570-1"; Parent "rna-C7A06_RS00570"; anticodon "(pos:complement(99568..99570))"; gbkey "tRNA"; inference "COORDINATES: profile:tRNAscan-SE:2.0.7"; locus_tag "C7A06_RS00570"; product "tRNA-Sec";
+NZ_CP027599.1 RefSeq gene 99897 101279 . + . gene_id "nbis-gene-89"; ID "nbis-gene-89"; Name "yicJ"; gbkey "Gene"; gene "yicJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00575";
+NZ_CP027599.1 RefSeq transcript 99897 101279 . + . gene_id "nbis-gene-89"; transcript_id "gene-C7A06_RS00575"; ID "gene-C7A06_RS00575"; Name "yicJ"; Parent "nbis-gene-89"; gbkey "Gene"; gene "yicJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00575"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 99897 101279 . + . gene_id "nbis-gene-89"; transcript_id "gene-C7A06_RS00575"; Dbxref "Genbank:WP_000834439.1"; ID "nbis-exon-97"; Name "WP_000834439.1"; Ontology_term "GO:0006814" "GO:0008643" "GO:0015293" "GO:0016021"; Parent "gene-C7A06_RS00575"; gbkey "CDS"; gene "yicJ"; go_component "integral component of membrane|0016021||IEA"; go_function "symporter activity|0015293||IEA"; go_process "sodium ion transport|0006814||IEA" "carbohydrate transport|0008643||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418114.4"; locus_tag "C7A06_RS00575"; product "glycoside-pentoside-hexuronide family transporter"; protein_id "WP_000834439.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 99897 101279 . + 0 gene_id "nbis-gene-89"; transcript_id "gene-C7A06_RS00575"; Dbxref "Genbank:WP_000834439.1"; ID "cds-WP_000834439.1"; Name "WP_000834439.1"; Ontology_term "GO:0006814" "GO:0008643" "GO:0015293" "GO:0016021"; Parent "gene-C7A06_RS00575"; gbkey "CDS"; gene "yicJ"; go_component "integral component of membrane|0016021||IEA"; go_function "symporter activity|0015293||IEA"; go_process "sodium ion transport|0006814||IEA" "carbohydrate transport|0008643||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418114.4"; locus_tag "C7A06_RS00575"; product "glycoside-pentoside-hexuronide family transporter"; protein_id "WP_000834439.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 101289 103607 . + . gene_id "nbis-gene-90"; ID "nbis-gene-90"; Name "yicI"; gbkey "Gene"; gene "yicI"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00580";
+NZ_CP027599.1 RefSeq transcript 101289 103607 . + . gene_id "nbis-gene-90"; transcript_id "gene-C7A06_RS00580"; ID "gene-C7A06_RS00580"; Name "yicI"; Parent "nbis-gene-90"; gbkey "Gene"; gene "yicI"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00580"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 101289 103607 . + . gene_id "nbis-gene-90"; transcript_id "gene-C7A06_RS00580"; Dbxref "Genbank:WP_000702953.1"; ID "nbis-exon-98"; Name "WP_000702953.1"; Ontology_term "GO:0005975" "GO:0004553"; Parent "gene-C7A06_RS00580"; gbkey "CDS"; gene "yicI"; go_function "hydrolase activity, hydrolyzing O-glycosyl compounds|0004553||IEA"; go_process "carbohydrate metabolic process|0005975||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418113.1"; locus_tag "C7A06_RS00580"; product "alpha-xylosidase"; protein_id "WP_000702953.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 101289 103607 . + 0 gene_id "nbis-gene-90"; transcript_id "gene-C7A06_RS00580"; Dbxref "Genbank:WP_000702953.1"; ID "cds-WP_000702953.1"; Name "WP_000702953.1"; Ontology_term "GO:0005975" "GO:0004553"; Parent "gene-C7A06_RS00580"; gbkey "CDS"; gene "yicI"; go_function "hydrolase activity, hydrolyzing O-glycosyl compounds|0004553||IEA"; go_process "carbohydrate metabolic process|0005975||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418113.1"; locus_tag "C7A06_RS00580"; product "alpha-xylosidase"; protein_id "WP_000702953.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 103660 105369 . - . gene_id "nbis-gene-91"; ID "nbis-gene-91"; Name "yicH"; gbkey "Gene"; gene "yicH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00585";
+NZ_CP027599.1 RefSeq transcript 103660 105369 . - . gene_id "nbis-gene-91"; transcript_id "gene-C7A06_RS00585"; ID "gene-C7A06_RS00585"; Name "yicH"; Parent "nbis-gene-91"; gbkey "Gene"; gene "yicH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00585"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 103660 105369 . - . gene_id "nbis-gene-91"; transcript_id "gene-C7A06_RS00585"; Dbxref "Genbank:WP_001341763.1"; ID "nbis-exon-99"; Name "WP_001341763.1"; Parent "gene-C7A06_RS00585"; gbkey "CDS"; gene "yicH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418112.1"; locus_tag "C7A06_RS00585"; product "AsmA family protein"; protein_id "WP_001341763.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 103660 105369 . - 0 gene_id "nbis-gene-91"; transcript_id "gene-C7A06_RS00585"; Dbxref "Genbank:WP_001341763.1"; ID "cds-WP_001341763.1"; Name "WP_001341763.1"; Parent "gene-C7A06_RS00585"; gbkey "CDS"; gene "yicH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418112.1"; locus_tag "C7A06_RS00585"; product "AsmA family protein"; protein_id "WP_001341763.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 105490 106881 . - . gene_id "nbis-gene-92"; ID "nbis-gene-92"; Name "xanP"; gbkey "Gene"; gene "xanP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00590";
+NZ_CP027599.1 RefSeq transcript 105490 106881 . - . gene_id "nbis-gene-92"; transcript_id "gene-C7A06_RS00590"; ID "gene-C7A06_RS00590"; Name "xanP"; Parent "nbis-gene-92"; gbkey "Gene"; gene "xanP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00590"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 105490 106881 . - . gene_id "nbis-gene-92"; transcript_id "gene-C7A06_RS00590"; Dbxref "Genbank:WP_001295238.1"; ID "nbis-exon-100"; Name "WP_001295238.1"; Parent "gene-C7A06_RS00590"; gbkey "CDS"; gene "xanP"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312557.1"; locus_tag "C7A06_RS00590"; product "xanthine/proton symporter XanP"; protein_id "WP_001295238.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 105490 106881 . - 0 gene_id "nbis-gene-92"; transcript_id "gene-C7A06_RS00590"; Dbxref "Genbank:WP_001295238.1"; ID "cds-WP_001295238.1"; Name "WP_001295238.1"; Parent "gene-C7A06_RS00590"; gbkey "CDS"; gene "xanP"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312557.1"; locus_tag "C7A06_RS00590"; product "xanthine/proton symporter XanP"; protein_id "WP_001295238.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 107161 108366 . + . gene_id "nbis-gene-93"; ID "nbis-gene-93"; Name "gltS"; gbkey "Gene"; gene "gltS"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00595";
+NZ_CP027599.1 RefSeq transcript 107161 108366 . + . gene_id "nbis-gene-93"; transcript_id "gene-C7A06_RS00595"; ID "gene-C7A06_RS00595"; Name "gltS"; Parent "nbis-gene-93"; gbkey "Gene"; gene "gltS"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00595"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 107161 108366 . + . gene_id "nbis-gene-93"; transcript_id "gene-C7A06_RS00595"; Dbxref "Genbank:WP_000468836.1"; ID "nbis-exon-101"; Name "WP_000468836.1"; Ontology_term "GO:0015813" "GO:0015501"; Parent "gene-C7A06_RS00595"; gbkey "CDS"; gene "gltS"; go_function "glutamate:sodium symporter activity|0015501||IEA"; go_process "L-glutamate transmembrane transport|0015813||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312556.1"; locus_tag "C7A06_RS00595"; product "sodium/glutamate symporter"; protein_id "WP_000468836.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 107161 108366 . + 0 gene_id "nbis-gene-93"; transcript_id "gene-C7A06_RS00595"; Dbxref "Genbank:WP_000468836.1"; ID "cds-WP_000468836.1"; Name "WP_000468836.1"; Ontology_term "GO:0015813" "GO:0015501"; Parent "gene-C7A06_RS00595"; gbkey "CDS"; gene "gltS"; go_function "glutamate:sodium symporter activity|0015501||IEA"; go_process "L-glutamate transmembrane transport|0015813||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312556.1"; locus_tag "C7A06_RS00595"; product "sodium/glutamate symporter"; protein_id "WP_000468836.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 108369 109235 . + . gene_id "nbis-gene-94"; ID "nbis-gene-94"; Name "C7A06_RS00600"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00600";
+NZ_CP027599.1 RefSeq transcript 108369 109235 . + . gene_id "nbis-gene-94"; transcript_id "gene-C7A06_RS00600"; ID "gene-C7A06_RS00600"; Name "C7A06_RS00600"; Parent "nbis-gene-94"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00600"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 108369 109235 . + . gene_id "nbis-gene-94"; transcript_id "gene-C7A06_RS00600"; Dbxref "Genbank:WP_000747329.1"; ID "nbis-exon-102"; Name "WP_000747329.1"; Parent "gene-C7A06_RS00600"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312555.2"; locus_tag "C7A06_RS00600"; product "hypothetical protein"; protein_id "WP_000747329.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 108369 109235 . + 0 gene_id "nbis-gene-94"; transcript_id "gene-C7A06_RS00600"; Dbxref "Genbank:WP_000747329.1"; ID "cds-WP_000747329.1"; Name "WP_000747329.1"; Parent "gene-C7A06_RS00600"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312555.2"; locus_tag "C7A06_RS00600"; product "hypothetical protein"; protein_id "WP_000747329.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 109220 111301 . - . gene_id "nbis-gene-95"; ID "nbis-gene-95"; Name "recG"; gbkey "Gene"; gene "recG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00605";
+NZ_CP027599.1 RefSeq transcript 109220 111301 . - . gene_id "nbis-gene-95"; transcript_id "gene-C7A06_RS00605"; ID "gene-C7A06_RS00605"; Name "recG"; Parent "nbis-gene-95"; gbkey "Gene"; gene "recG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00605"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 109220 111301 . - . gene_id "nbis-gene-95"; transcript_id "gene-C7A06_RS00605"; Dbxref "Genbank:WP_000678419.1"; ID "nbis-exon-103"; Name "WP_000678419.1"; Ontology_term "GO:0006281" "GO:0006310" "GO:0003676" "GO:0003678" "GO:0005524"; Parent "gene-C7A06_RS00605"; gbkey "CDS"; gene "recG"; go_function "nucleic acid binding|0003676||IEA" "DNA helicase activity|0003678||IEA" "ATP binding|0005524||IEA"; go_process "DNA repair|0006281||IEA" "DNA recombination|0006310||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418109.1"; locus_tag "C7A06_RS00605"; product "ATP-dependent DNA helicase RecG"; protein_id "WP_000678419.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 109220 111301 . - 0 gene_id "nbis-gene-95"; transcript_id "gene-C7A06_RS00605"; Dbxref "Genbank:WP_000678419.1"; ID "cds-WP_000678419.1"; Name "WP_000678419.1"; Ontology_term "GO:0006281" "GO:0006310" "GO:0003676" "GO:0003678" "GO:0005524"; Parent "gene-C7A06_RS00605"; gbkey "CDS"; gene "recG"; go_function "nucleic acid binding|0003676||IEA" "DNA helicase activity|0003678||IEA" "ATP binding|0005524||IEA"; go_process "DNA repair|0006281||IEA" "DNA recombination|0006310||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418109.1"; locus_tag "C7A06_RS00605"; product "ATP-dependent DNA helicase RecG"; protein_id "WP_000678419.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 111307 111996 . - . gene_id "nbis-gene-96"; ID "nbis-gene-96"; Name "trmH"; gbkey "Gene"; gene "trmH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00610";
+NZ_CP027599.1 RefSeq transcript 111307 111996 . - . gene_id "nbis-gene-96"; transcript_id "gene-C7A06_RS00610"; ID "gene-C7A06_RS00610"; Name "trmH"; Parent "nbis-gene-96"; gbkey "Gene"; gene "trmH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00610"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 111307 111996 . - . gene_id "nbis-gene-96"; transcript_id "gene-C7A06_RS00610"; Dbxref "Genbank:WP_001070177.1"; ID "nbis-exon-104"; Name "WP_001070177.1"; Ontology_term "GO:0030488" "GO:0008173" "GO:0009020"; Parent "gene-C7A06_RS00610"; gbkey "CDS"; gene "trmH"; go_function "RNA methyltransferase activity|0008173||IEA" "tRNA (guanosine-2'-O-)-methyltransferase activity|0009020||IEA"; go_process "tRNA methylation|0030488||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418108.1"; locus_tag "C7A06_RS00610"; product "tRNA (guanosine(18)-2'-O)-methyltransferase TrmH"; protein_id "WP_001070177.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 111307 111996 . - 0 gene_id "nbis-gene-96"; transcript_id "gene-C7A06_RS00610"; Dbxref "Genbank:WP_001070177.1"; ID "cds-WP_001070177.1"; Name "WP_001070177.1"; Ontology_term "GO:0030488" "GO:0008173" "GO:0009020"; Parent "gene-C7A06_RS00610"; gbkey "CDS"; gene "trmH"; go_function "RNA methyltransferase activity|0008173||IEA" "tRNA (guanosine-2'-O-)-methyltransferase activity|0009020||IEA"; go_process "tRNA methylation|0030488||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418108.1"; locus_tag "C7A06_RS00610"; product "tRNA (guanosine(18)-2'-O)-methyltransferase TrmH"; protein_id "WP_001070177.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 112003 114111 . - . gene_id "nbis-gene-97"; ID "nbis-gene-97"; Name "spoT"; gbkey "Gene"; gene "spoT"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00615";
+NZ_CP027599.1 RefSeq transcript 112003 114111 . - . gene_id "nbis-gene-97"; transcript_id "gene-C7A06_RS00615"; ID "gene-C7A06_RS00615"; Name "spoT"; Parent "nbis-gene-97"; gbkey "Gene"; gene "spoT"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00615"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 112003 114111 . - . gene_id "nbis-gene-97"; transcript_id "gene-C7A06_RS00615"; Dbxref "Genbank:WP_000280488.1"; ID "nbis-exon-105"; Name "WP_000280488.1"; Ontology_term "GO:0015969" "GO:0008728" "GO:0008893"; Parent "gene-C7A06_RS00615"; gbkey "CDS"; gene "spoT"; go_function "GTP diphosphokinase activity|0008728||IEA" "guanosine-3',5'-bis(diphosphate) 3'-diphosphatase activity|0008893||IEA"; go_process "guanosine tetraphosphate metabolic process|0015969||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312552.1"; locus_tag "C7A06_RS00615"; product "bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase"; protein_id "WP_000280488.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 112003 114111 . - 0 gene_id "nbis-gene-97"; transcript_id "gene-C7A06_RS00615"; Dbxref "Genbank:WP_000280488.1"; ID "cds-WP_000280488.1"; Name "WP_000280488.1"; Ontology_term "GO:0015969" "GO:0008728" "GO:0008893"; Parent "gene-C7A06_RS00615"; gbkey "CDS"; gene "spoT"; go_function "GTP diphosphokinase activity|0008728||IEA" "guanosine-3',5'-bis(diphosphate) 3'-diphosphatase activity|0008893||IEA"; go_process "guanosine tetraphosphate metabolic process|0015969||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312552.1"; locus_tag "C7A06_RS00615"; product "bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase"; protein_id "WP_000280488.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 114130 114405 . - . gene_id "nbis-gene-98"; ID "nbis-gene-98"; Name "rpoZ"; gbkey "Gene"; gene "rpoZ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00620";
+NZ_CP027599.1 RefSeq transcript 114130 114405 . - . gene_id "nbis-gene-98"; transcript_id "gene-C7A06_RS00620"; ID "gene-C7A06_RS00620"; Name "rpoZ"; Parent "nbis-gene-98"; gbkey "Gene"; gene "rpoZ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00620"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 114130 114405 . - . gene_id "nbis-gene-98"; transcript_id "gene-C7A06_RS00620"; Dbxref "Genbank:WP_000135058.1"; ID "nbis-exon-106"; Name "WP_000135058.1"; Ontology_term "GO:0006351" "GO:0003899" "GO:0000345"; Parent "gene-C7A06_RS00620"; gbkey "CDS"; gene "rpoZ"; go_component "cytosolic DNA-directed RNA polymerase complex|0000345||IEA"; go_function "DNA-directed 5'-3' RNA polymerase activity|0003899||IEA"; go_process "transcription, DNA-templated|0006351||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_013511051.1"; locus_tag "C7A06_RS00620"; product "DNA-directed RNA polymerase subunit omega"; protein_id "WP_000135058.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 114130 114405 . - 0 gene_id "nbis-gene-98"; transcript_id "gene-C7A06_RS00620"; Dbxref "Genbank:WP_000135058.1"; ID "cds-WP_000135058.1"; Name "WP_000135058.1"; Ontology_term "GO:0006351" "GO:0003899" "GO:0000345"; Parent "gene-C7A06_RS00620"; gbkey "CDS"; gene "rpoZ"; go_component "cytosolic DNA-directed RNA polymerase complex|0000345||IEA"; go_function "DNA-directed 5'-3' RNA polymerase activity|0003899||IEA"; go_process "transcription, DNA-templated|0006351||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_013511051.1"; locus_tag "C7A06_RS00620"; product "DNA-directed RNA polymerase subunit omega"; protein_id "WP_000135058.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 114460 115083 . - . gene_id "nbis-gene-99"; ID "nbis-gene-99"; Name "gmk"; gbkey "Gene"; gene "gmk"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00625";
+NZ_CP027599.1 RefSeq transcript 114460 115083 . - . gene_id "nbis-gene-99"; transcript_id "gene-C7A06_RS00625"; ID "gene-C7A06_RS00625"; Name "gmk"; Parent "nbis-gene-99"; gbkey "Gene"; gene "gmk"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00625"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 114460 115083 . - . gene_id "nbis-gene-99"; transcript_id "gene-C7A06_RS00625"; Dbxref "Genbank:WP_001295237.1"; ID "nbis-exon-107"; Name "WP_001295237.1"; Ontology_term "GO:0015949" "GO:0004385"; Parent "gene-C7A06_RS00625"; gbkey "CDS"; gene "gmk"; go_function "guanylate kinase activity|0004385||IEA"; go_process "nucleobase-containing small molecule interconversion|0015949||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000046969.1"; locus_tag "C7A06_RS00625"; product "guanylate kinase"; protein_id "WP_001295237.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 114460 115083 . - 0 gene_id "nbis-gene-99"; transcript_id "gene-C7A06_RS00625"; Dbxref "Genbank:WP_001295237.1"; ID "cds-WP_001295237.1"; Name "WP_001295237.1"; Ontology_term "GO:0015949" "GO:0004385"; Parent "gene-C7A06_RS00625"; gbkey "CDS"; gene "gmk"; go_function "guanylate kinase activity|0004385||IEA"; go_process "nucleobase-containing small molecule interconversion|0015949||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000046969.1"; locus_tag "C7A06_RS00625"; product "guanylate kinase"; protein_id "WP_001295237.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 115341 117023 . + . gene_id "nbis-gene-100"; ID "nbis-gene-100"; Name "ligB"; gbkey "Gene"; gene "ligB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00630";
+NZ_CP027599.1 RefSeq transcript 115341 117023 . + . gene_id "nbis-gene-100"; transcript_id "gene-C7A06_RS00630"; ID "gene-C7A06_RS00630"; Name "ligB"; Parent "nbis-gene-100"; gbkey "Gene"; gene "ligB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00630"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 115341 117023 . + . gene_id "nbis-gene-100"; transcript_id "gene-C7A06_RS00630"; Dbxref "Genbank:WP_001426185.1"; ID "nbis-exon-108"; Name "WP_001426185.1"; Ontology_term "GO:0006260" "GO:0006281" "GO:0003911"; Parent "gene-C7A06_RS00630"; gbkey "CDS"; gene "ligB"; go_function "DNA ligase (NAD+) activity|0003911||IEA"; go_process "DNA replication|0006260||IEA" "DNA repair|0006281||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312549.2"; locus_tag "C7A06_RS00630"; product "NAD-dependent DNA ligase LigB"; protein_id "WP_001426185.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 115341 117023 . + 0 gene_id "nbis-gene-100"; transcript_id "gene-C7A06_RS00630"; Dbxref "Genbank:WP_001426185.1"; ID "cds-WP_001426185.1"; Name "WP_001426185.1"; Ontology_term "GO:0006260" "GO:0006281" "GO:0003911"; Parent "gene-C7A06_RS00630"; gbkey "CDS"; gene "ligB"; go_function "DNA ligase (NAD+) activity|0003911||IEA"; go_process "DNA replication|0006260||IEA" "DNA repair|0006281||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312549.2"; locus_tag "C7A06_RS00630"; product "NAD-dependent DNA ligase LigB"; protein_id "WP_001426185.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 117020 117637 . - . gene_id "nbis-gene-101"; ID "nbis-gene-101"; Name "yicG"; gbkey "Gene"; gene "yicG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00635";
+NZ_CP027599.1 RefSeq transcript 117020 117637 . - . gene_id "nbis-gene-101"; transcript_id "gene-C7A06_RS00635"; ID "gene-C7A06_RS00635"; Name "yicG"; Parent "nbis-gene-101"; gbkey "Gene"; gene "yicG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00635"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 117020 117637 . - . gene_id "nbis-gene-101"; transcript_id "gene-C7A06_RS00635"; Dbxref "Genbank:WP_000924289.1"; ID "nbis-exon-109"; Name "WP_000924289.1"; Parent "gene-C7A06_RS00635"; gbkey "CDS"; gene "yicG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312548.2"; locus_tag "C7A06_RS00635"; product "trimeric intracellular cation channel family protein"; protein_id "WP_000924289.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 117020 117637 . - 0 gene_id "nbis-gene-101"; transcript_id "gene-C7A06_RS00635"; Dbxref "Genbank:WP_000924289.1"; ID "cds-WP_000924289.1"; Name "WP_000924289.1"; Parent "gene-C7A06_RS00635"; gbkey "CDS"; gene "yicG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312548.2"; locus_tag "C7A06_RS00635"; product "trimeric intracellular cation channel family protein"; protein_id "WP_000924289.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 117929 118753 . - . gene_id "nbis-gene-102"; ID "nbis-gene-102"; Name "dinD"; gbkey "Gene"; gene "dinD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00640";
+NZ_CP027599.1 RefSeq transcript 117929 118753 . - . gene_id "nbis-gene-102"; transcript_id "gene-C7A06_RS00640"; ID "gene-C7A06_RS00640"; Name "dinD"; Parent "nbis-gene-102"; gbkey "Gene"; gene "dinD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00640"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 117929 118753 . - . gene_id "nbis-gene-102"; transcript_id "gene-C7A06_RS00640"; Dbxref "Genbank:WP_001297374.1"; ID "nbis-exon-110"; Name "WP_001297374.1"; Parent "gene-C7A06_RS00640"; gbkey "CDS"; gene "dinD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312547.2"; locus_tag "C7A06_RS00640"; product "DNA damage-inducible protein D"; protein_id "WP_001297374.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 117929 118753 . - 0 gene_id "nbis-gene-102"; transcript_id "gene-C7A06_RS00640"; Dbxref "Genbank:WP_001297374.1"; ID "cds-WP_001297374.1"; Name "WP_001297374.1"; Parent "gene-C7A06_RS00640"; gbkey "CDS"; gene "dinD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312547.2"; locus_tag "C7A06_RS00640"; product "DNA damage-inducible protein D"; protein_id "WP_001297374.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 118974 119837 . - . gene_id "nbis-gene-103"; ID "nbis-gene-103"; Name "yicC"; gbkey "Gene"; gene "yicC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00645";
+NZ_CP027599.1 RefSeq transcript 118974 119837 . - . gene_id "nbis-gene-103"; transcript_id "gene-C7A06_RS00645"; ID "gene-C7A06_RS00645"; Name "yicC"; Parent "nbis-gene-103"; gbkey "Gene"; gene "yicC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00645"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 118974 119837 . - . gene_id "nbis-gene-103"; transcript_id "gene-C7A06_RS00645"; Dbxref "Genbank:WP_000621336.1"; ID "nbis-exon-111"; Name "WP_000621336.1"; Parent "gene-C7A06_RS00645"; gbkey "CDS"; gene "yicC"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005122606.1"; locus_tag "C7A06_RS00645"; product "YicC family protein"; protein_id "WP_000621336.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 118974 119837 . - 0 gene_id "nbis-gene-103"; transcript_id "gene-C7A06_RS00645"; Dbxref "Genbank:WP_000621336.1"; ID "cds-WP_000621336.1"; Name "WP_000621336.1"; Parent "gene-C7A06_RS00645"; gbkey "CDS"; gene "yicC"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005122606.1"; locus_tag "C7A06_RS00645"; product "YicC family protein"; protein_id "WP_000621336.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 119964 120680 . + . gene_id "nbis-gene-104"; ID "nbis-gene-104"; Name "rph"; gbkey "Gene"; gene "rph"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00655";
+NZ_CP027599.1 RefSeq transcript 119964 120680 . + . gene_id "nbis-gene-104"; transcript_id "gene-C7A06_RS00655"; ID "gene-C7A06_RS00655"; Name "rph"; Parent "nbis-gene-104"; gbkey "Gene"; gene "rph"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00655"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 119964 120680 . + . gene_id "nbis-gene-104"; transcript_id "gene-C7A06_RS00655"; Dbxref "Genbank:WP_001247089.1"; ID "nbis-exon-112"; Name "WP_001247089.1"; Ontology_term "GO:0008033" "GO:0004549"; Parent "gene-C7A06_RS00655"; gbkey "CDS"; gene "rph"; go_function "tRNA-specific ribonuclease activity|0004549||IEA"; go_process "tRNA processing|0008033||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_006803115.1"; locus_tag "C7A06_RS00655"; product "ribonuclease PH"; protein_id "WP_001247089.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 119964 120680 . + 0 gene_id "nbis-gene-104"; transcript_id "gene-C7A06_RS00655"; Dbxref "Genbank:WP_001247089.1"; ID "cds-WP_001247089.1"; Name "WP_001247089.1"; Ontology_term "GO:0008033" "GO:0004549"; Parent "gene-C7A06_RS00655"; gbkey "CDS"; gene "rph"; go_function "tRNA-specific ribonuclease activity|0004549||IEA"; go_process "tRNA processing|0008033||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_006803115.1"; locus_tag "C7A06_RS00655"; product "ribonuclease PH"; protein_id "WP_001247089.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 120746 121387 . + . gene_id "nbis-gene-105"; ID "nbis-gene-105"; Name "pyrE"; gbkey "Gene"; gene "pyrE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00660";
+NZ_CP027599.1 RefSeq transcript 120746 121387 . + . gene_id "nbis-gene-105"; transcript_id "gene-C7A06_RS00660"; ID "gene-C7A06_RS00660"; Name "pyrE"; Parent "nbis-gene-105"; gbkey "Gene"; gene "pyrE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00660"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 120746 121387 . + . gene_id "nbis-gene-105"; transcript_id "gene-C7A06_RS00660"; Dbxref "Genbank:WP_000806161.1"; ID "nbis-exon-113"; Name "WP_000806161.1"; Ontology_term "GO:0009220" "GO:0004588"; Parent "gene-C7A06_RS00660"; gbkey "CDS"; gene "pyrE"; go_function "orotate phosphoribosyltransferase activity|0004588||IEA"; go_process "pyrimidine ribonucleotide biosynthetic process|0009220||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312544.1"; locus_tag "C7A06_RS00660"; product "orotate phosphoribosyltransferase"; protein_id "WP_000806161.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 120746 121387 . + 0 gene_id "nbis-gene-105"; transcript_id "gene-C7A06_RS00660"; Dbxref "Genbank:WP_000806161.1"; ID "cds-WP_000806161.1"; Name "WP_000806161.1"; Ontology_term "GO:0009220" "GO:0004588"; Parent "gene-C7A06_RS00660"; gbkey "CDS"; gene "pyrE"; go_function "orotate phosphoribosyltransferase activity|0004588||IEA"; go_process "pyrimidine ribonucleotide biosynthetic process|0009220||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312544.1"; locus_tag "C7A06_RS00660"; product "orotate phosphoribosyltransferase"; protein_id "WP_000806161.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 121424 122020 . - . gene_id "nbis-gene-106"; ID "nbis-gene-106"; Name "slmA"; gbkey "Gene"; gene "slmA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00665";
+NZ_CP027599.1 RefSeq transcript 121424 122020 . - . gene_id "nbis-gene-106"; transcript_id "gene-C7A06_RS00665"; ID "gene-C7A06_RS00665"; Name "slmA"; Parent "nbis-gene-106"; gbkey "Gene"; gene "slmA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00665"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 121424 122020 . - . gene_id "nbis-gene-106"; transcript_id "gene-C7A06_RS00665"; Dbxref "Genbank:WP_000818601.1"; ID "nbis-exon-114"; Name "WP_000818601.1"; Ontology_term "GO:0010974" "GO:0003677"; Parent "gene-C7A06_RS00665"; gbkey "CDS"; gene "slmA"; go_function "DNA binding|0003677||IEA"; go_process "negative regulation of division septum assembly|0010974||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000818604.1"; locus_tag "C7A06_RS00665"; product "nucleoid occlusion factor SlmA"; protein_id "WP_000818601.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 121424 122020 . - 0 gene_id "nbis-gene-106"; transcript_id "gene-C7A06_RS00665"; Dbxref "Genbank:WP_000818601.1"; ID "cds-WP_000818601.1"; Name "WP_000818601.1"; Ontology_term "GO:0010974" "GO:0003677"; Parent "gene-C7A06_RS00665"; gbkey "CDS"; gene "slmA"; go_function "DNA binding|0003677||IEA"; go_process "negative regulation of division septum assembly|0010974||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000818604.1"; locus_tag "C7A06_RS00665"; product "nucleoid occlusion factor SlmA"; protein_id "WP_000818601.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 122127 122585 . - . gene_id "nbis-gene-107"; ID "nbis-gene-107"; Name "dut"; gbkey "Gene"; gene "dut"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00670";
+NZ_CP027599.1 RefSeq transcript 122127 122585 . - . gene_id "nbis-gene-107"; transcript_id "gene-C7A06_RS00670"; ID "gene-C7A06_RS00670"; Name "dut"; Parent "nbis-gene-107"; gbkey "Gene"; gene "dut"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00670"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 122127 122585 . - . gene_id "nbis-gene-107"; transcript_id "gene-C7A06_RS00670"; Dbxref "Genbank:WP_000976070.1"; ID "nbis-exon-115"; Name "WP_000976070.1"; Ontology_term "GO:0006226" "GO:0046081" "GO:0000287" "GO:0004170"; Parent "gene-C7A06_RS00670"; gbkey "CDS"; gene "dut"; go_function "magnesium ion binding|0000287||IEA" "dUTP diphosphatase activity|0004170||IEA"; go_process "dUMP biosynthetic process|0006226||IEA" "dUTP catabolic process|0046081||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000976070.1"; locus_tag "C7A06_RS00670"; product "dUTP diphosphatase"; protein_id "WP_000976070.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 122127 122585 . - 0 gene_id "nbis-gene-107"; transcript_id "gene-C7A06_RS00670"; Dbxref "Genbank:WP_000976070.1"; ID "cds-WP_000976070.1"; Name "WP_000976070.1"; Ontology_term "GO:0006226" "GO:0046081" "GO:0000287" "GO:0004170"; Parent "gene-C7A06_RS00670"; gbkey "CDS"; gene "dut"; go_function "magnesium ion binding|0000287||IEA" "dUTP diphosphatase activity|0004170||IEA"; go_process "dUMP biosynthetic process|0006226||IEA" "dUTP catabolic process|0046081||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000976070.1"; locus_tag "C7A06_RS00670"; product "dUTP diphosphatase"; protein_id "WP_000976070.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 122563 123783 . - . gene_id "nbis-gene-108"; ID "nbis-gene-108"; Name "coaBC"; gbkey "Gene"; gene "coaBC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00675";
+NZ_CP027599.1 RefSeq transcript 122563 123783 . - . gene_id "nbis-gene-108"; transcript_id "gene-C7A06_RS00675"; ID "gene-C7A06_RS00675"; Name "coaBC"; Parent "nbis-gene-108"; gbkey "Gene"; gene "coaBC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00675"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 122563 123783 . - . gene_id "nbis-gene-108"; transcript_id "gene-C7A06_RS00675"; Dbxref "Genbank:WP_000050139.1"; ID "nbis-exon-116"; Name "WP_000050139.1"; Ontology_term "GO:0015937" "GO:0015939" "GO:0004632" "GO:0004633"; Parent "gene-C7A06_RS00675"; gbkey "CDS"; gene "coaBC"; go_function "phosphopantothenate--cysteine ligase activity|0004632||IEA" "phosphopantothenoylcysteine decarboxylase activity|0004633||IEA"; go_process "coenzyme A biosynthetic process|0015937||IEA" "pantothenate metabolic process|0015939||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418096.4"; locus_tag "C7A06_RS00675"; product "bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC"; protein_id "WP_000050139.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 122563 123783 . - 0 gene_id "nbis-gene-108"; transcript_id "gene-C7A06_RS00675"; Dbxref "Genbank:WP_000050139.1"; ID "cds-WP_000050139.1"; Name "WP_000050139.1"; Ontology_term "GO:0015937" "GO:0015939" "GO:0004632" "GO:0004633"; Parent "gene-C7A06_RS00675"; gbkey "CDS"; gene "coaBC"; go_function "phosphopantothenate--cysteine ligase activity|0004632||IEA" "phosphopantothenoylcysteine decarboxylase activity|0004633||IEA"; go_process "coenzyme A biosynthetic process|0015937||IEA" "pantothenate metabolic process|0015939||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418096.4"; locus_tag "C7A06_RS00675"; product "bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC"; protein_id "WP_000050139.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 123955 124623 . + . gene_id "nbis-gene-109"; ID "nbis-gene-109"; Name "radC"; gbkey "Gene"; gene "radC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00680";
+NZ_CP027599.1 RefSeq transcript 123955 124623 . + . gene_id "nbis-gene-109"; transcript_id "gene-C7A06_RS00680"; ID "gene-C7A06_RS00680"; Name "radC"; Parent "nbis-gene-109"; gbkey "Gene"; gene "radC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00680"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 123955 124623 . + . gene_id "nbis-gene-109"; transcript_id "gene-C7A06_RS00680"; Dbxref "Genbank:WP_001297375.1"; ID "nbis-exon-117"; Name "WP_001297375.1"; Ontology_term "GO:0006281" "GO:0003677"; Parent "gene-C7A06_RS00680"; gbkey "CDS"; gene "radC"; go_function "DNA binding|0003677||IEA"; go_process "DNA repair|0006281||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709417.4"; locus_tag "C7A06_RS00680"; product "DNA repair protein RadC"; protein_id "WP_001297375.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 123955 124623 . + 0 gene_id "nbis-gene-109"; transcript_id "gene-C7A06_RS00680"; Dbxref "Genbank:WP_001297375.1"; ID "cds-WP_001297375.1"; Name "WP_001297375.1"; Ontology_term "GO:0006281" "GO:0003677"; Parent "gene-C7A06_RS00680"; gbkey "CDS"; gene "radC"; go_function "DNA binding|0003677||IEA"; go_process "DNA repair|0006281||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709417.4"; locus_tag "C7A06_RS00680"; product "DNA repair protein RadC"; protein_id "WP_001297375.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 124840 125076 . + . gene_id "nbis-gene-110"; ID "nbis-gene-110"; Name "rpmB"; gbkey "Gene"; gene "rpmB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00685";
+NZ_CP027599.1 RefSeq transcript 124840 125076 . + . gene_id "nbis-gene-110"; transcript_id "gene-C7A06_RS00685"; ID "gene-C7A06_RS00685"; Name "rpmB"; Parent "nbis-gene-110"; gbkey "Gene"; gene "rpmB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00685"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 124840 125076 . + . gene_id "nbis-gene-110"; transcript_id "gene-C7A06_RS00685"; Dbxref "Genbank:WP_000091955.1"; ID "nbis-exon-118"; Name "WP_000091955.1"; Ontology_term "GO:0006412" "GO:0003735" "GO:0000311" "GO:0022625"; Parent "gene-C7A06_RS00685"; gbkey "CDS"; gene "rpmB"; go_component "plastid large ribosomal subunit|0000311||IEA" "cytosolic large ribosomal subunit|0022625||IEA"; go_function "structural constituent of ribosome|0003735||IEA"; go_process "translation|0006412||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_008457442.1"; locus_tag "C7A06_RS00685"; product "50S ribosomal protein L28"; protein_id "WP_000091955.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 124840 125076 . + 0 gene_id "nbis-gene-110"; transcript_id "gene-C7A06_RS00685"; Dbxref "Genbank:WP_000091955.1"; ID "cds-WP_000091955.1"; Name "WP_000091955.1"; Ontology_term "GO:0006412" "GO:0003735" "GO:0000311" "GO:0022625"; Parent "gene-C7A06_RS00685"; gbkey "CDS"; gene "rpmB"; go_component "plastid large ribosomal subunit|0000311||IEA" "cytosolic large ribosomal subunit|0022625||IEA"; go_function "structural constituent of ribosome|0003735||IEA"; go_process "translation|0006412||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_008457442.1"; locus_tag "C7A06_RS00685"; product "50S ribosomal protein L28"; protein_id "WP_000091955.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 125097 125264 . + . gene_id "nbis-gene-111"; ID "nbis-gene-111"; Name "rpmG"; gbkey "Gene"; gene "rpmG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00690";
+NZ_CP027599.1 RefSeq transcript 125097 125264 . + . gene_id "nbis-gene-111"; transcript_id "gene-C7A06_RS00690"; ID "gene-C7A06_RS00690"; Name "rpmG"; Parent "nbis-gene-111"; gbkey "Gene"; gene "rpmG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00690"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 125097 125264 . + . gene_id "nbis-gene-111"; transcript_id "gene-C7A06_RS00690"; Dbxref "Genbank:WP_001051798.1"; ID "nbis-exon-119"; Name "WP_001051798.1"; Ontology_term "GO:0006412" "GO:0003735" "GO:0000315" "GO:0022625"; Parent "gene-C7A06_RS00690"; gbkey "CDS"; gene "rpmG"; go_component "organellar large ribosomal subunit|0000315||IEA" "cytosolic large ribosomal subunit|0022625||IEA"; go_function "structural constituent of ribosome|0003735||IEA"; go_process "translation|0006412||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_010847629.1"; locus_tag "C7A06_RS00690"; product "50S ribosomal protein L33"; protein_id "WP_001051798.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 125097 125264 . + 0 gene_id "nbis-gene-111"; transcript_id "gene-C7A06_RS00690"; Dbxref "Genbank:WP_001051798.1"; ID "cds-WP_001051798.1"; Name "WP_001051798.1"; Ontology_term "GO:0006412" "GO:0003735" "GO:0000315" "GO:0022625"; Parent "gene-C7A06_RS00690"; gbkey "CDS"; gene "rpmG"; go_component "organellar large ribosomal subunit|0000315||IEA" "cytosolic large ribosomal subunit|0022625||IEA"; go_function "structural constituent of ribosome|0003735||IEA"; go_process "translation|0006412||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_010847629.1"; locus_tag "C7A06_RS00690"; product "50S ribosomal protein L33"; protein_id "WP_001051798.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 125362 126171 . + . gene_id "nbis-gene-112"; ID "nbis-gene-112"; Name "mutM"; gbkey "Gene"; gene "mutM"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00695";
+NZ_CP027599.1 RefSeq transcript 125362 126171 . + . gene_id "nbis-gene-112"; transcript_id "gene-C7A06_RS00695"; ID "gene-C7A06_RS00695"; Name "mutM"; Parent "nbis-gene-112"; gbkey "Gene"; gene "mutM"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00695"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 125362 126171 . + . gene_id "nbis-gene-112"; transcript_id "gene-C7A06_RS00695"; Dbxref "Genbank:WP_001114533.1"; ID "nbis-exon-120"; Name "WP_001114533.1"; Ontology_term "GO:0006281" "GO:0006284" "GO:0003676" "GO:0003684" "GO:0003906" "GO:0008534" "GO:0016799" "GO:0019104"; Parent "gene-C7A06_RS00695"; gbkey "CDS"; gene "mutM"; go_function "nucleic acid binding|0003676||IEA" "damaged DNA binding|0003684||IEA" "DNA-(apurinic or apyrimidinic site) endonuclease activity|0003906||IEA" "oxidized purine nucleobase lesion DNA N-glycosylase activity|0008534||IEA" "hydrolase activity, hydrolyzing N-glycosyl compounds|0016799||IEA" "DNA N-glycosylase activity|0019104||IEA"; go_process "DNA repair|0006281||IEA" "base-excision repair|0006284||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312537.1"; locus_tag "C7A06_RS00695"; product "bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase"; protein_id "WP_001114533.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 125362 126171 . + 0 gene_id "nbis-gene-112"; transcript_id "gene-C7A06_RS00695"; Dbxref "Genbank:WP_001114533.1"; ID "cds-WP_001114533.1"; Name "WP_001114533.1"; Ontology_term "GO:0006281" "GO:0006284" "GO:0003676" "GO:0003684" "GO:0003906" "GO:0008534" "GO:0016799" "GO:0019104"; Parent "gene-C7A06_RS00695"; gbkey "CDS"; gene "mutM"; go_function "nucleic acid binding|0003676||IEA" "damaged DNA binding|0003684||IEA" "DNA-(apurinic or apyrimidinic site) endonuclease activity|0003906||IEA" "oxidized purine nucleobase lesion DNA N-glycosylase activity|0008534||IEA" "hydrolase activity, hydrolyzing N-glycosyl compounds|0016799||IEA" "DNA N-glycosylase activity|0019104||IEA"; go_process "DNA repair|0006281||IEA" "base-excision repair|0006284||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312537.1"; locus_tag "C7A06_RS00695"; product "bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase"; protein_id "WP_001114533.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 126210 126689 . - . gene_id "nbis-gene-113"; ID "nbis-gene-113"; Name "coaD"; gbkey "Gene"; gene "coaD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00700";
+NZ_CP027599.1 RefSeq transcript 126210 126689 . - . gene_id "nbis-gene-113"; transcript_id "gene-C7A06_RS00700"; ID "gene-C7A06_RS00700"; Name "coaD"; Parent "nbis-gene-113"; gbkey "Gene"; gene "coaD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00700"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 126210 126689 . - . gene_id "nbis-gene-113"; transcript_id "gene-C7A06_RS00700"; Dbxref "Genbank:WP_001171866.1"; ID "nbis-exon-121"; Name "WP_001171866.1"; Ontology_term "GO:0015937" "GO:0004595"; Parent "gene-C7A06_RS00700"; gbkey "CDS"; gene "coaD"; go_function "pantetheine-phosphate adenylyltransferase activity|0004595||IEA"; go_process "coenzyme A biosynthetic process|0015937||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312536.1"; locus_tag "C7A06_RS00700"; product "pantetheine-phosphate adenylyltransferase"; protein_id "WP_001171866.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 126210 126689 . - 0 gene_id "nbis-gene-113"; transcript_id "gene-C7A06_RS00700"; Dbxref "Genbank:WP_001171866.1"; ID "cds-WP_001171866.1"; Name "WP_001171866.1"; Ontology_term "GO:0015937" "GO:0004595"; Parent "gene-C7A06_RS00700"; gbkey "CDS"; gene "coaD"; go_function "pantetheine-phosphate adenylyltransferase activity|0004595||IEA"; go_process "coenzyme A biosynthetic process|0015937||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312536.1"; locus_tag "C7A06_RS00700"; product "pantetheine-phosphate adenylyltransferase"; protein_id "WP_001171866.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 126697 127974 . - . gene_id "nbis-gene-114"; ID "nbis-gene-114"; Name "waaA"; gbkey "Gene"; gene "waaA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00705";
+NZ_CP027599.1 RefSeq transcript 126697 127974 . - . gene_id "nbis-gene-114"; transcript_id "gene-C7A06_RS00705"; ID "gene-C7A06_RS00705"; Name "waaA"; Parent "nbis-gene-114"; gbkey "Gene"; gene "waaA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00705"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 126697 127974 . - . gene_id "nbis-gene-114"; transcript_id "gene-C7A06_RS00705"; Dbxref "Genbank:WP_000891564.1"; ID "nbis-exon-122"; Name "WP_000891564.1"; Ontology_term "GO:0016740"; Parent "gene-C7A06_RS00705"; gbkey "CDS"; gene "waaA"; go_function "transferase activity|0016740||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312535.1"; locus_tag "C7A06_RS00705"; product "lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase"; protein_id "WP_000891564.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 126697 127974 . - 0 gene_id "nbis-gene-114"; transcript_id "gene-C7A06_RS00705"; Dbxref "Genbank:WP_000891564.1"; ID "cds-WP_000891564.1"; Name "WP_000891564.1"; Ontology_term "GO:0016740"; Parent "gene-C7A06_RS00705"; gbkey "CDS"; gene "waaA"; go_function "transferase activity|0016740||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312535.1"; locus_tag "C7A06_RS00705"; product "lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase"; protein_id "WP_000891564.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 128387 129445 . + . gene_id "nbis-gene-115"; ID "nbis-gene-115"; Name "rfaQ"; gbkey "Gene"; gene "rfaQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00710";
+NZ_CP027599.1 RefSeq transcript 128387 129445 . + . gene_id "nbis-gene-115"; transcript_id "gene-C7A06_RS00710"; ID "gene-C7A06_RS00710"; Name "rfaQ"; Parent "nbis-gene-115"; gbkey "Gene"; gene "rfaQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00710"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 128387 129445 . + . gene_id "nbis-gene-115"; transcript_id "gene-C7A06_RS00710"; Dbxref "Genbank:WP_000360406.1"; ID "nbis-exon-123"; Name "WP_000360406.1"; Ontology_term "GO:0016757"; Parent "gene-C7A06_RS00710"; gbkey "CDS"; gene "rfaQ"; go_function "glycosyltransferase activity|0016757||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709409.1"; locus_tag "C7A06_RS00710"; product "lipopolysaccharide core heptosyltransferase RfaQ"; protein_id "WP_000360406.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 128387 129445 . + 0 gene_id "nbis-gene-115"; transcript_id "gene-C7A06_RS00710"; Dbxref "Genbank:WP_000360406.1"; ID "cds-WP_000360406.1"; Name "WP_000360406.1"; Ontology_term "GO:0016757"; Parent "gene-C7A06_RS00710"; gbkey "CDS"; gene "rfaQ"; go_function "glycosyltransferase activity|0016757||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709409.1"; locus_tag "C7A06_RS00710"; product "lipopolysaccharide core heptosyltransferase RfaQ"; protein_id "WP_000360406.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 129442 130566 . + . gene_id "nbis-gene-116"; ID "nbis-gene-116"; Name "waaG"; gbkey "Gene"; gene "waaG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00715";
+NZ_CP027599.1 RefSeq transcript 129442 130566 . + . gene_id "nbis-gene-116"; transcript_id "gene-C7A06_RS00715"; ID "gene-C7A06_RS00715"; Name "waaG"; Parent "nbis-gene-116"; gbkey "Gene"; gene "waaG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00715"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 129442 130566 . + . gene_id "nbis-gene-116"; transcript_id "gene-C7A06_RS00715"; Dbxref "Genbank:WP_000634240.1"; ID "nbis-exon-124"; Name "WP_000634240.1"; Parent "gene-C7A06_RS00715"; gbkey "CDS"; gene "waaG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312533.1"; locus_tag "C7A06_RS00715"; product "glycosyltransferase family 4 protein"; protein_id "WP_000634240.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 129442 130566 . + 0 gene_id "nbis-gene-116"; transcript_id "gene-C7A06_RS00715"; Dbxref "Genbank:WP_000634240.1"; ID "cds-WP_000634240.1"; Name "WP_000634240.1"; Parent "gene-C7A06_RS00715"; gbkey "CDS"; gene "waaG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312533.1"; locus_tag "C7A06_RS00715"; product "glycosyltransferase family 4 protein"; protein_id "WP_000634240.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 130559 131356 . + . gene_id "nbis-gene-117"; ID "nbis-gene-117"; Name "rfaP"; gbkey "Gene"; gene "rfaP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00720";
+NZ_CP027599.1 RefSeq transcript 130559 131356 . + . gene_id "nbis-gene-117"; transcript_id "gene-C7A06_RS00720"; ID "gene-C7A06_RS00720"; Name "rfaP"; Parent "nbis-gene-117"; gbkey "Gene"; gene "rfaP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00720"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 130559 131356 . + . gene_id "nbis-gene-117"; transcript_id "gene-C7A06_RS00720"; Dbxref "Genbank:WP_001341761.1"; ID "nbis-exon-125"; Name "WP_001341761.1"; Ontology_term "GO:0009103" "GO:0016301"; Parent "gene-C7A06_RS00720"; gbkey "CDS"; gene "rfaP"; go_function "kinase activity|0016301||IEA"; go_process "lipopolysaccharide biosynthetic process|0009103||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312532.2"; locus_tag "C7A06_RS00720"; product "lipopolysaccharide core heptose(I) kinase RfaP"; protein_id "WP_001341761.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 130559 131356 . + 0 gene_id "nbis-gene-117"; transcript_id "gene-C7A06_RS00720"; Dbxref "Genbank:WP_001341761.1"; ID "cds-WP_001341761.1"; Name "WP_001341761.1"; Ontology_term "GO:0009103" "GO:0016301"; Parent "gene-C7A06_RS00720"; gbkey "CDS"; gene "rfaP"; go_function "kinase activity|0016301||IEA"; go_process "lipopolysaccharide biosynthetic process|0009103||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312532.2"; locus_tag "C7A06_RS00720"; product "lipopolysaccharide core heptose(I) kinase RfaP"; protein_id "WP_001341761.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 131399 132406 . + . gene_id "nbis-gene-118"; ID "nbis-gene-118"; Name "waaO"; gbkey "Gene"; gene "waaO"; gene_biotype "protein_coding"; gene_synonym "rfaI"; locus_tag "C7A06_RS00725";
+NZ_CP027599.1 RefSeq transcript 131399 132406 . + . gene_id "nbis-gene-118"; transcript_id "gene-C7A06_RS00725"; ID "gene-C7A06_RS00725"; Name "waaO"; Parent "nbis-gene-118"; gbkey "Gene"; gene "waaO"; gene_biotype "protein_coding"; gene_synonym "rfaI"; locus_tag "C7A06_RS00725"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 131399 132406 . + . gene_id "nbis-gene-118"; transcript_id "gene-C7A06_RS00725"; Dbxref "Genbank:WP_000080643.1"; ID "nbis-exon-126"; Name "WP_000080643.1"; Ontology_term "GO:0009103" "GO:0008918"; Parent "gene-C7A06_RS00725"; gbkey "CDS"; gene "waaO"; go_function "lipopolysaccharide 3-alpha-galactosyltransferase activity|0008918||IEA"; go_process "lipopolysaccharide biosynthetic process|0009103||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001521942.1"; locus_tag "C7A06_RS00725"; product "lipopolysaccharide 3-alpha-galactosyltransferase"; protein_id "WP_000080643.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 131399 132406 . + 0 gene_id "nbis-gene-118"; transcript_id "gene-C7A06_RS00725"; Dbxref "Genbank:WP_000080643.1"; ID "cds-WP_000080643.1"; Name "WP_000080643.1"; Ontology_term "GO:0009103" "GO:0008918"; Parent "gene-C7A06_RS00725"; gbkey "CDS"; gene "waaO"; go_function "lipopolysaccharide 3-alpha-galactosyltransferase activity|0008918||IEA"; go_process "lipopolysaccharide biosynthetic process|0009103||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001521942.1"; locus_tag "C7A06_RS00725"; product "lipopolysaccharide 3-alpha-galactosyltransferase"; protein_id "WP_000080643.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 132432 133139 . + . gene_id "nbis-gene-119"; ID "nbis-gene-119"; Name "rfaY"; gbkey "Gene"; gene "rfaY"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00730";
+NZ_CP027599.1 RefSeq transcript 132432 133139 . + . gene_id "nbis-gene-119"; transcript_id "gene-C7A06_RS00730"; ID "gene-C7A06_RS00730"; Name "rfaY"; Parent "nbis-gene-119"; gbkey "Gene"; gene "rfaY"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00730"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 132432 133139 . + . gene_id "nbis-gene-119"; transcript_id "gene-C7A06_RS00730"; Dbxref "Genbank:WP_000639946.1"; ID "nbis-exon-127"; Name "WP_000639946.1"; Parent "gene-C7A06_RS00730"; gbkey "CDS"; gene "rfaY"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709405.1"; locus_tag "C7A06_RS00730"; product "lipopolysaccharide core heptose(II) kinase RfaY"; protein_id "WP_000639946.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 132432 133139 . + 0 gene_id "nbis-gene-119"; transcript_id "gene-C7A06_RS00730"; Dbxref "Genbank:WP_000639946.1"; ID "cds-WP_000639946.1"; Name "WP_000639946.1"; Parent "gene-C7A06_RS00730"; gbkey "CDS"; gene "rfaY"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709405.1"; locus_tag "C7A06_RS00730"; product "lipopolysaccharide core heptose(II) kinase RfaY"; protein_id "WP_000639946.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 133164 134177 . + . gene_id "nbis-gene-120"; ID "nbis-gene-120"; Name "C7A06_RS00735"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00735";
+NZ_CP027599.1 RefSeq transcript 133164 134177 . + . gene_id "nbis-gene-120"; transcript_id "gene-C7A06_RS00735"; ID "gene-C7A06_RS00735"; Name "C7A06_RS00735"; Parent "nbis-gene-120"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00735"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 133164 134177 . + . gene_id "nbis-gene-120"; transcript_id "gene-C7A06_RS00735"; Dbxref "Genbank:WP_000346017.1"; ID "nbis-exon-128"; Name "WP_000346017.1"; Parent "gene-C7A06_RS00735"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312529.1"; locus_tag "C7A06_RS00735"; product "UDP-glucose--(galactosyl) LPS alpha1,2-glucosyltransferase"; protein_id "WP_000346017.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 133164 134177 . + 0 gene_id "nbis-gene-120"; transcript_id "gene-C7A06_RS00735"; Dbxref "Genbank:WP_000346017.1"; ID "cds-WP_000346017.1"; Name "WP_000346017.1"; Parent "gene-C7A06_RS00735"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312529.1"; locus_tag "C7A06_RS00735"; product "UDP-glucose--(galactosyl) LPS alpha1,2-glucosyltransferase"; protein_id "WP_000346017.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 134186 135328 . + . gene_id "nbis-gene-121"; ID "nbis-gene-121"; Name "C7A06_RS00740"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00740";
+NZ_CP027599.1 RefSeq transcript 134186 135328 . + . gene_id "nbis-gene-121"; transcript_id "gene-C7A06_RS00740"; ID "gene-C7A06_RS00740"; Name "C7A06_RS00740"; Parent "nbis-gene-121"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00740"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 134186 135328 . + . gene_id "nbis-gene-121"; transcript_id "gene-C7A06_RS00740"; Dbxref "Genbank:WP_000227812.1"; ID "nbis-exon-129"; Name "WP_000227812.1"; Parent "gene-C7A06_RS00740"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312528.1"; locus_tag "C7A06_RS00740"; product "lipopolysaccharide N-acetylglucosaminyltransferase"; protein_id "WP_000227812.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 134186 135328 . + 0 gene_id "nbis-gene-121"; transcript_id "gene-C7A06_RS00740"; Dbxref "Genbank:WP_000227812.1"; ID "cds-WP_000227812.1"; Name "WP_000227812.1"; Parent "gene-C7A06_RS00740"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312528.1"; locus_tag "C7A06_RS00740"; product "lipopolysaccharide N-acetylglucosaminyltransferase"; protein_id "WP_000227812.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 135364 136572 . - . gene_id "nbis-gene-122"; ID "nbis-gene-122"; Name "rfaL"; gbkey "Gene"; gene "rfaL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00745";
+NZ_CP027599.1 RefSeq transcript 135364 136572 . - . gene_id "nbis-gene-122"; transcript_id "gene-C7A06_RS00745"; ID "gene-C7A06_RS00745"; Name "rfaL"; Parent "nbis-gene-122"; gbkey "Gene"; gene "rfaL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00745"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 135364 136572 . - . gene_id "nbis-gene-122"; transcript_id "gene-C7A06_RS00745"; Dbxref "Genbank:WP_000204742.1"; ID "nbis-exon-130"; Name "WP_000204742.1"; Parent "gene-C7A06_RS00745"; gbkey "CDS"; gene "rfaL"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312527.1"; locus_tag "C7A06_RS00745"; product "O-antigen ligase RfaL"; protein_id "WP_000204742.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 135364 136572 . - 0 gene_id "nbis-gene-122"; transcript_id "gene-C7A06_RS00745"; Dbxref "Genbank:WP_000204742.1"; ID "cds-WP_000204742.1"; Name "WP_000204742.1"; Parent "gene-C7A06_RS00745"; gbkey "CDS"; gene "rfaL"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312527.1"; locus_tag "C7A06_RS00745"; product "O-antigen ligase RfaL"; protein_id "WP_000204742.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 136569 137561 . - . gene_id "nbis-gene-123"; ID "nbis-gene-123"; Name "rfaC"; gbkey "Gene"; gene "rfaC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00750";
+NZ_CP027599.1 RefSeq transcript 136569 137561 . - . gene_id "nbis-gene-123"; transcript_id "gene-C7A06_RS00750"; ID "gene-C7A06_RS00750"; Name "rfaC"; Parent "nbis-gene-123"; gbkey "Gene"; gene "rfaC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00750"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 136569 137561 . - . gene_id "nbis-gene-123"; transcript_id "gene-C7A06_RS00750"; Dbxref "Genbank:WP_001264565.1"; ID "nbis-exon-131"; Name "WP_001264565.1"; Ontology_term "GO:0009244" "GO:0008920"; Parent "gene-C7A06_RS00750"; gbkey "CDS"; gene "rfaC"; go_function "lipopolysaccharide heptosyltransferase activity|0008920||IEA"; go_process "lipopolysaccharide core region biosynthetic process|0009244||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312526.1"; locus_tag "C7A06_RS00750"; product "lipopolysaccharide heptosyltransferase RfaC"; protein_id "WP_001264565.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 136569 137561 . - 0 gene_id "nbis-gene-123"; transcript_id "gene-C7A06_RS00750"; Dbxref "Genbank:WP_001264565.1"; ID "cds-WP_001264565.1"; Name "WP_001264565.1"; Ontology_term "GO:0009244" "GO:0008920"; Parent "gene-C7A06_RS00750"; gbkey "CDS"; gene "rfaC"; go_function "lipopolysaccharide heptosyltransferase activity|0008920||IEA"; go_process "lipopolysaccharide core region biosynthetic process|0009244||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312526.1"; locus_tag "C7A06_RS00750"; product "lipopolysaccharide heptosyltransferase RfaC"; protein_id "WP_001264565.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 137565 138611 . - . gene_id "nbis-gene-124"; ID "nbis-gene-124"; Name "rfaF"; gbkey "Gene"; gene "rfaF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00755";
+NZ_CP027599.1 RefSeq transcript 137565 138611 . - . gene_id "nbis-gene-124"; transcript_id "gene-C7A06_RS00755"; ID "gene-C7A06_RS00755"; Name "rfaF"; Parent "nbis-gene-124"; gbkey "Gene"; gene "rfaF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00755"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 137565 138611 . - . gene_id "nbis-gene-124"; transcript_id "gene-C7A06_RS00755"; Dbxref "Genbank:WP_000699219.1"; ID "nbis-exon-132"; Name "WP_000699219.1"; Ontology_term "GO:0009103" "GO:0016757"; Parent "gene-C7A06_RS00755"; gbkey "CDS"; gene "rfaF"; go_function "glycosyltransferase activity|0016757||IEA"; go_process "lipopolysaccharide biosynthetic process|0009103||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418077.1"; locus_tag "C7A06_RS00755"; product "ADP-heptose--LPS heptosyltransferase RfaF"; protein_id "WP_000699219.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 137565 138611 . - 0 gene_id "nbis-gene-124"; transcript_id "gene-C7A06_RS00755"; Dbxref "Genbank:WP_000699219.1"; ID "cds-WP_000699219.1"; Name "WP_000699219.1"; Ontology_term "GO:0009103" "GO:0016757"; Parent "gene-C7A06_RS00755"; gbkey "CDS"; gene "rfaF"; go_function "glycosyltransferase activity|0016757||IEA"; go_process "lipopolysaccharide biosynthetic process|0009103||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418077.1"; locus_tag "C7A06_RS00755"; product "ADP-heptose--LPS heptosyltransferase RfaF"; protein_id "WP_000699219.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 138621 139553 . - . gene_id "nbis-gene-125"; ID "nbis-gene-125"; Name "rfaD"; gbkey "Gene"; gene "rfaD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00760";
+NZ_CP027599.1 RefSeq transcript 138621 139553 . - . gene_id "nbis-gene-125"; transcript_id "gene-C7A06_RS00760"; ID "gene-C7A06_RS00760"; Name "rfaD"; Parent "nbis-gene-125"; gbkey "Gene"; gene "rfaD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00760"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 138621 139553 . - . gene_id "nbis-gene-125"; transcript_id "gene-C7A06_RS00760"; Dbxref "Genbank:WP_000587764.1"; ID "nbis-exon-133"; Name "WP_000587764.1"; Ontology_term "GO:0005975" "GO:0008712"; Parent "gene-C7A06_RS00760"; gbkey "CDS"; gene "rfaD"; go_function "ADP-glyceromanno-heptose 6-epimerase activity|0008712||IEA"; go_process "carbohydrate metabolic process|0005975||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020233050.1"; locus_tag "C7A06_RS00760"; product "ADP-glyceromanno-heptose 6-epimerase"; protein_id "WP_000587764.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 138621 139553 . - 0 gene_id "nbis-gene-125"; transcript_id "gene-C7A06_RS00760"; Dbxref "Genbank:WP_000587764.1"; ID "cds-WP_000587764.1"; Name "WP_000587764.1"; Ontology_term "GO:0005975" "GO:0008712"; Parent "gene-C7A06_RS00760"; gbkey "CDS"; gene "rfaD"; go_function "ADP-glyceromanno-heptose 6-epimerase activity|0008712||IEA"; go_process "carbohydrate metabolic process|0005975||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020233050.1"; locus_tag "C7A06_RS00760"; product "ADP-glyceromanno-heptose 6-epimerase"; protein_id "WP_000587764.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 139857 140714 . + . gene_id "nbis-gene-126"; ID "nbis-gene-126"; Name "yibB"; gbkey "Gene"; gene "yibB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00765";
+NZ_CP027599.1 RefSeq transcript 139857 140714 . + . gene_id "nbis-gene-126"; transcript_id "gene-C7A06_RS00765"; ID "gene-C7A06_RS00765"; Name "yibB"; Parent "nbis-gene-126"; gbkey "Gene"; gene "yibB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00765"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 139857 140714 . + . gene_id "nbis-gene-126"; transcript_id "gene-C7A06_RS00765"; Dbxref "Genbank:WP_000842823.1"; ID "nbis-exon-134"; Name "WP_000842823.1"; Parent "gene-C7A06_RS00765"; gbkey "CDS"; gene "yibB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418075.2"; locus_tag "C7A06_RS00765"; product "protein YibB"; protein_id "WP_000842823.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 139857 140714 . + 0 gene_id "nbis-gene-126"; transcript_id "gene-C7A06_RS00765"; Dbxref "Genbank:WP_000842823.1"; ID "cds-WP_000842823.1"; Name "WP_000842823.1"; Parent "gene-C7A06_RS00765"; gbkey "CDS"; gene "yibB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418075.2"; locus_tag "C7A06_RS00765"; product "protein YibB"; protein_id "WP_000842823.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 140989 142185 . + . gene_id "nbis-gene-127"; ID "nbis-gene-127"; Name "kbl"; gbkey "Gene"; gene "kbl"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00770";
+NZ_CP027599.1 RefSeq transcript 140989 142185 . + . gene_id "nbis-gene-127"; transcript_id "gene-C7A06_RS00770"; ID "gene-C7A06_RS00770"; Name "kbl"; Parent "nbis-gene-127"; gbkey "Gene"; gene "kbl"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00770"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 140989 142185 . + . gene_id "nbis-gene-127"; transcript_id "gene-C7A06_RS00770"; Dbxref "Genbank:WP_001213834.1"; ID "nbis-exon-135"; Name "WP_001213834.1"; Ontology_term "GO:0006567" "GO:0008890"; Parent "gene-C7A06_RS00770"; gbkey "CDS"; gene "kbl"; go_function "glycine C-acetyltransferase activity|0008890||IEA"; go_process "threonine catabolic process|0006567||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020239151.1"; locus_tag "C7A06_RS00770"; product "glycine C-acetyltransferase"; protein_id "WP_001213834.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 140989 142185 . + 0 gene_id "nbis-gene-127"; transcript_id "gene-C7A06_RS00770"; Dbxref "Genbank:WP_001213834.1"; ID "cds-WP_001213834.1"; Name "WP_001213834.1"; Ontology_term "GO:0006567" "GO:0008890"; Parent "gene-C7A06_RS00770"; gbkey "CDS"; gene "kbl"; go_function "glycine C-acetyltransferase activity|0008890||IEA"; go_process "threonine catabolic process|0006567||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020239151.1"; locus_tag "C7A06_RS00770"; product "glycine C-acetyltransferase"; protein_id "WP_001213834.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 142195 143220 . + . gene_id "nbis-gene-128"; ID "nbis-gene-128"; Name "tdh"; gbkey "Gene"; gene "tdh"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00775";
+NZ_CP027599.1 RefSeq transcript 142195 143220 . + . gene_id "nbis-gene-128"; transcript_id "gene-C7A06_RS00775"; ID "gene-C7A06_RS00775"; Name "tdh"; Parent "nbis-gene-128"; gbkey "Gene"; gene "tdh"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00775"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 142195 143220 . + . gene_id "nbis-gene-128"; transcript_id "gene-C7A06_RS00775"; Dbxref "Genbank:WP_000646014.1"; ID "nbis-exon-136"; Name "WP_000646014.1"; Ontology_term "GO:0006567" "GO:0008743"; Parent "gene-C7A06_RS00775"; gbkey "CDS"; gene "tdh"; go_function "L-threonine 3-dehydrogenase activity|0008743||IEA"; go_process "threonine catabolic process|0006567||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005120462.1"; locus_tag "C7A06_RS00775"; product "L-threonine 3-dehydrogenase"; protein_id "WP_000646014.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 142195 143220 . + 0 gene_id "nbis-gene-128"; transcript_id "gene-C7A06_RS00775"; Dbxref "Genbank:WP_000646014.1"; ID "cds-WP_000646014.1"; Name "WP_000646014.1"; Ontology_term "GO:0006567" "GO:0008743"; Parent "gene-C7A06_RS00775"; gbkey "CDS"; gene "tdh"; go_function "L-threonine 3-dehydrogenase activity|0008743||IEA"; go_process "threonine catabolic process|0006567||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005120462.1"; locus_tag "C7A06_RS00775"; product "L-threonine 3-dehydrogenase"; protein_id "WP_000646014.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 143472 144506 . + . gene_id "nbis-gene-129"; ID "nbis-gene-129"; Name "waaH"; gbkey "Gene"; gene "waaH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00780";
+NZ_CP027599.1 RefSeq transcript 143472 144506 . + . gene_id "nbis-gene-129"; transcript_id "gene-C7A06_RS00780"; ID "gene-C7A06_RS00780"; Name "waaH"; Parent "nbis-gene-129"; gbkey "Gene"; gene "waaH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00780"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 143472 144506 . + . gene_id "nbis-gene-129"; transcript_id "gene-C7A06_RS00780"; Dbxref "Genbank:WP_000982091.1"; ID "nbis-exon-137"; Name "WP_000982091.1"; Parent "gene-C7A06_RS00780"; gbkey "CDS"; gene "waaH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418072.1"; locus_tag "C7A06_RS00780"; product "UDP-glucuronate:LPS(HepIII) glycosyltransferase"; protein_id "WP_000982091.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 143472 144506 . + 0 gene_id "nbis-gene-129"; transcript_id "gene-C7A06_RS00780"; Dbxref "Genbank:WP_000982091.1"; ID "cds-WP_000982091.1"; Name "WP_000982091.1"; Parent "gene-C7A06_RS00780"; gbkey "CDS"; gene "waaH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418072.1"; locus_tag "C7A06_RS00780"; product "UDP-glucuronate:LPS(HepIII) glycosyltransferase"; protein_id "WP_000982091.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 144493 145452 . - . gene_id "nbis-gene-130"; ID "nbis-gene-130"; Name "yibQ"; gbkey "Gene"; gene "yibQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00785";
+NZ_CP027599.1 RefSeq transcript 144493 145452 . - . gene_id "nbis-gene-130"; transcript_id "gene-C7A06_RS00785"; ID "gene-C7A06_RS00785"; Name "yibQ"; Parent "nbis-gene-130"; gbkey "Gene"; gene "yibQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00785"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 144493 145452 . - . gene_id "nbis-gene-130"; transcript_id "gene-C7A06_RS00785"; Dbxref "Genbank:WP_000483865.1"; ID "nbis-exon-138"; Name "WP_000483865.1"; Parent "gene-C7A06_RS00785"; gbkey "CDS"; gene "yibQ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312519.2"; locus_tag "C7A06_RS00785"; product "divergent polysaccharide deacetylase family protein"; protein_id "WP_000483865.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 144493 145452 . - 0 gene_id "nbis-gene-130"; transcript_id "gene-C7A06_RS00785"; Dbxref "Genbank:WP_000483865.1"; ID "cds-WP_000483865.1"; Name "WP_000483865.1"; Parent "gene-C7A06_RS00785"; gbkey "CDS"; gene "yibQ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312519.2"; locus_tag "C7A06_RS00785"; product "divergent polysaccharide deacetylase family protein"; protein_id "WP_000483865.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 145456 146715 . - . gene_id "nbis-gene-131"; ID "nbis-gene-131"; Name "envC"; gbkey "Gene"; gene "envC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00790";
+NZ_CP027599.1 RefSeq transcript 145456 146715 . - . gene_id "nbis-gene-131"; transcript_id "gene-C7A06_RS00790"; ID "gene-C7A06_RS00790"; Name "envC"; Parent "nbis-gene-131"; gbkey "Gene"; gene "envC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00790"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 145456 146715 . - . gene_id "nbis-gene-131"; transcript_id "gene-C7A06_RS00790"; Dbxref "Genbank:WP_000196256.1"; ID "nbis-exon-139"; Name "WP_000196256.1"; Parent "gene-C7A06_RS00790"; gbkey "CDS"; gene "envC"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418070.6"; locus_tag "C7A06_RS00790"; product "murein hydrolase activator EnvC"; protein_id "WP_000196256.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 145456 146715 . - 0 gene_id "nbis-gene-131"; transcript_id "gene-C7A06_RS00790"; Dbxref "Genbank:WP_000196256.1"; ID "cds-WP_000196256.1"; Name "WP_000196256.1"; Parent "gene-C7A06_RS00790"; gbkey "CDS"; gene "envC"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418070.6"; locus_tag "C7A06_RS00790"; product "murein hydrolase activator EnvC"; protein_id "WP_000196256.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 146749 148293 . - . gene_id "nbis-gene-132"; ID "nbis-gene-132"; Name "gpmM"; gbkey "Gene"; gene "gpmM"; gene_biotype "protein_coding"; gene_synonym "pgmI"; locus_tag "C7A06_RS00795";
+NZ_CP027599.1 RefSeq transcript 146749 148293 . - . gene_id "nbis-gene-132"; transcript_id "gene-C7A06_RS00795"; ID "gene-C7A06_RS00795"; Name "gpmM"; Parent "nbis-gene-132"; gbkey "Gene"; gene "gpmM"; gene_biotype "protein_coding"; gene_synonym "pgmI"; locus_tag "C7A06_RS00795"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 146749 148293 . - . gene_id "nbis-gene-132"; transcript_id "gene-C7A06_RS00795"; Dbxref "Genbank:WP_000116566.1"; ID "nbis-exon-140"; Name "WP_000116566.1"; Ontology_term "GO:0006007" "GO:0004619"; Parent "gene-C7A06_RS00795"; gbkey "CDS"; gene "gpmM"; go_function "phosphoglycerate mutase activity|0004619||IEA"; go_process "glucose catabolic process|0006007||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312517.1"; locus_tag "C7A06_RS00795"; product "2,3-bisphosphoglycerate-independent phosphoglycerate mutase"; protein_id "WP_000116566.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 146749 148293 . - 0 gene_id "nbis-gene-132"; transcript_id "gene-C7A06_RS00795"; Dbxref "Genbank:WP_000116566.1"; ID "cds-WP_000116566.1"; Name "WP_000116566.1"; Ontology_term "GO:0006007" "GO:0004619"; Parent "gene-C7A06_RS00795"; gbkey "CDS"; gene "gpmM"; go_function "phosphoglycerate mutase activity|0004619||IEA"; go_process "glucose catabolic process|0006007||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312517.1"; locus_tag "C7A06_RS00795"; product "2,3-bisphosphoglycerate-independent phosphoglycerate mutase"; protein_id "WP_000116566.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 148538 148969 . + . gene_id "nbis-gene-133"; ID "nbis-gene-133"; Name "yibN"; gbkey "Gene"; gene "yibN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00805";
+NZ_CP027599.1 RefSeq transcript 148538 148969 . + . gene_id "nbis-gene-133"; transcript_id "gene-C7A06_RS00805"; ID "gene-C7A06_RS00805"; Name "yibN"; Parent "nbis-gene-133"; gbkey "Gene"; gene "yibN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00805"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 148538 148969 . + . gene_id "nbis-gene-133"; transcript_id "gene-C7A06_RS00805"; Dbxref "Genbank:WP_001156181.1"; ID "nbis-exon-141"; Name "WP_001156181.1"; Parent "gene-C7A06_RS00805"; gbkey "CDS"; gene "yibN"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312516.1"; locus_tag "C7A06_RS00805"; product "rhodanese-like domain-containing protein"; protein_id "WP_001156181.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 148538 148969 . + 0 gene_id "nbis-gene-133"; transcript_id "gene-C7A06_RS00805"; Dbxref "Genbank:WP_001156181.1"; ID "cds-WP_001156181.1"; Name "WP_001156181.1"; Parent "gene-C7A06_RS00805"; gbkey "CDS"; gene "yibN"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312516.1"; locus_tag "C7A06_RS00805"; product "rhodanese-like domain-containing protein"; protein_id "WP_001156181.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 149111 149362 . + . gene_id "nbis-gene-134"; ID "nbis-gene-134"; Name "grxC"; gbkey "Gene"; gene "grxC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00810";
+NZ_CP027599.1 RefSeq transcript 149111 149362 . + . gene_id "nbis-gene-134"; transcript_id "gene-C7A06_RS00810"; ID "gene-C7A06_RS00810"; Name "grxC"; Parent "nbis-gene-134"; gbkey "Gene"; gene "grxC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00810"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 149111 149362 . + . gene_id "nbis-gene-134"; transcript_id "gene-C7A06_RS00810"; Dbxref "Genbank:WP_000024392.1"; ID "nbis-exon-142"; Name "WP_000024392.1"; Parent "gene-C7A06_RS00810"; gbkey "CDS"; gene "grxC"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312515.1"; locus_tag "C7A06_RS00810"; product "glutaredoxin 3"; protein_id "WP_000024392.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 149111 149362 . + 0 gene_id "nbis-gene-134"; transcript_id "gene-C7A06_RS00810"; Dbxref "Genbank:WP_000024392.1"; ID "cds-WP_000024392.1"; Name "WP_000024392.1"; Parent "gene-C7A06_RS00810"; gbkey "CDS"; gene "grxC"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312515.1"; locus_tag "C7A06_RS00810"; product "glutaredoxin 3"; protein_id "WP_000024392.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 149425 149892 . + . gene_id "nbis-gene-135"; ID "nbis-gene-135"; Name "secB"; gbkey "Gene"; gene "secB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00815";
+NZ_CP027599.1 RefSeq transcript 149425 149892 . + . gene_id "nbis-gene-135"; transcript_id "gene-C7A06_RS00815"; ID "gene-C7A06_RS00815"; Name "secB"; Parent "nbis-gene-135"; gbkey "Gene"; gene "secB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00815"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 149425 149892 . + . gene_id "nbis-gene-135"; transcript_id "gene-C7A06_RS00815"; Dbxref "Genbank:WP_000003377.1"; ID "nbis-exon-143"; Name "WP_000003377.1"; Parent "gene-C7A06_RS00815"; gbkey "CDS"; gene "secB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_015369180.1"; locus_tag "C7A06_RS00815"; product "protein-export chaperone SecB"; protein_id "WP_000003377.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 149425 149892 . + 0 gene_id "nbis-gene-135"; transcript_id "gene-C7A06_RS00815"; Dbxref "Genbank:WP_000003377.1"; ID "cds-WP_000003377.1"; Name "WP_000003377.1"; Parent "gene-C7A06_RS00815"; gbkey "CDS"; gene "secB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_015369180.1"; locus_tag "C7A06_RS00815"; product "protein-export chaperone SecB"; protein_id "WP_000003377.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 149892 150911 . + . gene_id "nbis-gene-136"; ID "nbis-gene-136"; Name "gpsA"; gbkey "Gene"; gene "gpsA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00820";
+NZ_CP027599.1 RefSeq transcript 149892 150911 . + . gene_id "nbis-gene-136"; transcript_id "gene-C7A06_RS00820"; ID "gene-C7A06_RS00820"; Name "gpsA"; Parent "nbis-gene-136"; gbkey "Gene"; gene "gpsA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00820"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 149892 150911 . + . gene_id "nbis-gene-136"; transcript_id "gene-C7A06_RS00820"; Dbxref "Genbank:WP_001076194.1"; ID "nbis-exon-144"; Name "WP_001076194.1"; Ontology_term "GO:0006072" "GO:0004367"; Parent "gene-C7A06_RS00820"; gbkey "CDS"; gene "gpsA"; go_function "glycerol-3-phosphate dehydrogenase [NAD+] activity|0004367||IEA"; go_process "glycerol-3-phosphate metabolic process|0006072||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312513.1"; locus_tag "C7A06_RS00820"; product "NAD(P)H-dependent glycerol-3-phosphate dehydrogenase"; protein_id "WP_001076194.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 149892 150911 . + 0 gene_id "nbis-gene-136"; transcript_id "gene-C7A06_RS00820"; Dbxref "Genbank:WP_001076194.1"; ID "cds-WP_001076194.1"; Name "WP_001076194.1"; Ontology_term "GO:0006072" "GO:0004367"; Parent "gene-C7A06_RS00820"; gbkey "CDS"; gene "gpsA"; go_function "glycerol-3-phosphate dehydrogenase [NAD+] activity|0004367||IEA"; go_process "glycerol-3-phosphate metabolic process|0006072||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312513.1"; locus_tag "C7A06_RS00820"; product "NAD(P)H-dependent glycerol-3-phosphate dehydrogenase"; protein_id "WP_001076194.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 150991 151812 . + . gene_id "nbis-gene-137"; ID "nbis-gene-137"; Name "cysE"; gbkey "Gene"; gene "cysE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00825";
+NZ_CP027599.1 RefSeq transcript 150991 151812 . + . gene_id "nbis-gene-137"; transcript_id "gene-C7A06_RS00825"; ID "gene-C7A06_RS00825"; Name "cysE"; Parent "nbis-gene-137"; gbkey "Gene"; gene "cysE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00825"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 150991 151812 . + . gene_id "nbis-gene-137"; transcript_id "gene-C7A06_RS00825"; Dbxref "Genbank:WP_001277561.1"; ID "nbis-exon-145"; Name "WP_001277561.1"; Ontology_term "GO:0006535" "GO:0009001"; Parent "gene-C7A06_RS00825"; gbkey "CDS"; gene "cysE"; go_function "serine O-acetyltransferase activity|0009001||IEA"; go_process "cysteine biosynthetic process from serine|0006535||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001112113.1"; locus_tag "C7A06_RS00825"; product "serine O-acetyltransferase"; protein_id "WP_001277561.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 150991 151812 . + 0 gene_id "nbis-gene-137"; transcript_id "gene-C7A06_RS00825"; Dbxref "Genbank:WP_001277561.1"; ID "cds-WP_001277561.1"; Name "WP_001277561.1"; Ontology_term "GO:0006535" "GO:0009001"; Parent "gene-C7A06_RS00825"; gbkey "CDS"; gene "cysE"; go_function "serine O-acetyltransferase activity|0009001||IEA"; go_process "cysteine biosynthetic process from serine|0006535||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001112113.1"; locus_tag "C7A06_RS00825"; product "serine O-acetyltransferase"; protein_id "WP_001277561.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 151865 152338 . - . gene_id "nbis-gene-138"; ID "nbis-gene-138"; Name "trmL"; gbkey "Gene"; gene "trmL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00830";
+NZ_CP027599.1 RefSeq transcript 151865 152338 . - . gene_id "nbis-gene-138"; transcript_id "gene-C7A06_RS00830"; ID "gene-C7A06_RS00830"; Name "trmL"; Parent "nbis-gene-138"; gbkey "Gene"; gene "trmL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00830"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 151865 152338 . - . gene_id "nbis-gene-138"; transcript_id "gene-C7A06_RS00830"; Dbxref "Genbank:WP_000932342.1"; ID "nbis-exon-146"; Name "WP_000932342.1"; Ontology_term "GO:0001510" "GO:0008173"; Parent "gene-C7A06_RS00830"; gbkey "CDS"; gene "trmL"; go_function "RNA methyltransferase activity|0008173||IEA"; go_process "RNA methylation|0001510||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312511.1"; locus_tag "C7A06_RS00830"; product "tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL"; protein_id "WP_000932342.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 151865 152338 . - 0 gene_id "nbis-gene-138"; transcript_id "gene-C7A06_RS00830"; Dbxref "Genbank:WP_000932342.1"; ID "cds-WP_000932342.1"; Name "WP_000932342.1"; Ontology_term "GO:0001510" "GO:0008173"; Parent "gene-C7A06_RS00830"; gbkey "CDS"; gene "trmL"; go_function "RNA methyltransferase activity|0008173||IEA"; go_process "RNA methylation|0001510||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312511.1"; locus_tag "C7A06_RS00830"; product "tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL"; protein_id "WP_000932342.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 152524 153714 . - . gene_id "nbis-gene-139"; ID "nbis-gene-139"; Name "lldD"; gbkey "Gene"; gene "lldD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00835";
+NZ_CP027599.1 RefSeq transcript 152524 153714 . - . gene_id "nbis-gene-139"; transcript_id "gene-C7A06_RS00835"; ID "gene-C7A06_RS00835"; Name "lldD"; Parent "nbis-gene-139"; gbkey "Gene"; gene "lldD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00835"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 152524 153714 . - . gene_id "nbis-gene-139"; transcript_id "gene-C7A06_RS00835"; Dbxref "Genbank:WP_000586964.1"; ID "nbis-exon-147"; Name "WP_000586964.1"; Parent "gene-C7A06_RS00835"; gbkey "CDS"; gene "lldD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312510.1"; locus_tag "C7A06_RS00835"; product "quinone-dependent L-lactate dehydrogenase"; protein_id "WP_000586964.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 152524 153714 . - 0 gene_id "nbis-gene-139"; transcript_id "gene-C7A06_RS00835"; Dbxref "Genbank:WP_000586964.1"; ID "cds-WP_000586964.1"; Name "WP_000586964.1"; Parent "gene-C7A06_RS00835"; gbkey "CDS"; gene "lldD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312510.1"; locus_tag "C7A06_RS00835"; product "quinone-dependent L-lactate dehydrogenase"; protein_id "WP_000586964.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 153711 154487 . - . gene_id "nbis-gene-140"; ID "nbis-gene-140"; Name "lldR"; gbkey "Gene"; gene "lldR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00840";
+NZ_CP027599.1 RefSeq transcript 153711 154487 . - . gene_id "nbis-gene-140"; transcript_id "gene-C7A06_RS00840"; ID "gene-C7A06_RS00840"; Name "lldR"; Parent "nbis-gene-140"; gbkey "Gene"; gene "lldR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00840"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 153711 154487 . - . gene_id "nbis-gene-140"; transcript_id "gene-C7A06_RS00840"; Dbxref "Genbank:WP_000636500.1"; ID "nbis-exon-148"; Name "WP_000636500.1"; Ontology_term "GO:0006355" "GO:0003700"; Parent "gene-C7A06_RS00840"; gbkey "CDS"; gene "lldR"; go_function "DNA-binding transcription factor activity|0003700||IEA"; go_process "regulation of transcription, DNA-templated|0006355||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418061.1"; locus_tag "C7A06_RS00840"; product "transcriptional regulator LldR"; protein_id "WP_000636500.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 153711 154487 . - 0 gene_id "nbis-gene-140"; transcript_id "gene-C7A06_RS00840"; Dbxref "Genbank:WP_000636500.1"; ID "cds-WP_000636500.1"; Name "WP_000636500.1"; Ontology_term "GO:0006355" "GO:0003700"; Parent "gene-C7A06_RS00840"; gbkey "CDS"; gene "lldR"; go_function "DNA-binding transcription factor activity|0003700||IEA"; go_process "regulation of transcription, DNA-templated|0006355||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418061.1"; locus_tag "C7A06_RS00840"; product "transcriptional regulator LldR"; protein_id "WP_000636500.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 154487 156142 . - . gene_id "nbis-gene-141"; ID "nbis-gene-141"; Name "lldP"; gbkey "Gene"; gene "lldP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00845";
+NZ_CP027599.1 RefSeq transcript 154487 156142 . - . gene_id "nbis-gene-141"; transcript_id "gene-C7A06_RS00845"; ID "gene-C7A06_RS00845"; Name "lldP"; Parent "nbis-gene-141"; gbkey "Gene"; gene "lldP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00845"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 154487 156142 . - . gene_id "nbis-gene-141"; transcript_id "gene-C7A06_RS00845"; Dbxref "Genbank:WP_001297977.1"; ID "nbis-exon-149"; Name "WP_001297977.1"; Ontology_term "GO:0015727" "GO:0015129" "GO:0005887"; Parent "gene-C7A06_RS00845"; gbkey "CDS"; gene "lldP"; go_component "integral component of plasma membrane|0005887||IEA"; go_function "lactate transmembrane transporter activity|0015129||IEA"; go_process "lactate transport|0015727||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312508.1"; locus_tag "C7A06_RS00845"; product "L-lactate permease"; protein_id "WP_001297977.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 154487 156142 . - 0 gene_id "nbis-gene-141"; transcript_id "gene-C7A06_RS00845"; Dbxref "Genbank:WP_001297977.1"; ID "cds-WP_001297977.1"; Name "WP_001297977.1"; Ontology_term "GO:0015727" "GO:0015129" "GO:0005887"; Parent "gene-C7A06_RS00845"; gbkey "CDS"; gene "lldP"; go_component "integral component of plasma membrane|0005887||IEA"; go_function "lactate transmembrane transporter activity|0015129||IEA"; go_process "lactate transport|0015727||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312508.1"; locus_tag "C7A06_RS00845"; product "L-lactate permease"; protein_id "WP_001297977.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 156511 161361 . - . gene_id "nbis-gene-142"; ID "nbis-gene-142"; Name "ehaG"; gbkey "Gene"; gene "ehaG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00855";
+NZ_CP027599.1 RefSeq transcript 156511 161361 . - . gene_id "nbis-gene-142"; transcript_id "gene-C7A06_RS00855"; ID "gene-C7A06_RS00855"; Name "ehaG"; Parent "nbis-gene-142"; gbkey "Gene"; gene "ehaG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00855"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 156511 161361 . - . gene_id "nbis-gene-142"; transcript_id "gene-C7A06_RS00855"; Dbxref "Genbank:WP_001033225.1"; ID "nbis-exon-150"; Name "WP_001033225.1"; Parent "gene-C7A06_RS00855"; gbkey "CDS"; gene "ehaG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312507.1"; locus_tag "C7A06_RS00855"; product "trimeric autotransporter adhesin EhaG"; protein_id "WP_001033225.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 156511 161361 . - 0 gene_id "nbis-gene-142"; transcript_id "gene-C7A06_RS00855"; Dbxref "Genbank:WP_001033225.1"; ID "cds-WP_001033225.1"; Name "WP_001033225.1"; Parent "gene-C7A06_RS00855"; gbkey "CDS"; gene "ehaG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312507.1"; locus_tag "C7A06_RS00855"; product "trimeric autotransporter adhesin EhaG"; protein_id "WP_001033225.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 161361 162089 . - . gene_id "nbis-gene-143"; ID "nbis-gene-143"; Name "C7A06_RS00860"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00860";
+NZ_CP027599.1 RefSeq transcript 161361 162089 . - . gene_id "nbis-gene-143"; transcript_id "gene-C7A06_RS00860"; ID "gene-C7A06_RS00860"; Name "C7A06_RS00860"; Parent "nbis-gene-143"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00860"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 161361 162089 . - . gene_id "nbis-gene-143"; transcript_id "gene-C7A06_RS00860"; Dbxref "Genbank:WP_001049540.1"; ID "nbis-exon-151"; Name "WP_001049540.1"; Parent "gene-C7A06_RS00860"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001049551.1"; locus_tag "C7A06_RS00860"; product "DUF3251 domain-containing protein"; protein_id "WP_001049540.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 161361 162089 . - 0 gene_id "nbis-gene-143"; transcript_id "gene-C7A06_RS00860"; Dbxref "Genbank:WP_001049540.1"; ID "cds-WP_001049540.1"; Name "WP_001049540.1"; Parent "gene-C7A06_RS00860"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001049551.1"; locus_tag "C7A06_RS00860"; product "DUF3251 domain-containing protein"; protein_id "WP_001049540.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 162632 162994 . - . gene_id "nbis-gene-144"; ID "nbis-gene-144"; Name "yibL"; gbkey "Gene"; gene "yibL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00870";
+NZ_CP027599.1 RefSeq transcript 162632 162994 . - . gene_id "nbis-gene-144"; transcript_id "gene-C7A06_RS00870"; ID "gene-C7A06_RS00870"; Name "yibL"; Parent "nbis-gene-144"; gbkey "Gene"; gene "yibL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00870"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 162632 162994 . - . gene_id "nbis-gene-144"; transcript_id "gene-C7A06_RS00870"; Dbxref "Genbank:WP_000665680.1"; ID "nbis-exon-152"; Name "WP_000665680.1"; Parent "gene-C7A06_RS00870"; gbkey "CDS"; gene "yibL"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312505.1"; locus_tag "C7A06_RS00870"; product "YibL family ribosome-associated protein"; protein_id "WP_000665680.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 162632 162994 . - 0 gene_id "nbis-gene-144"; transcript_id "gene-C7A06_RS00870"; Dbxref "Genbank:WP_000665680.1"; ID "cds-WP_000665680.1"; Name "WP_000665680.1"; Parent "gene-C7A06_RS00870"; gbkey "CDS"; gene "yibL"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312505.1"; locus_tag "C7A06_RS00870"; product "YibL family ribosome-associated protein"; protein_id "WP_000665680.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 163279 163488 . + . gene_id "nbis-gene-145"; ID "nbis-gene-145"; Name "C7A06_RS00875"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00875";
+NZ_CP027599.1 RefSeq transcript 163279 163488 . + . gene_id "nbis-gene-145"; transcript_id "gene-C7A06_RS00875"; ID "gene-C7A06_RS00875"; Name "C7A06_RS00875"; Parent "nbis-gene-145"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00875"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 163279 163488 . + . gene_id "nbis-gene-145"; transcript_id "gene-C7A06_RS00875"; Dbxref "Genbank:WP_000517100.1"; ID "nbis-exon-153"; Name "WP_000517100.1"; Parent "gene-C7A06_RS00875"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_588470.1"; locus_tag "C7A06_RS00875"; product "hypothetical protein"; protein_id "WP_000517100.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 163279 163488 . + 0 gene_id "nbis-gene-145"; transcript_id "gene-C7A06_RS00875"; Dbxref "Genbank:WP_000517100.1"; ID "cds-WP_000517100.1"; Name "WP_000517100.1"; Parent "gene-C7A06_RS00875"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_588470.1"; locus_tag "C7A06_RS00875"; product "hypothetical protein"; protein_id "WP_000517100.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 163500 164087 . - . gene_id "nbis-gene-146"; ID "nbis-gene-146"; Name "mtlR"; gbkey "Gene"; gene "mtlR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00880";
+NZ_CP027599.1 RefSeq transcript 163500 164087 . - . gene_id "nbis-gene-146"; transcript_id "gene-C7A06_RS00880"; ID "gene-C7A06_RS00880"; Name "mtlR"; Parent "nbis-gene-146"; gbkey "Gene"; gene "mtlR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00880"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 163500 164087 . - . gene_id "nbis-gene-146"; transcript_id "gene-C7A06_RS00880"; Dbxref "Genbank:WP_000228271.1"; ID "nbis-exon-154"; Name "WP_000228271.1"; Parent "gene-C7A06_RS00880"; gbkey "CDS"; gene "mtlR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312504.1"; locus_tag "C7A06_RS00880"; product "mannitol operon repressor MtlR"; protein_id "WP_000228271.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 163500 164087 . - 0 gene_id "nbis-gene-146"; transcript_id "gene-C7A06_RS00880"; Dbxref "Genbank:WP_000228271.1"; ID "cds-WP_000228271.1"; Name "WP_000228271.1"; Parent "gene-C7A06_RS00880"; gbkey "CDS"; gene "mtlR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312504.1"; locus_tag "C7A06_RS00880"; product "mannitol operon repressor MtlR"; protein_id "WP_000228271.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 164087 165235 . - . gene_id "nbis-gene-147"; ID "nbis-gene-147"; Name "mtlD"; gbkey "Gene"; gene "mtlD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00885";
+NZ_CP027599.1 RefSeq transcript 164087 165235 . - . gene_id "nbis-gene-147"; transcript_id "gene-C7A06_RS00885"; ID "gene-C7A06_RS00885"; Name "mtlD"; Parent "nbis-gene-147"; gbkey "Gene"; gene "mtlD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00885"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 164087 165235 . - . gene_id "nbis-gene-147"; transcript_id "gene-C7A06_RS00885"; Dbxref "Genbank:WP_000645424.1"; ID "nbis-exon-155"; Name "WP_000645424.1"; Ontology_term "GO:0019594" "GO:0008926"; Parent "gene-C7A06_RS00885"; gbkey "CDS"; gene "mtlD"; go_function "mannitol-1-phosphate 5-dehydrogenase activity|0008926||IEA"; go_process "mannitol metabolic process|0019594||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709374.2"; locus_tag "C7A06_RS00885"; product "mannitol-1-phosphate 5-dehydrogenase"; protein_id "WP_000645424.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 164087 165235 . - 0 gene_id "nbis-gene-147"; transcript_id "gene-C7A06_RS00885"; Dbxref "Genbank:WP_000645424.1"; ID "cds-WP_000645424.1"; Name "WP_000645424.1"; Ontology_term "GO:0019594" "GO:0008926"; Parent "gene-C7A06_RS00885"; gbkey "CDS"; gene "mtlD"; go_function "mannitol-1-phosphate 5-dehydrogenase activity|0008926||IEA"; go_process "mannitol metabolic process|0019594||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709374.2"; locus_tag "C7A06_RS00885"; product "mannitol-1-phosphate 5-dehydrogenase"; protein_id "WP_000645424.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 165465 167378 . - . gene_id "nbis-gene-148"; ID "nbis-gene-148"; Name "mtlA"; gbkey "Gene"; gene "mtlA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00890";
+NZ_CP027599.1 RefSeq transcript 165465 167378 . - . gene_id "nbis-gene-148"; transcript_id "gene-C7A06_RS00890"; ID "gene-C7A06_RS00890"; Name "mtlA"; Parent "nbis-gene-148"; gbkey "Gene"; gene "mtlA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00890"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 165465 167378 . - . gene_id "nbis-gene-148"; transcript_id "gene-C7A06_RS00890"; Dbxref "Genbank:WP_000093261.1"; ID "nbis-exon-156"; Name "WP_000093261.1"; Parent "gene-C7A06_RS00890"; gbkey "CDS"; gene "mtlA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709373.1"; locus_tag "C7A06_RS00890"; product "PTS mannitol transporter subunit IICBA"; protein_id "WP_000093261.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 165465 167378 . - 0 gene_id "nbis-gene-148"; transcript_id "gene-C7A06_RS00890"; Dbxref "Genbank:WP_000093261.1"; ID "cds-WP_000093261.1"; Name "WP_000093261.1"; Parent "gene-C7A06_RS00890"; gbkey "CDS"; gene "mtlA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709373.1"; locus_tag "C7A06_RS00890"; product "PTS mannitol transporter subunit IICBA"; protein_id "WP_000093261.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 167915 168277 . + . gene_id "nbis-gene-149"; ID "nbis-gene-149"; Name "yibI"; gbkey "Gene"; gene "yibI"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00895";
+NZ_CP027599.1 RefSeq transcript 167915 168277 . + . gene_id "nbis-gene-149"; transcript_id "gene-C7A06_RS00895"; ID "gene-C7A06_RS00895"; Name "yibI"; Parent "nbis-gene-149"; gbkey "Gene"; gene "yibI"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00895"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 167915 168277 . + . gene_id "nbis-gene-149"; transcript_id "gene-C7A06_RS00895"; Dbxref "Genbank:WP_000479624.1"; ID "nbis-exon-157"; Name "WP_000479624.1"; Parent "gene-C7A06_RS00895"; gbkey "CDS"; gene "yibI"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418055.1"; locus_tag "C7A06_RS00895"; product "DUF3302 domain-containing protein"; protein_id "WP_000479624.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 167915 168277 . + 0 gene_id "nbis-gene-149"; transcript_id "gene-C7A06_RS00895"; Dbxref "Genbank:WP_000479624.1"; ID "cds-WP_000479624.1"; Name "WP_000479624.1"; Parent "gene-C7A06_RS00895"; gbkey "CDS"; gene "yibI"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418055.1"; locus_tag "C7A06_RS00895"; product "DUF3302 domain-containing protein"; protein_id "WP_000479624.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 168280 169346 . + . gene_id "nbis-pseudogene-9"; ID "nbis-pseudogene-9"; Name "yibH"; gbkey "Gene"; gene "yibH"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00900"; original_biotype "pseudogene"; pseudo "true";
+NZ_CP027599.1 RefSeq transcript 168280 169346 . + . gene_id "nbis-pseudogene-9"; transcript_id "gene-C7A06_RS00900"; ID "gene-C7A06_RS00900"; Name "yibH"; Parent "nbis-pseudogene-9"; gbkey "Gene"; gene "yibH"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00900"; original_biotype "mrna"; pseudo "true";
+NZ_CP027599.1 Protein Homology exon 168280 169346 . + . gene_id "nbis-pseudogene-9"; transcript_id "gene-C7A06_RS00900"; ID "nbis-exon-158"; Note "frameshifted"; Parent "gene-C7A06_RS00900"; gbkey "CDS"; gene "yibH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312500.1"; locus_tag "C7A06_RS00900"; product "HlyD family secretion protein"; pseudo "true"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 168280 169346 . + 0 gene_id "nbis-pseudogene-9"; transcript_id "gene-C7A06_RS00900"; ID "cds-C7A06_RS00900"; Note "frameshifted"; Parent "gene-C7A06_RS00900"; gbkey "CDS"; gene "yibH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312500.1"; locus_tag "C7A06_RS00900"; product "HlyD family secretion protein"; pseudo "true"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 169806 170315 . - . gene_id "nbis-gene-150"; ID "nbis-gene-150"; Name "C7A06_RS00905"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00905";
+NZ_CP027599.1 RefSeq transcript 169806 170315 . - . gene_id "nbis-gene-150"; transcript_id "gene-C7A06_RS00905"; ID "gene-C7A06_RS00905"; Name "C7A06_RS00905"; Parent "nbis-gene-150"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00905"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 169806 170315 . - . gene_id "nbis-gene-150"; transcript_id "gene-C7A06_RS00905"; Dbxref "Genbank:WP_236917825.1"; ID "nbis-exon-159"; Name "WP_236917825.1"; Parent "gene-C7A06_RS00905"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_016158939.1"; locus_tag "C7A06_RS00905"; product "Imm57 family immunity protein"; protein_id "WP_236917825.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 169806 170315 . - 0 gene_id "nbis-gene-150"; transcript_id "gene-C7A06_RS00905"; Dbxref "Genbank:WP_236917825.1"; ID "cds-WP_236917825.1"; Name "WP_236917825.1"; Parent "gene-C7A06_RS00905"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_016158939.1"; locus_tag "C7A06_RS00905"; product "Imm57 family immunity protein"; protein_id "WP_236917825.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 170950 171411 . - . gene_id "nbis-gene-151"; ID "nbis-gene-151"; Name "yibG"; gbkey "Gene"; gene "yibG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00920";
+NZ_CP027599.1 RefSeq transcript 170950 171411 . - . gene_id "nbis-gene-151"; transcript_id "gene-C7A06_RS00920"; ID "gene-C7A06_RS00920"; Name "yibG"; Parent "nbis-gene-151"; gbkey "Gene"; gene "yibG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00920"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 170950 171411 . - . gene_id "nbis-gene-151"; transcript_id "gene-C7A06_RS00920"; Dbxref "Genbank:WP_000642489.1"; ID "nbis-exon-160"; Name "WP_000642489.1"; Parent "gene-C7A06_RS00920"; gbkey "CDS"; gene "yibG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418053.1"; locus_tag "C7A06_RS00920"; product "sel1 repeat family protein"; protein_id "WP_000642489.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 170950 171411 . - 0 gene_id "nbis-gene-151"; transcript_id "gene-C7A06_RS00920"; Dbxref "Genbank:WP_000642489.1"; ID "cds-WP_000642489.1"; Name "WP_000642489.1"; Parent "gene-C7A06_RS00920"; gbkey "CDS"; gene "yibG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418053.1"; locus_tag "C7A06_RS00920"; product "sel1 repeat family protein"; protein_id "WP_000642489.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 171423 172381 . - . gene_id "nbis-pseudogene-281"; ID "nbis-pseudogene-281"; Name "C7A06_RS33910"; end_range "172381" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33910"; original_biotype "pseudogene"; partial "true"; pseudo "true";
+NZ_CP027599.1 RefSeq transcript 171423 172381 . - . gene_id "nbis-pseudogene-281"; transcript_id "gene-C7A06_RS33910"; ID "gene-C7A06_RS33910"; Name "C7A06_RS33910"; Parent "nbis-pseudogene-281"; end_range "172381" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33910"; original_biotype "mrna"; partial "true"; pseudo "true";
+NZ_CP027599.1 Protein Homology exon 171423 172381 . - . gene_id "nbis-pseudogene-281"; transcript_id "gene-C7A06_RS33910"; ID "nbis-exon-5988"; Note "frameshifted; incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS33910"; end_range "172381" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312497.1"; locus_tag "C7A06_RS33910"; partial "true"; product "RHS domain-containing protein"; pseudo "true"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 171423 172381 . - 0 gene_id "nbis-pseudogene-281"; transcript_id "gene-C7A06_RS33910"; ID "cds-C7A06_RS33910"; Note "frameshifted; incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS33910"; end_range "172381" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312497.1"; locus_tag "C7A06_RS33910"; partial "true"; product "RHS domain-containing protein"; pseudo "true"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 172409 173251 . - . gene_id "nbis-gene-152"; ID "nbis-gene-152"; Name "yibA"; gbkey "Gene"; gene "yibA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00930";
+NZ_CP027599.1 RefSeq transcript 172409 173251 . - . gene_id "nbis-gene-152"; transcript_id "gene-C7A06_RS00930"; ID "gene-C7A06_RS00930"; Name "yibA"; Parent "nbis-gene-152"; gbkey "Gene"; gene "yibA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00930"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 172409 173251 . - . gene_id "nbis-gene-152"; transcript_id "gene-C7A06_RS00930"; Dbxref "Genbank:WP_000072850.1"; ID "nbis-exon-161"; Name "WP_000072850.1"; Parent "gene-C7A06_RS00930"; gbkey "CDS"; gene "yibA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418051.1"; locus_tag "C7A06_RS00930"; product "HEAT repeat domain-containing protein"; protein_id "WP_000072850.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 172409 173251 . - 0 gene_id "nbis-gene-152"; transcript_id "gene-C7A06_RS00930"; Dbxref "Genbank:WP_000072850.1"; ID "cds-WP_000072850.1"; Name "WP_000072850.1"; Parent "gene-C7A06_RS00930"; gbkey "CDS"; gene "yibA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418051.1"; locus_tag "C7A06_RS00930"; product "HEAT repeat domain-containing protein"; protein_id "WP_000072850.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 173272 177393 . - . gene_id "nbis-gene-153"; ID "nbis-gene-153"; Name "C7A06_RS00935"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00935";
+NZ_CP027599.1 RefSeq transcript 173272 177393 . - . gene_id "nbis-gene-153"; transcript_id "gene-C7A06_RS00935"; ID "gene-C7A06_RS00935"; Name "C7A06_RS00935"; Parent "nbis-gene-153"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00935"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 173272 177393 . - . gene_id "nbis-gene-153"; transcript_id "gene-C7A06_RS00935"; Dbxref "Genbank:WP_000015217.1"; ID "nbis-exon-162"; Name "WP_000015217.1"; Parent "gene-C7A06_RS00935"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418050.1"; locus_tag "C7A06_RS00935"; product "polymorphic toxin type 34 domain-containing protein"; protein_id "WP_000015217.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 173272 177393 . - 0 gene_id "nbis-gene-153"; transcript_id "gene-C7A06_RS00935"; Dbxref "Genbank:WP_000015217.1"; ID "cds-WP_000015217.1"; Name "WP_000015217.1"; Parent "gene-C7A06_RS00935"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418050.1"; locus_tag "C7A06_RS00935"; product "polymorphic toxin type 34 domain-containing protein"; protein_id "WP_000015217.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 177622 178230 . + . gene_id "nbis-gene-154"; ID "nbis-gene-154"; Name "yibF"; gbkey "Gene"; gene "yibF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00940";
+NZ_CP027599.1 RefSeq transcript 177622 178230 . + . gene_id "nbis-gene-154"; transcript_id "gene-C7A06_RS00940"; ID "gene-C7A06_RS00940"; Name "yibF"; Parent "nbis-gene-154"; gbkey "Gene"; gene "yibF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00940"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 177622 178230 . + . gene_id "nbis-gene-154"; transcript_id "gene-C7A06_RS00940"; Dbxref "Genbank:WP_000779792.1"; ID "nbis-exon-163"; Name "WP_000779792.1"; Ontology_term "GO:0006749" "GO:0005515"; Parent "gene-C7A06_RS00940"; gbkey "CDS"; gene "yibF"; go_function "protein binding|0005515||IEA"; go_process "glutathione metabolic process|0006749||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418049.1"; locus_tag "C7A06_RS00940"; product "glutathione S-transferase"; protein_id "WP_000779792.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 177622 178230 . + 0 gene_id "nbis-gene-154"; transcript_id "gene-C7A06_RS00940"; Dbxref "Genbank:WP_000779792.1"; ID "cds-WP_000779792.1"; Name "WP_000779792.1"; Ontology_term "GO:0006749" "GO:0005515"; Parent "gene-C7A06_RS00940"; gbkey "CDS"; gene "yibF"; go_function "protein binding|0005515||IEA"; go_process "glutathione metabolic process|0006749||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418049.1"; locus_tag "C7A06_RS00940"; product "glutathione S-transferase"; protein_id "WP_000779792.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 178328 179719 . + . gene_id "nbis-gene-155"; ID "nbis-gene-155"; Name "selA"; gbkey "Gene"; gene "selA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00945";
+NZ_CP027599.1 RefSeq transcript 178328 179719 . + . gene_id "nbis-gene-155"; transcript_id "gene-C7A06_RS00945"; ID "gene-C7A06_RS00945"; Name "selA"; Parent "nbis-gene-155"; gbkey "Gene"; gene "selA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00945"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 178328 179719 . + . gene_id "nbis-gene-155"; transcript_id "gene-C7A06_RS00945"; Dbxref "Genbank:WP_000206271.1"; ID "nbis-exon-164"; Name "WP_000206271.1"; Ontology_term "GO:0016260" "GO:0004125"; Parent "gene-C7A06_RS00945"; gbkey "CDS"; gene "selA"; go_function "L-seryl-tRNASec selenium transferase activity|0004125||IEA"; go_process "selenocysteine biosynthetic process|0016260||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312495.1"; locus_tag "C7A06_RS00945"; product "L-seryl-tRNA(Sec) selenium transferase"; protein_id "WP_000206271.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 178328 179719 . + 0 gene_id "nbis-gene-155"; transcript_id "gene-C7A06_RS00945"; Dbxref "Genbank:WP_000206271.1"; ID "cds-WP_000206271.1"; Name "WP_000206271.1"; Ontology_term "GO:0016260" "GO:0004125"; Parent "gene-C7A06_RS00945"; gbkey "CDS"; gene "selA"; go_function "L-seryl-tRNASec selenium transferase activity|0004125||IEA"; go_process "selenocysteine biosynthetic process|0016260||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312495.1"; locus_tag "C7A06_RS00945"; product "L-seryl-tRNA(Sec) selenium transferase"; protein_id "WP_000206271.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 179716 181560 . + . gene_id "nbis-gene-156"; ID "nbis-gene-156"; Name "selB"; gbkey "Gene"; gene "selB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00950";
+NZ_CP027599.1 RefSeq transcript 179716 181560 . + . gene_id "nbis-gene-156"; transcript_id "gene-C7A06_RS00950"; ID "gene-C7A06_RS00950"; Name "selB"; Parent "nbis-gene-156"; gbkey "Gene"; gene "selB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00950"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 179716 181560 . + . gene_id "nbis-gene-156"; transcript_id "gene-C7A06_RS00950"; Dbxref "Genbank:WP_000582492.1"; ID "nbis-exon-165"; Name "WP_000582492.1"; Ontology_term "GO:0001514" "GO:0003723" "GO:0003746" "GO:0003924" "GO:0005525"; Parent "gene-C7A06_RS00950"; gbkey "CDS"; gene "selB"; go_function "RNA binding|0003723||IEA" "translation elongation factor activity|0003746||IEA" "GTPase activity|0003924||IEA" "GTP binding|0005525||IEA"; go_process "selenocysteine incorporation|0001514||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418047.1"; locus_tag "C7A06_RS00950"; product "selenocysteine-specific translation elongation factor"; protein_id "WP_000582492.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 179716 181560 . + 0 gene_id "nbis-gene-156"; transcript_id "gene-C7A06_RS00950"; Dbxref "Genbank:WP_000582492.1"; ID "cds-WP_000582492.1"; Name "WP_000582492.1"; Ontology_term "GO:0001514" "GO:0003723" "GO:0003746" "GO:0003924" "GO:0005525"; Parent "gene-C7A06_RS00950"; gbkey "CDS"; gene "selB"; go_function "RNA binding|0003723||IEA" "translation elongation factor activity|0003746||IEA" "GTPase activity|0003924||IEA" "GTP binding|0005525||IEA"; go_process "selenocysteine incorporation|0001514||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418047.1"; locus_tag "C7A06_RS00950"; product "selenocysteine-specific translation elongation factor"; protein_id "WP_000582492.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 181750 182901 . + . gene_id "nbis-gene-157"; ID "nbis-gene-157"; Name "yiaY"; gbkey "Gene"; gene "yiaY"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00955";
+NZ_CP027599.1 RefSeq transcript 181750 182901 . + . gene_id "nbis-gene-157"; transcript_id "gene-C7A06_RS00955"; ID "gene-C7A06_RS00955"; Name "yiaY"; Parent "nbis-gene-157"; gbkey "Gene"; gene "yiaY"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00955"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 181750 182901 . + . gene_id "nbis-gene-157"; transcript_id "gene-C7A06_RS00955"; Dbxref "Genbank:WP_000168712.1"; ID "nbis-exon-166"; Name "WP_000168712.1"; Ontology_term "GO:0016491"; Parent "gene-C7A06_RS00955"; gbkey "CDS"; gene "yiaY"; go_function "oxidoreductase activity|0016491||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312493.1"; locus_tag "C7A06_RS00955"; product "L-threonine dehydrogenase"; protein_id "WP_000168712.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 181750 182901 . + 0 gene_id "nbis-gene-157"; transcript_id "gene-C7A06_RS00955"; Dbxref "Genbank:WP_000168712.1"; ID "cds-WP_000168712.1"; Name "WP_000168712.1"; Ontology_term "GO:0016491"; Parent "gene-C7A06_RS00955"; gbkey "CDS"; gene "yiaY"; go_function "oxidoreductase activity|0016491||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312493.1"; locus_tag "C7A06_RS00955"; product "L-threonine dehydrogenase"; protein_id "WP_000168712.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 183066 184604 . + . gene_id "nbis-gene-158"; ID "nbis-gene-158"; Name "aldB"; gbkey "Gene"; gene "aldB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00960";
+NZ_CP027599.1 RefSeq transcript 183066 184604 . + . gene_id "nbis-gene-158"; transcript_id "gene-C7A06_RS00960"; ID "gene-C7A06_RS00960"; Name "aldB"; Parent "nbis-gene-158"; gbkey "Gene"; gene "aldB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00960"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 183066 184604 . + . gene_id "nbis-gene-158"; transcript_id "gene-C7A06_RS00960"; Dbxref "Genbank:WP_000183978.1"; ID "nbis-exon-167"; Name "WP_000183978.1"; Parent "gene-C7A06_RS00960"; gbkey "CDS"; gene "aldB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001551836.1"; locus_tag "C7A06_RS00960"; product "aldehyde dehydrogenase AldB"; protein_id "WP_000183978.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 183066 184604 . + 0 gene_id "nbis-gene-158"; transcript_id "gene-C7A06_RS00960"; Dbxref "Genbank:WP_000183978.1"; ID "cds-WP_000183978.1"; Name "WP_000183978.1"; Parent "gene-C7A06_RS00960"; gbkey "CDS"; gene "aldB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001551836.1"; locus_tag "C7A06_RS00960"; product "aldehyde dehydrogenase AldB"; protein_id "WP_000183978.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 184823 184987 . - . gene_id "nbis-gene-159"; ID "nbis-gene-159"; Name "C7A06_RS00965"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00965";
+NZ_CP027599.1 RefSeq transcript 184823 184987 . - . gene_id "nbis-gene-159"; transcript_id "gene-C7A06_RS00965"; ID "gene-C7A06_RS00965"; Name "C7A06_RS00965"; Parent "nbis-gene-159"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00965"; original_biotype "mrna";
+NZ_CP027599.1 GeneMarkS-2+ exon 184823 184987 . - . gene_id "nbis-gene-159"; transcript_id "gene-C7A06_RS00965"; Dbxref "Genbank:WP_001375509.1"; ID "nbis-exon-168"; Name "WP_001375509.1"; Parent "gene-C7A06_RS00965"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS00965"; product "hypothetical protein"; protein_id "WP_001375509.1"; transl_table "11";
+NZ_CP027599.1 GeneMarkS-2+ CDS 184823 184987 . - 0 gene_id "nbis-gene-159"; transcript_id "gene-C7A06_RS00965"; Dbxref "Genbank:WP_001375509.1"; ID "cds-WP_001375509.1"; Name "WP_001375509.1"; Parent "gene-C7A06_RS00965"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS00965"; product "hypothetical protein"; protein_id "WP_001375509.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 185169 185471 . + . gene_id "nbis-gene-160"; ID "nbis-gene-160"; Name "yiaW"; gbkey "Gene"; gene "yiaW"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00975";
+NZ_CP027599.1 RefSeq transcript 185169 185471 . + . gene_id "nbis-gene-160"; transcript_id "gene-C7A06_RS00975"; ID "gene-C7A06_RS00975"; Name "yiaW"; Parent "nbis-gene-160"; gbkey "Gene"; gene "yiaW"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00975"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 185169 185471 . + . gene_id "nbis-gene-160"; transcript_id "gene-C7A06_RS00975"; Dbxref "Genbank:WP_032348558.1"; ID "nbis-exon-169"; Name "WP_032348558.1"; Parent "gene-C7A06_RS00975"; gbkey "CDS"; gene "yiaW"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312490.1"; locus_tag "C7A06_RS00975"; product "DUF3302 domain-containing protein"; protein_id "WP_032348558.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 185169 185471 . + 0 gene_id "nbis-gene-160"; transcript_id "gene-C7A06_RS00975"; Dbxref "Genbank:WP_032348558.1"; ID "cds-WP_032348558.1"; Name "WP_032348558.1"; Parent "gene-C7A06_RS00975"; gbkey "CDS"; gene "yiaW"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312490.1"; locus_tag "C7A06_RS00975"; product "DUF3302 domain-containing protein"; protein_id "WP_032348558.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 185477 186613 . + . gene_id "nbis-gene-161"; ID "nbis-gene-161"; Name "yiaV"; gbkey "Gene"; gene "yiaV"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00980";
+NZ_CP027599.1 RefSeq transcript 185477 186613 . + . gene_id "nbis-gene-161"; transcript_id "gene-C7A06_RS00980"; ID "gene-C7A06_RS00980"; Name "yiaV"; Parent "nbis-gene-161"; gbkey "Gene"; gene "yiaV"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00980"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 185477 186613 . + . gene_id "nbis-gene-161"; transcript_id "gene-C7A06_RS00980"; Dbxref "Genbank:WP_000364874.1"; ID "nbis-exon-170"; Name "WP_000364874.1"; Parent "gene-C7A06_RS00980"; gbkey "CDS"; gene "yiaV"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418043.1"; locus_tag "C7A06_RS00980"; product "HlyD family secretion protein"; protein_id "WP_000364874.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 185477 186613 . + 0 gene_id "nbis-gene-161"; transcript_id "gene-C7A06_RS00980"; Dbxref "Genbank:WP_000364874.1"; ID "cds-WP_000364874.1"; Name "WP_000364874.1"; Parent "gene-C7A06_RS00980"; gbkey "CDS"; gene "yiaV"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418043.1"; locus_tag "C7A06_RS00980"; product "HlyD family secretion protein"; protein_id "WP_000364874.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 186610 187584 . - . gene_id "nbis-gene-162"; ID "nbis-gene-162"; Name "yiaU"; gbkey "Gene"; gene "yiaU"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00985";
+NZ_CP027599.1 RefSeq transcript 186610 187584 . - . gene_id "nbis-gene-162"; transcript_id "gene-C7A06_RS00985"; ID "gene-C7A06_RS00985"; Name "yiaU"; Parent "nbis-gene-162"; gbkey "Gene"; gene "yiaU"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00985"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 186610 187584 . - . gene_id "nbis-gene-162"; transcript_id "gene-C7A06_RS00985"; Dbxref "Genbank:WP_000164036.1"; ID "nbis-exon-171"; Name "WP_000164036.1"; Parent "gene-C7A06_RS00985"; gbkey "CDS"; gene "yiaU"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418042.1"; locus_tag "C7A06_RS00985"; product "LysR family transcriptional regulator"; protein_id "WP_000164036.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 186610 187584 . - 0 gene_id "nbis-gene-162"; transcript_id "gene-C7A06_RS00985"; Dbxref "Genbank:WP_000164036.1"; ID "cds-WP_000164036.1"; Name "WP_000164036.1"; Parent "gene-C7A06_RS00985"; gbkey "CDS"; gene "yiaU"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418042.1"; locus_tag "C7A06_RS00985"; product "LysR family transcriptional regulator"; protein_id "WP_000164036.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 187708 188448 . + . gene_id "nbis-gene-163"; ID "nbis-gene-163"; Name "yiaT"; gbkey "Gene"; gene "yiaT"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00990";
+NZ_CP027599.1 RefSeq transcript 187708 188448 . + . gene_id "nbis-gene-163"; transcript_id "gene-C7A06_RS00990"; ID "gene-C7A06_RS00990"; Name "yiaT"; Parent "nbis-gene-163"; gbkey "Gene"; gene "yiaT"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00990"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 187708 188448 . + . gene_id "nbis-gene-163"; transcript_id "gene-C7A06_RS00990"; Dbxref "Genbank:WP_000906808.1"; ID "nbis-exon-172"; Name "WP_000906808.1"; Parent "gene-C7A06_RS00990"; gbkey "CDS"; gene "yiaT"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312487.1"; locus_tag "C7A06_RS00990"; product "MipA/OmpV family protein"; protein_id "WP_000906808.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 187708 188448 . + 0 gene_id "nbis-gene-163"; transcript_id "gene-C7A06_RS00990"; Dbxref "Genbank:WP_000906808.1"; ID "cds-WP_000906808.1"; Name "WP_000906808.1"; Parent "gene-C7A06_RS00990"; gbkey "CDS"; gene "yiaT"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312487.1"; locus_tag "C7A06_RS00990"; product "MipA/OmpV family protein"; protein_id "WP_000906808.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 188395 188658 . - . gene_id "nbis-pseudogene-311"; ID "nbis-pseudogene-311"; Name "C7A06_RS34805"; end_range "188658" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34805"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "188395";
+NZ_CP027599.1 RefSeq transcript 188395 188658 . - . gene_id "nbis-pseudogene-311"; transcript_id "gene-C7A06_RS34805"; ID "gene-C7A06_RS34805"; Name "C7A06_RS34805"; Parent "nbis-pseudogene-311"; end_range "188658" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34805"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "188395";
+NZ_CP027599.1 Protein Homology exon 188395 188658 . - . gene_id "nbis-pseudogene-311"; transcript_id "gene-C7A06_RS34805"; ID "nbis-exon-6141"; Note "incomplete; partial in the middle of a contig; missing N-terminus and C-terminus"; Parent "gene-C7A06_RS34805"; end_range "188658" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020239594.1"; locus_tag "C7A06_RS34805"; partial "true"; product "hypothetical protein"; pseudo "true"; start_range "." "188395"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 188395 188658 . - 0 gene_id "nbis-pseudogene-311"; transcript_id "gene-C7A06_RS34805"; ID "cds-C7A06_RS34805"; Note "incomplete; partial in the middle of a contig; missing N-terminus and C-terminus"; Parent "gene-C7A06_RS34805"; end_range "188658" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020239594.1"; locus_tag "C7A06_RS34805"; partial "true"; product "hypothetical protein"; pseudo "true"; start_range "." "188395"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 188662 188763 . + . gene_id "nbis-pseudogene-290"; ID "nbis-pseudogene-290"; Name "C7A06_RS34380"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34380"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "188662";
+NZ_CP027599.1 RefSeq transcript 188662 188763 . + . gene_id "nbis-pseudogene-290"; transcript_id "gene-C7A06_RS34380"; ID "gene-C7A06_RS34380"; Name "C7A06_RS34380"; Parent "nbis-pseudogene-290"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34380"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "188662";
+NZ_CP027599.1 Protein Homology exon 188662 188763 . + . gene_id "nbis-pseudogene-290"; transcript_id "gene-C7A06_RS34380"; ID "nbis-exon-6063"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS34380"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312484.1"; locus_tag "C7A06_RS34380"; partial "true"; product "AraC family transcriptional regulator"; pseudo "true"; start_range "." "188662"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 188662 188763 . + 0 gene_id "nbis-pseudogene-290"; transcript_id "gene-C7A06_RS34380"; ID "cds-C7A06_RS34380"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS34380"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312484.1"; locus_tag "C7A06_RS34380"; partial "true"; product "AraC family transcriptional regulator"; pseudo "true"; start_range "." "188662"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 188795 189490 . - . gene_id "nbis-gene-164"; ID "nbis-gene-164"; Name "araD"; gbkey "Gene"; gene "araD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01000";
+NZ_CP027599.1 RefSeq transcript 188795 189490 . - . gene_id "nbis-gene-164"; transcript_id "gene-C7A06_RS01000"; ID "gene-C7A06_RS01000"; Name "araD"; Parent "nbis-gene-164"; gbkey "Gene"; gene "araD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01000"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 188795 189490 . - . gene_id "nbis-gene-164"; transcript_id "gene-C7A06_RS01000"; Dbxref "Genbank:WP_000893142.1"; ID "nbis-exon-173"; Name "WP_000893142.1"; Ontology_term "GO:0019568" "GO:0008742"; Parent "gene-C7A06_RS01000"; gbkey "CDS"; gene "araD"; go_function "L-ribulose-phosphate 4-epimerase activity|0008742||IEA"; go_process "arabinose catabolic process|0019568||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418040.1"; locus_tag "C7A06_RS01000"; product "L-ribulose-5-phosphate 4-epimerase"; protein_id "WP_000893142.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 188795 189490 . - 0 gene_id "nbis-gene-164"; transcript_id "gene-C7A06_RS01000"; Dbxref "Genbank:WP_000893142.1"; ID "cds-WP_000893142.1"; Name "WP_000893142.1"; Ontology_term "GO:0019568" "GO:0008742"; Parent "gene-C7A06_RS01000"; gbkey "CDS"; gene "araD"; go_function "L-ribulose-phosphate 4-epimerase activity|0008742||IEA"; go_process "arabinose catabolic process|0019568||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418040.1"; locus_tag "C7A06_RS01000"; product "L-ribulose-5-phosphate 4-epimerase"; protein_id "WP_000893142.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 189484 190344 . - . gene_id "nbis-gene-165"; ID "nbis-gene-165"; Name "sgbU"; gbkey "Gene"; gene "sgbU"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01005";
+NZ_CP027599.1 RefSeq transcript 189484 190344 . - . gene_id "nbis-gene-165"; transcript_id "gene-C7A06_RS01005"; ID "gene-C7A06_RS01005"; Name "sgbU"; Parent "nbis-gene-165"; gbkey "Gene"; gene "sgbU"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01005"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 189484 190344 . - . gene_id "nbis-gene-165"; transcript_id "gene-C7A06_RS01005"; Dbxref "Genbank:WP_001296811.1"; ID "nbis-exon-174"; Name "WP_001296811.1"; Parent "gene-C7A06_RS01005"; gbkey "CDS"; gene "sgbU"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418039.2"; locus_tag "C7A06_RS01005"; product "L-ribulose-5-phosphate 3-epimerase"; protein_id "WP_001296811.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 189484 190344 . - 0 gene_id "nbis-gene-165"; transcript_id "gene-C7A06_RS01005"; Dbxref "Genbank:WP_001296811.1"; ID "cds-WP_001296811.1"; Name "WP_001296811.1"; Parent "gene-C7A06_RS01005"; gbkey "CDS"; gene "sgbU"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418039.2"; locus_tag "C7A06_RS01005"; product "L-ribulose-5-phosphate 3-epimerase"; protein_id "WP_001296811.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 190337 190999 . - . gene_id "nbis-gene-166"; ID "nbis-gene-166"; Name "ulaD"; gbkey "Gene"; gene "ulaD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01010";
+NZ_CP027599.1 RefSeq transcript 190337 190999 . - . gene_id "nbis-gene-166"; transcript_id "gene-C7A06_RS01010"; ID "gene-C7A06_RS01010"; Name "ulaD"; Parent "nbis-gene-166"; gbkey "Gene"; gene "ulaD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01010"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 190337 190999 . - . gene_id "nbis-gene-166"; transcript_id "gene-C7A06_RS01010"; Dbxref "Genbank:WP_000089497.1"; ID "nbis-exon-175"; Name "WP_000089497.1"; Parent "gene-C7A06_RS01010"; gbkey "CDS"; gene "ulaD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418038.1"; locus_tag "C7A06_RS01010"; product "3-keto-L-gulonate-6-phosphate decarboxylase UlaD"; protein_id "WP_000089497.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 190337 190999 . - 0 gene_id "nbis-gene-166"; transcript_id "gene-C7A06_RS01010"; Dbxref "Genbank:WP_000089497.1"; ID "cds-WP_000089497.1"; Name "WP_000089497.1"; Parent "gene-C7A06_RS01010"; gbkey "CDS"; gene "ulaD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418038.1"; locus_tag "C7A06_RS01010"; product "3-keto-L-gulonate-6-phosphate decarboxylase UlaD"; protein_id "WP_000089497.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 190996 192492 . - . gene_id "nbis-gene-167"; ID "nbis-gene-167"; Name "lyxK"; gbkey "Gene"; gene "lyxK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01015";
+NZ_CP027599.1 RefSeq transcript 190996 192492 . - . gene_id "nbis-gene-167"; transcript_id "gene-C7A06_RS01015"; ID "gene-C7A06_RS01015"; Name "lyxK"; Parent "nbis-gene-167"; gbkey "Gene"; gene "lyxK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01015"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 190996 192492 . - . gene_id "nbis-gene-167"; transcript_id "gene-C7A06_RS01015"; Dbxref "Genbank:WP_000196086.1"; ID "nbis-exon-176"; Name "WP_000196086.1"; Parent "gene-C7A06_RS01015"; gbkey "CDS"; gene "lyxK"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418037.1"; locus_tag "C7A06_RS01015"; product "L-xylulokinase"; protein_id "WP_000196086.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 190996 192492 . - 0 gene_id "nbis-gene-167"; transcript_id "gene-C7A06_RS01015"; Dbxref "Genbank:WP_000196086.1"; ID "cds-WP_000196086.1"; Name "WP_000196086.1"; Parent "gene-C7A06_RS01015"; gbkey "CDS"; gene "lyxK"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418037.1"; locus_tag "C7A06_RS01015"; product "L-xylulokinase"; protein_id "WP_000196086.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 192496 193482 . - . gene_id "nbis-gene-168"; ID "nbis-gene-168"; Name "yiaO"; gbkey "Gene"; gene "yiaO"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01020";
+NZ_CP027599.1 RefSeq transcript 192496 193482 . - . gene_id "nbis-gene-168"; transcript_id "gene-C7A06_RS01020"; ID "gene-C7A06_RS01020"; Name "yiaO"; Parent "nbis-gene-168"; gbkey "Gene"; gene "yiaO"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01020"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 192496 193482 . - . gene_id "nbis-gene-168"; transcript_id "gene-C7A06_RS01020"; Dbxref "Genbank:WP_000776892.1"; ID "nbis-exon-177"; Name "WP_000776892.1"; Parent "gene-C7A06_RS01020"; gbkey "CDS"; gene "yiaO"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418036.1"; locus_tag "C7A06_RS01020"; product "2,3-diketo-L-gulonate transporter substrate-binding protein YiaO"; protein_id "WP_000776892.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 192496 193482 . - 0 gene_id "nbis-gene-168"; transcript_id "gene-C7A06_RS01020"; Dbxref "Genbank:WP_000776892.1"; ID "cds-WP_000776892.1"; Name "WP_000776892.1"; Parent "gene-C7A06_RS01020"; gbkey "CDS"; gene "yiaO"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418036.1"; locus_tag "C7A06_RS01020"; product "2,3-diketo-L-gulonate transporter substrate-binding protein YiaO"; protein_id "WP_000776892.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 193495 194772 . - . gene_id "nbis-gene-169"; ID "nbis-gene-169"; Name "yiaN"; gbkey "Gene"; gene "yiaN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01025";
+NZ_CP027599.1 RefSeq transcript 193495 194772 . - . gene_id "nbis-gene-169"; transcript_id "gene-C7A06_RS01025"; ID "gene-C7A06_RS01025"; Name "yiaN"; Parent "nbis-gene-169"; gbkey "Gene"; gene "yiaN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01025"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 193495 194772 . - . gene_id "nbis-gene-169"; transcript_id "gene-C7A06_RS01025"; Dbxref "Genbank:WP_000279599.1"; ID "nbis-exon-178"; Name "WP_000279599.1"; Parent "gene-C7A06_RS01025"; gbkey "CDS"; gene "yiaN"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026232.1"; locus_tag "C7A06_RS01025"; product "2,3-diketo-L-gulonate transporter large permease YiaN"; protein_id "WP_000279599.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 193495 194772 . - 0 gene_id "nbis-gene-169"; transcript_id "gene-C7A06_RS01025"; Dbxref "Genbank:WP_000279599.1"; ID "cds-WP_000279599.1"; Name "WP_000279599.1"; Parent "gene-C7A06_RS01025"; gbkey "CDS"; gene "yiaN"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026232.1"; locus_tag "C7A06_RS01025"; product "2,3-diketo-L-gulonate transporter large permease YiaN"; protein_id "WP_000279599.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 194775 195248 . - . gene_id "nbis-gene-170"; ID "nbis-gene-170"; Name "yiaM"; gbkey "Gene"; gene "yiaM"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01030";
+NZ_CP027599.1 RefSeq transcript 194775 195248 . - . gene_id "nbis-gene-170"; transcript_id "gene-C7A06_RS01030"; ID "gene-C7A06_RS01030"; Name "yiaM"; Parent "nbis-gene-170"; gbkey "Gene"; gene "yiaM"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01030"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 194775 195248 . - . gene_id "nbis-gene-170"; transcript_id "gene-C7A06_RS01030"; Dbxref "Genbank:WP_000721664.1"; ID "nbis-exon-179"; Name "WP_000721664.1"; Parent "gene-C7A06_RS01030"; gbkey "CDS"; gene "yiaM"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418034.1"; locus_tag "C7A06_RS01030"; product "2,3-diketo-L-gulonate TRAP transporter small permease YiaM"; protein_id "WP_000721664.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 194775 195248 . - 0 gene_id "nbis-gene-170"; transcript_id "gene-C7A06_RS01030"; Dbxref "Genbank:WP_000721664.1"; ID "cds-WP_000721664.1"; Name "WP_000721664.1"; Parent "gene-C7A06_RS01030"; gbkey "CDS"; gene "yiaM"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418034.1"; locus_tag "C7A06_RS01030"; product "2,3-diketo-L-gulonate TRAP transporter small permease YiaM"; protein_id "WP_000721664.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 195366 195833 . - . gene_id "nbis-gene-171"; ID "nbis-gene-171"; Name "yiaL"; gbkey "Gene"; gene "yiaL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01035";
+NZ_CP027599.1 RefSeq transcript 195366 195833 . - . gene_id "nbis-gene-171"; transcript_id "gene-C7A06_RS01035"; ID "gene-C7A06_RS01035"; Name "yiaL"; Parent "nbis-gene-171"; gbkey "Gene"; gene "yiaL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01035"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 195366 195833 . - . gene_id "nbis-gene-171"; transcript_id "gene-C7A06_RS01035"; Dbxref "Genbank:WP_000576071.1"; ID "nbis-exon-180"; Name "WP_000576071.1"; Parent "gene-C7A06_RS01035"; gbkey "CDS"; gene "yiaL"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418033.1"; locus_tag "C7A06_RS01035"; product "YhcH/YjgK/YiaL family protein"; protein_id "WP_000576071.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 195366 195833 . - 0 gene_id "nbis-gene-171"; transcript_id "gene-C7A06_RS01035"; Dbxref "Genbank:WP_000576071.1"; ID "cds-WP_000576071.1"; Name "WP_000576071.1"; Parent "gene-C7A06_RS01035"; gbkey "CDS"; gene "yiaL"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418033.1"; locus_tag "C7A06_RS01035"; product "YhcH/YjgK/YiaL family protein"; protein_id "WP_000576071.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 195845 196843 . - . gene_id "nbis-gene-172"; ID "nbis-gene-172"; Name "yiaK"; gbkey "Gene"; gene "yiaK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01040";
+NZ_CP027599.1 RefSeq transcript 195845 196843 . - . gene_id "nbis-gene-172"; transcript_id "gene-C7A06_RS01040"; ID "gene-C7A06_RS01040"; Name "yiaK"; Parent "nbis-gene-172"; gbkey "Gene"; gene "yiaK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01040"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 195845 196843 . - . gene_id "nbis-gene-172"; transcript_id "gene-C7A06_RS01040"; Dbxref "Genbank:WP_000869039.1"; ID "nbis-exon-181"; Name "WP_000869039.1"; Ontology_term "GO:0047559" "GO:0070403"; Parent "gene-C7A06_RS01040"; gbkey "CDS"; gene "yiaK"; go_function "3-dehydro-L-gulonate 2-dehydrogenase activity|0047559||IEA" "NAD+ binding|0070403||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709360.1"; locus_tag "C7A06_RS01040"; product "3-dehydro-L-gulonate 2-dehydrogenase"; protein_id "WP_000869039.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 195845 196843 . - 0 gene_id "nbis-gene-172"; transcript_id "gene-C7A06_RS01040"; Dbxref "Genbank:WP_000869039.1"; ID "cds-WP_000869039.1"; Name "WP_000869039.1"; Ontology_term "GO:0047559" "GO:0070403"; Parent "gene-C7A06_RS01040"; gbkey "CDS"; gene "yiaK"; go_function "3-dehydro-L-gulonate 2-dehydrogenase activity|0047559||IEA" "NAD+ binding|0070403||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709360.1"; locus_tag "C7A06_RS01040"; product "3-dehydro-L-gulonate 2-dehydrogenase"; protein_id "WP_000869039.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 197044 197892 . + . gene_id "nbis-gene-173"; ID "nbis-gene-173"; Name "yiaJ"; gbkey "Gene"; gene "yiaJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01045";
+NZ_CP027599.1 RefSeq transcript 197044 197892 . + . gene_id "nbis-gene-173"; transcript_id "gene-C7A06_RS01045"; ID "gene-C7A06_RS01045"; Name "yiaJ"; Parent "nbis-gene-173"; gbkey "Gene"; gene "yiaJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01045"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 197044 197892 . + . gene_id "nbis-gene-173"; transcript_id "gene-C7A06_RS01045"; Dbxref "Genbank:WP_000514230.1"; ID "nbis-exon-182"; Name "WP_000514230.1"; Parent "gene-C7A06_RS01045"; gbkey "CDS"; gene "yiaJ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418031.1"; locus_tag "C7A06_RS01045"; product "IclR family transcriptional regulator YiaJ"; protein_id "WP_000514230.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 197044 197892 . + 0 gene_id "nbis-gene-173"; transcript_id "gene-C7A06_RS01045"; Dbxref "Genbank:WP_000514230.1"; ID "cds-WP_000514230.1"; Name "WP_000514230.1"; Parent "gene-C7A06_RS01045"; gbkey "CDS"; gene "yiaJ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418031.1"; locus_tag "C7A06_RS01045"; product "IclR family transcriptional regulator YiaJ"; protein_id "WP_000514230.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 197994 198467 . + . gene_id "nbis-gene-174"; ID "nbis-gene-174"; Name "ysaA"; gbkey "Gene"; gene "ysaA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01050";
+NZ_CP027599.1 RefSeq transcript 197994 198467 . + . gene_id "nbis-gene-174"; transcript_id "gene-C7A06_RS01050"; ID "gene-C7A06_RS01050"; Name "ysaA"; Parent "nbis-gene-174"; gbkey "Gene"; gene "ysaA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01050"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 197994 198467 . + . gene_id "nbis-gene-174"; transcript_id "gene-C7A06_RS01050"; Dbxref "Genbank:WP_001296790.1"; ID "nbis-exon-183"; Name "WP_001296790.1"; Parent "gene-C7A06_RS01050"; gbkey "CDS"; gene "ysaA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312483.1"; locus_tag "C7A06_RS01050"; product "4Fe-4S binding protein"; protein_id "WP_001296790.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 197994 198467 . + 0 gene_id "nbis-gene-174"; transcript_id "gene-C7A06_RS01050"; Dbxref "Genbank:WP_001296790.1"; ID "cds-WP_001296790.1"; Name "WP_001296790.1"; Parent "gene-C7A06_RS01050"; gbkey "CDS"; gene "ysaA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312483.1"; locus_tag "C7A06_RS01050"; product "4Fe-4S binding protein"; protein_id "WP_001296790.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 198619 199872 . - . gene_id "nbis-gene-175"; ID "nbis-gene-175"; Name "avtA"; gbkey "Gene"; gene "avtA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01055";
+NZ_CP027599.1 RefSeq transcript 198619 199872 . - . gene_id "nbis-gene-175"; transcript_id "gene-C7A06_RS01055"; ID "gene-C7A06_RS01055"; Name "avtA"; Parent "nbis-gene-175"; gbkey "Gene"; gene "avtA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01055"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 198619 199872 . - . gene_id "nbis-gene-175"; transcript_id "gene-C7A06_RS01055"; Dbxref "Genbank:WP_000144361.1"; ID "nbis-exon-184"; Name "WP_000144361.1"; Parent "gene-C7A06_RS01055"; gbkey "CDS"; gene "avtA"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026231.1"; locus_tag "C7A06_RS01055"; product "valine--pyruvate transaminase"; protein_id "WP_000144361.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 198619 199872 . - 0 gene_id "nbis-gene-175"; transcript_id "gene-C7A06_RS01055"; Dbxref "Genbank:WP_000144361.1"; ID "cds-WP_000144361.1"; Name "WP_000144361.1"; Parent "gene-C7A06_RS01055"; gbkey "CDS"; gene "avtA"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026231.1"; locus_tag "C7A06_RS01055"; product "valine--pyruvate transaminase"; protein_id "WP_000144361.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 200050 202080 . - . gene_id "nbis-gene-176"; ID "nbis-gene-176"; Name "malS"; gbkey "Gene"; gene "malS"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01060";
+NZ_CP027599.1 RefSeq transcript 200050 202080 . - . gene_id "nbis-gene-176"; transcript_id "gene-C7A06_RS01060"; ID "gene-C7A06_RS01060"; Name "malS"; Parent "nbis-gene-176"; gbkey "Gene"; gene "malS"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01060"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 200050 202080 . - . gene_id "nbis-gene-176"; transcript_id "gene-C7A06_RS01060"; Dbxref "Genbank:WP_000761204.1"; ID "nbis-exon-185"; Name "WP_000761204.1"; Ontology_term "GO:0004556"; Parent "gene-C7A06_RS01060"; gbkey "CDS"; gene "malS"; go_function "alpha-amylase activity|0004556||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312481.1"; locus_tag "C7A06_RS01060"; product "alpha-amylase"; protein_id "WP_000761204.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 200050 202080 . - 0 gene_id "nbis-gene-176"; transcript_id "gene-C7A06_RS01060"; Dbxref "Genbank:WP_000761204.1"; ID "cds-WP_000761204.1"; Name "WP_000761204.1"; Ontology_term "GO:0004556"; Parent "gene-C7A06_RS01060"; gbkey "CDS"; gene "malS"; go_function "alpha-amylase activity|0004556||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312481.1"; locus_tag "C7A06_RS01060"; product "alpha-amylase"; protein_id "WP_000761204.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 202400 203224 . + . gene_id "nbis-gene-177"; ID "nbis-gene-177"; Name "bax"; gbkey "Gene"; gene "bax"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01065";
+NZ_CP027599.1 RefSeq transcript 202400 203224 . + . gene_id "nbis-gene-177"; transcript_id "gene-C7A06_RS01065"; ID "gene-C7A06_RS01065"; Name "bax"; Parent "nbis-gene-177"; gbkey "Gene"; gene "bax"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01065"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 202400 203224 . + . gene_id "nbis-gene-177"; transcript_id "gene-C7A06_RS01065"; Dbxref "Genbank:WP_001296804.1"; ID "nbis-exon-186"; Name "WP_001296804.1"; Parent "gene-C7A06_RS01065"; gbkey "CDS"; gene "bax"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026230.1"; locus_tag "C7A06_RS01065"; product "protein bax"; protein_id "WP_001296804.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 202400 203224 . + 0 gene_id "nbis-gene-177"; transcript_id "gene-C7A06_RS01065"; Dbxref "Genbank:WP_001296804.1"; ID "cds-WP_001296804.1"; Name "WP_001296804.1"; Parent "gene-C7A06_RS01065"; gbkey "CDS"; gene "bax"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026230.1"; locus_tag "C7A06_RS01065"; product "protein bax"; protein_id "WP_001296804.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 203332 204510 . - . gene_id "nbis-gene-178"; ID "nbis-gene-178"; Name "xylR"; gbkey "Gene"; gene "xylR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01070";
+NZ_CP027599.1 RefSeq transcript 203332 204510 . - . gene_id "nbis-gene-178"; transcript_id "gene-C7A06_RS01070"; ID "gene-C7A06_RS01070"; Name "xylR"; Parent "nbis-gene-178"; gbkey "Gene"; gene "xylR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01070"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 203332 204510 . - . gene_id "nbis-gene-178"; transcript_id "gene-C7A06_RS01070"; Dbxref "Genbank:WP_000494484.1"; ID "nbis-exon-187"; Name "WP_000494484.1"; Parent "gene-C7A06_RS01070"; gbkey "CDS"; gene "xylR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312479.1"; locus_tag "C7A06_RS01070"; product "DNA-binding transcriptional regulator XylR"; protein_id "WP_000494484.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 203332 204510 . - 0 gene_id "nbis-gene-178"; transcript_id "gene-C7A06_RS01070"; Dbxref "Genbank:WP_000494484.1"; ID "cds-WP_000494484.1"; Name "WP_000494484.1"; Parent "gene-C7A06_RS01070"; gbkey "CDS"; gene "xylR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312479.1"; locus_tag "C7A06_RS01070"; product "DNA-binding transcriptional regulator XylR"; protein_id "WP_000494484.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 204588 205769 . - . gene_id "nbis-gene-179"; ID "nbis-gene-179"; Name "xylH"; gbkey "Gene"; gene "xylH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01075";
+NZ_CP027599.1 RefSeq transcript 204588 205769 . - . gene_id "nbis-gene-179"; transcript_id "gene-C7A06_RS01075"; ID "gene-C7A06_RS01075"; Name "xylH"; Parent "nbis-gene-179"; gbkey "Gene"; gene "xylH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01075"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 204588 205769 . - . gene_id "nbis-gene-179"; transcript_id "gene-C7A06_RS01075"; Dbxref "Genbank:WP_000045978.1"; ID "nbis-exon-188"; Name "WP_000045978.1"; Parent "gene-C7A06_RS01075"; gbkey "CDS"; gene "xylH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312478.1"; locus_tag "C7A06_RS01075"; product "xylose ABC transporter permease XylH"; protein_id "WP_000045978.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 204588 205769 . - 0 gene_id "nbis-gene-179"; transcript_id "gene-C7A06_RS01075"; Dbxref "Genbank:WP_000045978.1"; ID "cds-WP_000045978.1"; Name "WP_000045978.1"; Parent "gene-C7A06_RS01075"; gbkey "CDS"; gene "xylH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312478.1"; locus_tag "C7A06_RS01075"; product "xylose ABC transporter permease XylH"; protein_id "WP_000045978.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 205747 207288 . - . gene_id "nbis-gene-180"; ID "nbis-gene-180"; Name "xylG"; gbkey "Gene"; gene "xylG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01080";
+NZ_CP027599.1 RefSeq transcript 205747 207288 . - . gene_id "nbis-gene-180"; transcript_id "gene-C7A06_RS01080"; ID "gene-C7A06_RS01080"; Name "xylG"; Parent "nbis-gene-180"; gbkey "Gene"; gene "xylG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01080"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 205747 207288 . - . gene_id "nbis-gene-180"; transcript_id "gene-C7A06_RS01080"; Dbxref "Genbank:WP_001146482.1"; ID "nbis-exon-189"; Name "WP_001146482.1"; Ontology_term "GO:0015753" "GO:0005524" "GO:0015614" "GO:0009898" "GO:0055052"; Parent "gene-C7A06_RS01080"; gbkey "CDS"; gene "xylG"; go_component "cytoplasmic side of plasma membrane|0009898||IEA" "ATP-binding cassette (ABC) transporter complex, substrate-binding subunit-containing|0055052||IEA"; go_function "ATP binding|0005524||IEA" "ABC-type D-xylose transporter activity|0015614||IEA"; go_process "D-xylose transmembrane transport|0015753||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312477.1"; locus_tag "C7A06_RS01080"; product "D-xylose ABC transporter ATP-binding protein"; protein_id "WP_001146482.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 205747 207288 . - 0 gene_id "nbis-gene-180"; transcript_id "gene-C7A06_RS01080"; Dbxref "Genbank:WP_001146482.1"; ID "cds-WP_001146482.1"; Name "WP_001146482.1"; Ontology_term "GO:0015753" "GO:0005524" "GO:0015614" "GO:0009898" "GO:0055052"; Parent "gene-C7A06_RS01080"; gbkey "CDS"; gene "xylG"; go_component "cytoplasmic side of plasma membrane|0009898||IEA" "ATP-binding cassette (ABC) transporter complex, substrate-binding subunit-containing|0055052||IEA"; go_function "ATP binding|0005524||IEA" "ABC-type D-xylose transporter activity|0015614||IEA"; go_process "D-xylose transmembrane transport|0015753||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312477.1"; locus_tag "C7A06_RS01080"; product "D-xylose ABC transporter ATP-binding protein"; protein_id "WP_001146482.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 207366 208358 . - . gene_id "nbis-gene-181"; ID "nbis-gene-181"; Name "xylF"; gbkey "Gene"; gene "xylF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01085";
+NZ_CP027599.1 RefSeq transcript 207366 208358 . - . gene_id "nbis-gene-181"; transcript_id "gene-C7A06_RS01085"; ID "gene-C7A06_RS01085"; Name "xylF"; Parent "nbis-gene-181"; gbkey "Gene"; gene "xylF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01085"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 207366 208358 . - . gene_id "nbis-gene-181"; transcript_id "gene-C7A06_RS01085"; Dbxref "Genbank:WP_001296518.1"; ID "nbis-exon-190"; Name "WP_001296518.1"; Ontology_term "GO:0015753"; Parent "gene-C7A06_RS01085"; gbkey "CDS"; gene "xylF"; go_process "D-xylose transmembrane transport|0015753||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418023.1"; locus_tag "C7A06_RS01085"; product "D-xylose ABC transporter substrate-binding protein"; protein_id "WP_001296518.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 207366 208358 . - 0 gene_id "nbis-gene-181"; transcript_id "gene-C7A06_RS01085"; Dbxref "Genbank:WP_001296518.1"; ID "cds-WP_001296518.1"; Name "WP_001296518.1"; Ontology_term "GO:0015753"; Parent "gene-C7A06_RS01085"; gbkey "CDS"; gene "xylF"; go_process "D-xylose transmembrane transport|0015753||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418023.1"; locus_tag "C7A06_RS01085"; product "D-xylose ABC transporter substrate-binding protein"; protein_id "WP_001296518.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 208724 210046 . + . gene_id "nbis-gene-182"; ID "nbis-gene-182"; Name "xylA"; gbkey "Gene"; gene "xylA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01090";
+NZ_CP027599.1 RefSeq transcript 208724 210046 . + . gene_id "nbis-gene-182"; transcript_id "gene-C7A06_RS01090"; ID "gene-C7A06_RS01090"; Name "xylA"; Parent "nbis-gene-182"; gbkey "Gene"; gene "xylA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01090"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 208724 210046 . + . gene_id "nbis-gene-182"; transcript_id "gene-C7A06_RS01090"; Dbxref "Genbank:WP_001149582.1"; ID "nbis-exon-191"; Name "WP_001149582.1"; Ontology_term "GO:0006098" "GO:0042732" "GO:0000287" "GO:0009045"; Parent "gene-C7A06_RS01090"; gbkey "CDS"; gene "xylA"; go_function "magnesium ion binding|0000287||IEA" "xylose isomerase activity|0009045||IEA"; go_process "pentose-phosphate shunt|0006098||IEA" "D-xylose metabolic process|0042732||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312475.1"; locus_tag "C7A06_RS01090"; product "xylose isomerase"; protein_id "WP_001149582.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 208724 210046 . + 0 gene_id "nbis-gene-182"; transcript_id "gene-C7A06_RS01090"; Dbxref "Genbank:WP_001149582.1"; ID "cds-WP_001149582.1"; Name "WP_001149582.1"; Ontology_term "GO:0006098" "GO:0042732" "GO:0000287" "GO:0009045"; Parent "gene-C7A06_RS01090"; gbkey "CDS"; gene "xylA"; go_function "magnesium ion binding|0000287||IEA" "xylose isomerase activity|0009045||IEA"; go_process "pentose-phosphate shunt|0006098||IEA" "D-xylose metabolic process|0042732||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312475.1"; locus_tag "C7A06_RS01090"; product "xylose isomerase"; protein_id "WP_001149582.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 210118 211572 . + . gene_id "nbis-gene-183"; ID "nbis-gene-183"; Name "xylB"; gbkey "Gene"; gene "xylB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01095";
+NZ_CP027599.1 RefSeq transcript 210118 211572 . + . gene_id "nbis-gene-183"; transcript_id "gene-C7A06_RS01095"; ID "gene-C7A06_RS01095"; Name "xylB"; Parent "nbis-gene-183"; gbkey "Gene"; gene "xylB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01095"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 210118 211572 . + . gene_id "nbis-gene-183"; transcript_id "gene-C7A06_RS01095"; Dbxref "Genbank:WP_000275386.1"; ID "nbis-exon-192"; Name "WP_000275386.1"; Ontology_term "GO:0005997" "GO:0004856"; Parent "gene-C7A06_RS01095"; gbkey "CDS"; gene "xylB"; go_function "xylulokinase activity|0004856||IEA"; go_process "xylulose metabolic process|0005997||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709351.1"; locus_tag "C7A06_RS01095"; product "xylulokinase"; protein_id "WP_000275386.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 210118 211572 . + 0 gene_id "nbis-gene-183"; transcript_id "gene-C7A06_RS01095"; Dbxref "Genbank:WP_000275386.1"; ID "cds-WP_000275386.1"; Name "WP_000275386.1"; Ontology_term "GO:0005997" "GO:0004856"; Parent "gene-C7A06_RS01095"; gbkey "CDS"; gene "xylB"; go_function "xylulokinase activity|0004856||IEA"; go_process "xylulose metabolic process|0005997||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709351.1"; locus_tag "C7A06_RS01095"; product "xylulokinase"; protein_id "WP_000275386.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 211741 212082 . + . gene_id "nbis-gene-184"; ID "nbis-gene-184"; Name "C7A06_RS01100"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01100";
+NZ_CP027599.1 RefSeq transcript 211741 212082 . + . gene_id "nbis-gene-184"; transcript_id "gene-C7A06_RS01100"; ID "gene-C7A06_RS01100"; Name "C7A06_RS01100"; Parent "nbis-gene-184"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01100"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 211741 212082 . + . gene_id "nbis-gene-184"; transcript_id "gene-C7A06_RS01100"; Dbxref "Genbank:WP_000858193.1"; ID "nbis-exon-193"; Name "WP_000858193.1"; Parent "gene-C7A06_RS01100"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709350.2"; locus_tag "C7A06_RS01100"; product "hypothetical protein"; protein_id "WP_000858193.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 211741 212082 . + 0 gene_id "nbis-gene-184"; transcript_id "gene-C7A06_RS01100"; Dbxref "Genbank:WP_000858193.1"; ID "cds-WP_000858193.1"; Name "WP_000858193.1"; Parent "gene-C7A06_RS01100"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709350.2"; locus_tag "C7A06_RS01100"; product "hypothetical protein"; protein_id "WP_000858193.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 212128 212565 . + . gene_id "nbis-gene-185"; ID "nbis-gene-185"; Name "yiaA"; gbkey "Gene"; gene "yiaA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01105";
+NZ_CP027599.1 RefSeq transcript 212128 212565 . + . gene_id "nbis-gene-185"; transcript_id "gene-C7A06_RS01105"; ID "gene-C7A06_RS01105"; Name "yiaA"; Parent "nbis-gene-185"; gbkey "Gene"; gene "yiaA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01105"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 212128 212565 . + . gene_id "nbis-gene-185"; transcript_id "gene-C7A06_RS01105"; Dbxref "Genbank:WP_001298726.1"; ID "nbis-exon-194"; Name "WP_001298726.1"; Parent "gene-C7A06_RS01105"; gbkey "CDS"; gene "yiaA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312472.2"; locus_tag "C7A06_RS01105"; product "YiaB family inner membrane protein"; protein_id "WP_001298726.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 212128 212565 . + 0 gene_id "nbis-gene-185"; transcript_id "gene-C7A06_RS01105"; Dbxref "Genbank:WP_001298726.1"; ID "cds-WP_001298726.1"; Name "WP_001298726.1"; Parent "gene-C7A06_RS01105"; gbkey "CDS"; gene "yiaA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312472.2"; locus_tag "C7A06_RS01105"; product "YiaB family inner membrane protein"; protein_id "WP_001298726.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 212607 213602 . - . gene_id "nbis-gene-186"; ID "nbis-gene-186"; Name "wecH"; gbkey "Gene"; gene "wecH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01110";
+NZ_CP027599.1 RefSeq transcript 212607 213602 . - . gene_id "nbis-gene-186"; transcript_id "gene-C7A06_RS01110"; ID "gene-C7A06_RS01110"; Name "wecH"; Parent "nbis-gene-186"; gbkey "Gene"; gene "wecH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01110"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 212607 213602 . - . gene_id "nbis-gene-186"; transcript_id "gene-C7A06_RS01110"; Dbxref "Genbank:WP_001182671.1"; ID "nbis-exon-195"; Name "WP_001182671.1"; Parent "gene-C7A06_RS01110"; gbkey "CDS"; gene "wecH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709348.1"; locus_tag "C7A06_RS01110"; product "O-acetyltransferase WecH"; protein_id "WP_001182671.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 212607 213602 . - 0 gene_id "nbis-gene-186"; transcript_id "gene-C7A06_RS01110"; Dbxref "Genbank:WP_001182671.1"; ID "cds-WP_001182671.1"; Name "WP_001182671.1"; Parent "gene-C7A06_RS01110"; gbkey "CDS"; gene "wecH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709348.1"; locus_tag "C7A06_RS01110"; product "O-acetyltransferase WecH"; protein_id "WP_001182671.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 213777 214076 . + . gene_id "nbis-gene-187"; ID "nbis-gene-187"; Name "ysaB"; gbkey "Gene"; gene "ysaB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01115";
+NZ_CP027599.1 RefSeq transcript 213777 214076 . + . gene_id "nbis-gene-187"; transcript_id "gene-C7A06_RS01115"; ID "gene-C7A06_RS01115"; Name "ysaB"; Parent "nbis-gene-187"; gbkey "Gene"; gene "ysaB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01115"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 213777 214076 . + . gene_id "nbis-gene-187"; transcript_id "gene-C7A06_RS01115"; Dbxref "Genbank:WP_000980114.1"; ID "nbis-exon-196"; Name "WP_000980114.1"; Parent "gene-C7A06_RS01115"; gbkey "CDS"; gene "ysaB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709347.1"; locus_tag "C7A06_RS01115"; product "YsaB family lipoprotein"; protein_id "WP_000980114.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 213777 214076 . + 0 gene_id "nbis-gene-187"; transcript_id "gene-C7A06_RS01115"; Dbxref "Genbank:WP_000980114.1"; ID "cds-WP_000980114.1"; Name "WP_000980114.1"; Parent "gene-C7A06_RS01115"; gbkey "CDS"; gene "ysaB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709347.1"; locus_tag "C7A06_RS01115"; product "YsaB family lipoprotein"; protein_id "WP_000980114.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 214171 215082 . + . gene_id "nbis-gene-188"; ID "nbis-gene-188"; Name "glyQ"; gbkey "Gene"; gene "glyQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01120";
+NZ_CP027599.1 RefSeq transcript 214171 215082 . + . gene_id "nbis-gene-188"; transcript_id "gene-C7A06_RS01120"; ID "gene-C7A06_RS01120"; Name "glyQ"; Parent "nbis-gene-188"; gbkey "Gene"; gene "glyQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01120"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 214171 215082 . + . gene_id "nbis-gene-188"; transcript_id "gene-C7A06_RS01120"; Dbxref "Genbank:WP_001168544.1"; ID "nbis-exon-197"; Name "WP_001168544.1"; Ontology_term "GO:0006426" "GO:0004820" "GO:0009345"; Parent "gene-C7A06_RS01120"; gbkey "CDS"; gene "glyQ"; go_component "glycine-tRNA ligase complex|0009345||IEA"; go_function "glycine-tRNA ligase activity|0004820||IEA"; go_process "glycyl-tRNA aminoacylation|0006426||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312470.1"; locus_tag "C7A06_RS01120"; product "glycine--tRNA ligase subunit alpha"; protein_id "WP_001168544.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 214171 215082 . + 0 gene_id "nbis-gene-188"; transcript_id "gene-C7A06_RS01120"; Dbxref "Genbank:WP_001168544.1"; ID "cds-WP_001168544.1"; Name "WP_001168544.1"; Ontology_term "GO:0006426" "GO:0004820" "GO:0009345"; Parent "gene-C7A06_RS01120"; gbkey "CDS"; gene "glyQ"; go_component "glycine-tRNA ligase complex|0009345||IEA"; go_function "glycine-tRNA ligase activity|0004820||IEA"; go_process "glycyl-tRNA aminoacylation|0006426||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312470.1"; locus_tag "C7A06_RS01120"; product "glycine--tRNA ligase subunit alpha"; protein_id "WP_001168544.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 215092 217161 . + . gene_id "nbis-gene-189"; ID "nbis-gene-189"; Name "glyS"; gbkey "Gene"; gene "glyS"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01125";
+NZ_CP027599.1 RefSeq transcript 215092 217161 . + . gene_id "nbis-gene-189"; transcript_id "gene-C7A06_RS01125"; ID "gene-C7A06_RS01125"; Name "glyS"; Parent "nbis-gene-189"; gbkey "Gene"; gene "glyS"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01125"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 215092 217161 . + . gene_id "nbis-gene-189"; transcript_id "gene-C7A06_RS01125"; Dbxref "Genbank:WP_001291774.1"; ID "nbis-exon-198"; Name "WP_001291774.1"; Ontology_term "GO:0006426" "GO:0004820" "GO:0009345"; Parent "gene-C7A06_RS01125"; gbkey "CDS"; gene "glyS"; go_component "glycine-tRNA ligase complex|0009345||IEA"; go_function "glycine-tRNA ligase activity|0004820||IEA"; go_process "glycyl-tRNA aminoacylation|0006426||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001291772.1"; locus_tag "C7A06_RS01125"; product "glycine--tRNA ligase subunit beta"; protein_id "WP_001291774.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 215092 217161 . + 0 gene_id "nbis-gene-189"; transcript_id "gene-C7A06_RS01125"; Dbxref "Genbank:WP_001291774.1"; ID "cds-WP_001291774.1"; Name "WP_001291774.1"; Ontology_term "GO:0006426" "GO:0004820" "GO:0009345"; Parent "gene-C7A06_RS01125"; gbkey "CDS"; gene "glyS"; go_component "glycine-tRNA ligase complex|0009345||IEA"; go_function "glycine-tRNA ligase activity|0004820||IEA"; go_process "glycyl-tRNA aminoacylation|0006426||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001291772.1"; locus_tag "C7A06_RS01125"; product "glycine--tRNA ligase subunit beta"; protein_id "WP_001291774.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 217486 217638 . + . gene_id "nbis-gene-190"; ID "nbis-gene-190"; Name "hokA"; gbkey "Gene"; gene "hokA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01130";
+NZ_CP027599.1 RefSeq transcript 217486 217638 . + . gene_id "nbis-gene-190"; transcript_id "gene-C7A06_RS01130"; ID "gene-C7A06_RS01130"; Name "hokA"; Parent "nbis-gene-190"; gbkey "Gene"; gene "hokA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01130"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 217486 217638 . + . gene_id "nbis-gene-190"; transcript_id "gene-C7A06_RS01130"; Dbxref "Genbank:WP_001135738.1"; ID "nbis-exon-199"; Name "WP_001135738.1"; Parent "gene-C7A06_RS01130"; gbkey "CDS"; gene "hokA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012540334.1"; locus_tag "C7A06_RS01130"; product "type I toxin-antitoxin system toxin HokA"; protein_id "WP_001135738.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 217486 217638 . + 0 gene_id "nbis-gene-190"; transcript_id "gene-C7A06_RS01130"; Dbxref "Genbank:WP_001135738.1"; ID "cds-WP_001135738.1"; Name "WP_001135738.1"; Parent "gene-C7A06_RS01130"; gbkey "CDS"; gene "hokA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012540334.1"; locus_tag "C7A06_RS01130"; product "type I toxin-antitoxin system toxin HokA"; protein_id "WP_001135738.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 217627 217686 . - . gene_id "nbis-gene-5808"; ID "nbis-gene-5808"; Name "C7A06_RS34675"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34675";
+NZ_CP027599.1 RefSeq transcript 217627 217686 . - . gene_id "nbis-gene-5808"; transcript_id "gene-C7A06_RS34675"; ID "gene-C7A06_RS34675"; Name "C7A06_RS34675"; Parent "nbis-gene-5808"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34675"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 217627 217686 . - . gene_id "nbis-gene-5808"; transcript_id "gene-C7A06_RS34675"; Dbxref "Genbank:WP_212591412.1"; ID "nbis-exon-6117"; Name "WP_212591412.1"; Parent "gene-C7A06_RS34675"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_010051206.1"; locus_tag "C7A06_RS34675"; product "hypothetical protein"; protein_id "WP_212591412.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 217627 217686 . - 0 gene_id "nbis-gene-5808"; transcript_id "gene-C7A06_RS34675"; Dbxref "Genbank:WP_212591412.1"; ID "cds-WP_212591412.1"; Name "WP_212591412.1"; Parent "gene-C7A06_RS34675"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_010051206.1"; locus_tag "C7A06_RS34675"; product "hypothetical protein"; protein_id "WP_212591412.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 217826 218038 . - . gene_id "nbis-gene-191"; ID "nbis-gene-191"; Name "cspA"; gbkey "Gene"; gene "cspA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01135";
+NZ_CP027599.1 RefSeq transcript 217826 218038 . - . gene_id "nbis-gene-191"; transcript_id "gene-C7A06_RS01135"; ID "gene-C7A06_RS01135"; Name "cspA"; Parent "nbis-gene-191"; gbkey "Gene"; gene "cspA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01135"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 217826 218038 . - . gene_id "nbis-gene-191"; transcript_id "gene-C7A06_RS01135"; Dbxref "Genbank:WP_000014594.1"; ID "nbis-exon-200"; Name "WP_000014594.1"; Parent "gene-C7A06_RS01135"; gbkey "CDS"; gene "cspA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312468.1"; locus_tag "C7A06_RS01135"; product "RNA chaperone/antiterminator CspA"; protein_id "WP_000014594.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 217826 218038 . - 0 gene_id "nbis-gene-191"; transcript_id "gene-C7A06_RS01135"; Dbxref "Genbank:WP_000014594.1"; ID "cds-WP_000014594.1"; Name "WP_000014594.1"; Parent "gene-C7A06_RS01135"; gbkey "CDS"; gene "cspA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312468.1"; locus_tag "C7A06_RS01135"; product "RNA chaperone/antiterminator CspA"; protein_id "WP_000014594.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 218319 218609 . - . gene_id "nbis-gene-192"; ID "nbis-gene-192"; Name "yiaG"; gbkey "Gene"; gene "yiaG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01140";
+NZ_CP027599.1 RefSeq transcript 218319 218609 . - . gene_id "nbis-gene-192"; transcript_id "gene-C7A06_RS01140"; ID "gene-C7A06_RS01140"; Name "yiaG"; Parent "nbis-gene-192"; gbkey "Gene"; gene "yiaG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01140"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 218319 218609 . - . gene_id "nbis-gene-192"; transcript_id "gene-C7A06_RS01140"; Dbxref "Genbank:WP_000455798.1"; ID "nbis-exon-201"; Name "WP_000455798.1"; Parent "gene-C7A06_RS01140"; gbkey "CDS"; gene "yiaG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312467.1"; locus_tag "C7A06_RS01140"; product "HTH-type transcriptional regulator"; protein_id "WP_000455798.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 218319 218609 . - 0 gene_id "nbis-gene-192"; transcript_id "gene-C7A06_RS01140"; Dbxref "Genbank:WP_000455798.1"; ID "cds-WP_000455798.1"; Name "WP_000455798.1"; Parent "gene-C7A06_RS01140"; gbkey "CDS"; gene "yiaG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312467.1"; locus_tag "C7A06_RS01140"; product "HTH-type transcriptional regulator"; protein_id "WP_000455798.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 219043 219753 . + . gene_id "nbis-gene-193"; ID "nbis-gene-193"; Name "yiaF"; gbkey "Gene"; gene "yiaF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01145";
+NZ_CP027599.1 RefSeq transcript 219043 219753 . + . gene_id "nbis-gene-193"; transcript_id "gene-C7A06_RS01145"; ID "gene-C7A06_RS01145"; Name "yiaF"; Parent "nbis-gene-193"; gbkey "Gene"; gene "yiaF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01145"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 219043 219753 . + . gene_id "nbis-gene-193"; transcript_id "gene-C7A06_RS01145"; Dbxref "Genbank:WP_000190517.1"; ID "nbis-exon-202"; Name "WP_000190517.1"; Parent "gene-C7A06_RS01145"; gbkey "CDS"; gene "yiaF"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418010.2"; locus_tag "C7A06_RS01145"; product "DUF3053 domain-containing protein"; protein_id "WP_000190517.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 219043 219753 . + 0 gene_id "nbis-gene-193"; transcript_id "gene-C7A06_RS01145"; Dbxref "Genbank:WP_000190517.1"; ID "cds-WP_000190517.1"; Name "WP_000190517.1"; Parent "gene-C7A06_RS01145"; gbkey "CDS"; gene "yiaF"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418010.2"; locus_tag "C7A06_RS01145"; product "DUF3053 domain-containing protein"; protein_id "WP_000190517.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 219803 220777 . - . gene_id "nbis-gene-194"; ID "nbis-gene-194"; Name "ghrB"; gbkey "Gene"; gene "ghrB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01150";
+NZ_CP027599.1 RefSeq transcript 219803 220777 . - . gene_id "nbis-gene-194"; transcript_id "gene-C7A06_RS01150"; ID "gene-C7A06_RS01150"; Name "ghrB"; Parent "nbis-gene-194"; gbkey "Gene"; gene "ghrB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01150"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 219803 220777 . - . gene_id "nbis-gene-194"; transcript_id "gene-C7A06_RS01150"; Dbxref "Genbank:WP_000805027.1"; ID "nbis-exon-203"; Name "WP_000805027.1"; Ontology_term "GO:0016616" "GO:0051287"; Parent "gene-C7A06_RS01150"; gbkey "CDS"; gene "ghrB"; go_function "oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|0016616||IEA" "NAD binding|0051287||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312465.2"; locus_tag "C7A06_RS01150"; product "glyoxylate/hydroxypyruvate reductase GhrB"; protein_id "WP_000805027.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 219803 220777 . - 0 gene_id "nbis-gene-194"; transcript_id "gene-C7A06_RS01150"; Dbxref "Genbank:WP_000805027.1"; ID "cds-WP_000805027.1"; Name "WP_000805027.1"; Ontology_term "GO:0016616" "GO:0051287"; Parent "gene-C7A06_RS01150"; gbkey "CDS"; gene "ghrB"; go_function "oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|0016616||IEA" "NAD binding|0051287||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312465.2"; locus_tag "C7A06_RS01150"; product "glyoxylate/hydroxypyruvate reductase GhrB"; protein_id "WP_000805027.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 220881 221540 . - . gene_id "nbis-gene-195"; ID "nbis-gene-195"; Name "yiaD"; gbkey "Gene"; gene "yiaD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01155";
+NZ_CP027599.1 RefSeq transcript 220881 221540 . - . gene_id "nbis-gene-195"; transcript_id "gene-C7A06_RS01155"; ID "gene-C7A06_RS01155"; Name "yiaD"; Parent "nbis-gene-195"; gbkey "Gene"; gene "yiaD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01155"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 220881 221540 . - . gene_id "nbis-gene-195"; transcript_id "gene-C7A06_RS01155"; Dbxref "Genbank:WP_000747625.1"; ID "nbis-exon-204"; Name "WP_000747625.1"; Ontology_term "GO:0009279"; Parent "gene-C7A06_RS01155"; gbkey "CDS"; gene "yiaD"; go_component "cell outer membrane|0009279||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312464.1"; locus_tag "C7A06_RS01155"; product "OmpA family lipoprotein"; protein_id "WP_000747625.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 220881 221540 . - 0 gene_id "nbis-gene-195"; transcript_id "gene-C7A06_RS01155"; Dbxref "Genbank:WP_000747625.1"; ID "cds-WP_000747625.1"; Name "WP_000747625.1"; Ontology_term "GO:0009279"; Parent "gene-C7A06_RS01155"; gbkey "CDS"; gene "yiaD"; go_component "cell outer membrane|0009279||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312464.1"; locus_tag "C7A06_RS01155"; product "OmpA family lipoprotein"; protein_id "WP_000747625.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 221693 224026 . + . gene_id "nbis-gene-196"; ID "nbis-gene-196"; Name "bisC"; gbkey "Gene"; gene "bisC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01160";
+NZ_CP027599.1 RefSeq transcript 221693 224026 . + . gene_id "nbis-gene-196"; transcript_id "gene-C7A06_RS01160"; ID "gene-C7A06_RS01160"; Name "bisC"; Parent "nbis-gene-196"; gbkey "Gene"; gene "bisC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01160"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 221693 224026 . + . gene_id "nbis-gene-196"; transcript_id "gene-C7A06_RS01160"; Dbxref "Genbank:WP_000013916.1"; ID "nbis-exon-205"; Name "WP_000013916.1"; Parent "gene-C7A06_RS01160"; gbkey "CDS"; gene "bisC"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418007.3"; locus_tag "C7A06_RS01160"; product "biotin sulfoxide reductase"; protein_id "WP_000013916.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 221693 224026 . + 0 gene_id "nbis-gene-196"; transcript_id "gene-C7A06_RS01160"; Dbxref "Genbank:WP_000013916.1"; ID "cds-WP_000013916.1"; Name "WP_000013916.1"; Parent "gene-C7A06_RS01160"; gbkey "CDS"; gene "bisC"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418007.3"; locus_tag "C7A06_RS01160"; product "biotin sulfoxide reductase"; protein_id "WP_000013916.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 223995 224435 . - . gene_id "nbis-gene-197"; ID "nbis-gene-197"; Name "yiaC"; gbkey "Gene"; gene "yiaC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01165";
+NZ_CP027599.1 RefSeq transcript 223995 224435 . - . gene_id "nbis-gene-197"; transcript_id "gene-C7A06_RS01165"; ID "gene-C7A06_RS01165"; Name "yiaC"; Parent "nbis-gene-197"; gbkey "Gene"; gene "yiaC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01165"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 223995 224435 . - . gene_id "nbis-gene-197"; transcript_id "gene-C7A06_RS01165"; Dbxref "Genbank:WP_000617478.1"; ID "nbis-exon-206"; Name "WP_000617478.1"; Ontology_term "GO:0008080"; Parent "gene-C7A06_RS01165"; gbkey "CDS"; gene "yiaC"; go_function "N-acetyltransferase activity|0008080||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709328.1"; locus_tag "C7A06_RS01165"; product "N-acetyltransferase"; protein_id "WP_000617478.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 223995 224435 . - 0 gene_id "nbis-gene-197"; transcript_id "gene-C7A06_RS01165"; Dbxref "Genbank:WP_000617478.1"; ID "cds-WP_000617478.1"; Name "WP_000617478.1"; Ontology_term "GO:0008080"; Parent "gene-C7A06_RS01165"; gbkey "CDS"; gene "yiaC"; go_function "N-acetyltransferase activity|0008080||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709328.1"; locus_tag "C7A06_RS01165"; product "N-acetyltransferase"; protein_id "WP_000617478.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 224432 224995 . - . gene_id "nbis-gene-198"; ID "nbis-gene-198"; Name "tag"; gbkey "Gene"; gene "tag"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01170";
+NZ_CP027599.1 RefSeq transcript 224432 224995 . - . gene_id "nbis-gene-198"; transcript_id "gene-C7A06_RS01170"; ID "gene-C7A06_RS01170"; Name "tag"; Parent "nbis-gene-198"; gbkey "Gene"; gene "tag"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01170"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 224432 224995 . - . gene_id "nbis-gene-198"; transcript_id "gene-C7A06_RS01170"; Dbxref "Genbank:WP_000438953.1"; ID "nbis-exon-207"; Name "WP_000438953.1"; Parent "gene-C7A06_RS01170"; gbkey "CDS"; gene "tag"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418005.1"; locus_tag "C7A06_RS01170"; product "DNA-3-methyladenine glycosylase I"; protein_id "WP_000438953.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 224432 224995 . - 0 gene_id "nbis-gene-198"; transcript_id "gene-C7A06_RS01170"; Dbxref "Genbank:WP_000438953.1"; ID "cds-WP_000438953.1"; Name "WP_000438953.1"; Parent "gene-C7A06_RS01170"; gbkey "CDS"; gene "tag"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418005.1"; locus_tag "C7A06_RS01170"; product "DNA-3-methyladenine glycosylase I"; protein_id "WP_000438953.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 225153 225851 . + . gene_id "nbis-gene-199"; ID "nbis-gene-199"; Name "yhjY"; gbkey "Gene"; gene "yhjY"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01175";
+NZ_CP027599.1 RefSeq transcript 225153 225851 . + . gene_id "nbis-gene-199"; transcript_id "gene-C7A06_RS01175"; ID "gene-C7A06_RS01175"; Name "yhjY"; Parent "nbis-gene-199"; gbkey "Gene"; gene "yhjY"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01175"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 225153 225851 . + . gene_id "nbis-gene-199"; transcript_id "gene-C7A06_RS01175"; Dbxref "Genbank:WP_001296791.1"; ID "nbis-exon-208"; Name "WP_001296791.1"; Parent "gene-C7A06_RS01175"; gbkey "CDS"; gene "yhjY"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709326.2"; locus_tag "C7A06_RS01175"; product "autotransporter outer membrane beta-barrel domain-containing protein"; protein_id "WP_001296791.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 225153 225851 . + 0 gene_id "nbis-gene-199"; transcript_id "gene-C7A06_RS01175"; Dbxref "Genbank:WP_001296791.1"; ID "cds-WP_001296791.1"; Name "WP_001296791.1"; Parent "gene-C7A06_RS01175"; gbkey "CDS"; gene "yhjY"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709326.2"; locus_tag "C7A06_RS01175"; product "autotransporter outer membrane beta-barrel domain-containing protein"; protein_id "WP_001296791.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 226080 227282 . + . gene_id "nbis-gene-200"; ID "nbis-gene-200"; Name "yhjX"; gbkey "Gene"; gene "yhjX"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01185";
+NZ_CP027599.1 RefSeq transcript 226080 227282 . + . gene_id "nbis-gene-200"; transcript_id "gene-C7A06_RS01185"; ID "gene-C7A06_RS01185"; Name "yhjX"; Parent "nbis-gene-200"; gbkey "Gene"; gene "yhjX"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01185"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 226080 227282 . + . gene_id "nbis-gene-200"; transcript_id "gene-C7A06_RS01185"; Dbxref "Genbank:WP_000189036.1"; ID "nbis-exon-209"; Name "WP_000189036.1"; Parent "gene-C7A06_RS01185"; gbkey "CDS"; gene "yhjX"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312459.1"; locus_tag "C7A06_RS01185"; product "MFS transporter"; protein_id "WP_000189036.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 226080 227282 . + 0 gene_id "nbis-gene-200"; transcript_id "gene-C7A06_RS01185"; Dbxref "Genbank:WP_000189036.1"; ID "cds-WP_000189036.1"; Name "WP_000189036.1"; Parent "gene-C7A06_RS01185"; gbkey "CDS"; gene "yhjX"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312459.1"; locus_tag "C7A06_RS01185"; product "MFS transporter"; protein_id "WP_000189036.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 227606 228130 . + . gene_id "nbis-gene-201"; ID "nbis-gene-201"; Name "C7A06_RS01190"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01190";
+NZ_CP027599.1 RefSeq transcript 227606 228130 . + . gene_id "nbis-gene-201"; transcript_id "gene-C7A06_RS01190"; ID "gene-C7A06_RS01190"; Name "C7A06_RS01190"; Parent "nbis-gene-201"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01190"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 227606 228130 . + . gene_id "nbis-gene-201"; transcript_id "gene-C7A06_RS01190"; Dbxref "Genbank:WP_000756356.1"; ID "nbis-exon-210"; Name "WP_000756356.1"; Parent "gene-C7A06_RS01190"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000756357.1"; locus_tag "C7A06_RS01190"; product "long polar fimbria major subunit LpfA"; protein_id "WP_000756356.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 227606 228130 . + 0 gene_id "nbis-gene-201"; transcript_id "gene-C7A06_RS01190"; Dbxref "Genbank:WP_000756356.1"; ID "cds-WP_000756356.1"; Name "WP_000756356.1"; Parent "gene-C7A06_RS01190"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000756357.1"; locus_tag "C7A06_RS01190"; product "long polar fimbria major subunit LpfA"; protein_id "WP_000756356.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 228214 228900 . + . gene_id "nbis-gene-202"; ID "nbis-gene-202"; Name "lpfB"; gbkey "Gene"; gene "lpfB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01195";
+NZ_CP027599.1 RefSeq transcript 228214 228900 . + . gene_id "nbis-gene-202"; transcript_id "gene-C7A06_RS01195"; ID "gene-C7A06_RS01195"; Name "lpfB"; Parent "nbis-gene-202"; gbkey "Gene"; gene "lpfB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01195"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 228214 228900 . + . gene_id "nbis-gene-202"; transcript_id "gene-C7A06_RS01195"; Dbxref "Genbank:WP_000822476.1"; ID "nbis-exon-211"; Name "WP_000822476.1"; Parent "gene-C7A06_RS01195"; gbkey "CDS"; gene "lpfB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000822474.1"; locus_tag "C7A06_RS01195"; product "long polar fimbrial biogenesis chaperone LpfB"; protein_id "WP_000822476.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 228214 228900 . + 0 gene_id "nbis-gene-202"; transcript_id "gene-C7A06_RS01195"; Dbxref "Genbank:WP_000822476.1"; ID "cds-WP_000822476.1"; Name "WP_000822476.1"; Parent "gene-C7A06_RS01195"; gbkey "CDS"; gene "lpfB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000822474.1"; locus_tag "C7A06_RS01195"; product "long polar fimbrial biogenesis chaperone LpfB"; protein_id "WP_000822476.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 228924 231455 . + . gene_id "nbis-gene-203"; ID "nbis-gene-203"; Name "lpfC"; gbkey "Gene"; gene "lpfC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01200";
+NZ_CP027599.1 RefSeq transcript 228924 231455 . + . gene_id "nbis-gene-203"; transcript_id "gene-C7A06_RS01200"; ID "gene-C7A06_RS01200"; Name "lpfC"; Parent "nbis-gene-203"; gbkey "Gene"; gene "lpfC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01200"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 228924 231455 . + . gene_id "nbis-gene-203"; transcript_id "gene-C7A06_RS01200"; Dbxref "Genbank:WP_000558677.1"; ID "nbis-exon-212"; Name "WP_000558677.1"; Parent "gene-C7A06_RS01200"; gbkey "CDS"; gene "lpfC"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001759518.1"; locus_tag "C7A06_RS01200"; product "outer membrane usher protein LpfC"; protein_id "WP_000558677.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 228924 231455 . + 0 gene_id "nbis-gene-203"; transcript_id "gene-C7A06_RS01200"; Dbxref "Genbank:WP_000558677.1"; ID "cds-WP_000558677.1"; Name "WP_000558677.1"; Parent "gene-C7A06_RS01200"; gbkey "CDS"; gene "lpfC"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001759518.1"; locus_tag "C7A06_RS01200"; product "outer membrane usher protein LpfC"; protein_id "WP_000558677.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 231466 232521 . + . gene_id "nbis-gene-204"; ID "nbis-gene-204"; Name "lpfD"; gbkey "Gene"; gene "lpfD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01205";
+NZ_CP027599.1 RefSeq transcript 231466 232521 . + . gene_id "nbis-gene-204"; transcript_id "gene-C7A06_RS01205"; ID "gene-C7A06_RS01205"; Name "lpfD"; Parent "nbis-gene-204"; gbkey "Gene"; gene "lpfD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01205"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 231466 232521 . + . gene_id "nbis-gene-204"; transcript_id "gene-C7A06_RS01205"; Dbxref "Genbank:WP_000694926.1"; ID "nbis-exon-213"; Name "WP_000694926.1"; Parent "gene-C7A06_RS01205"; gbkey "CDS"; gene "lpfD"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000694923.1"; locus_tag "C7A06_RS01205"; product "long polar fimbrial protein LpfD"; protein_id "WP_000694926.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 231466 232521 . + 0 gene_id "nbis-gene-204"; transcript_id "gene-C7A06_RS01205"; Dbxref "Genbank:WP_000694926.1"; ID "cds-WP_000694926.1"; Name "WP_000694926.1"; Parent "gene-C7A06_RS01205"; gbkey "CDS"; gene "lpfD"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000694923.1"; locus_tag "C7A06_RS01205"; product "long polar fimbrial protein LpfD"; protein_id "WP_000694926.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 232527 233051 . + . gene_id "nbis-gene-205"; ID "nbis-gene-205"; Name "lpfE"; gbkey "Gene"; gene "lpfE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01210";
+NZ_CP027599.1 RefSeq transcript 232527 233051 . + . gene_id "nbis-gene-205"; transcript_id "gene-C7A06_RS01210"; ID "gene-C7A06_RS01210"; Name "lpfE"; Parent "nbis-gene-205"; gbkey "Gene"; gene "lpfE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01210"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 232527 233051 . + . gene_id "nbis-gene-205"; transcript_id "gene-C7A06_RS01210"; Dbxref "Genbank:WP_000831422.1"; ID "nbis-exon-214"; Name "WP_000831422.1"; Parent "gene-C7A06_RS01210"; gbkey "CDS"; gene "lpfE"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000792957.1"; locus_tag "C7A06_RS01210"; product "long polar fimbrial protein LpfE"; protein_id "WP_000831422.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 232527 233051 . + 0 gene_id "nbis-gene-205"; transcript_id "gene-C7A06_RS01210"; Dbxref "Genbank:WP_000831422.1"; ID "cds-WP_000831422.1"; Name "WP_000831422.1"; Parent "gene-C7A06_RS01210"; gbkey "CDS"; gene "lpfE"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000792957.1"; locus_tag "C7A06_RS01210"; product "long polar fimbrial protein LpfE"; protein_id "WP_000831422.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 233304 234995 . + . gene_id "nbis-gene-206"; ID "nbis-gene-206"; Name "eptB"; gbkey "Gene"; gene "eptB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01215";
+NZ_CP027599.1 RefSeq transcript 233304 234995 . + . gene_id "nbis-gene-206"; transcript_id "gene-C7A06_RS01215"; ID "gene-C7A06_RS01215"; Name "eptB"; Parent "nbis-gene-206"; gbkey "Gene"; gene "eptB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01215"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 233304 234995 . + . gene_id "nbis-gene-206"; transcript_id "gene-C7A06_RS01215"; Dbxref "Genbank:WP_001269224.1"; ID "nbis-exon-215"; Name "WP_001269224.1"; Ontology_term "GO:0008484"; Parent "gene-C7A06_RS01215"; gbkey "CDS"; gene "eptB"; go_function "sulfuric ester hydrolase activity|0008484||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418002.2"; locus_tag "C7A06_RS01215"; product "kdo(2)-lipid A phosphoethanolamine 7''-transferase"; protein_id "WP_001269224.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 233304 234995 . + 0 gene_id "nbis-gene-206"; transcript_id "gene-C7A06_RS01215"; Dbxref "Genbank:WP_001269224.1"; ID "cds-WP_001269224.1"; Name "WP_001269224.1"; Ontology_term "GO:0008484"; Parent "gene-C7A06_RS01215"; gbkey "CDS"; gene "eptB"; go_function "sulfuric ester hydrolase activity|0008484||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418002.2"; locus_tag "C7A06_RS01215"; product "kdo(2)-lipid A phosphoethanolamine 7''-transferase"; protein_id "WP_001269224.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 235087 235163 . + . gene_id "gene-C7A06_RS01220"; ID "gene-C7A06_RS01220"; Name "C7A06_RS01220"; gbkey "Gene"; gene_biotype "tRNA"; locus_tag "C7A06_RS01220";
+NZ_CP027599.1 tRNAscan-SE transcript 235087 235163 . + . gene_id "gene-C7A06_RS01220"; transcript_id "rna-C7A06_RS01220"; ID "rna-C7A06_RS01220"; Parent "gene-C7A06_RS01220"; anticodon "(pos:235121..235123)"; gbkey "tRNA"; inference "COORDINATES: profile:tRNAscan-SE:2.0.7"; locus_tag "C7A06_RS01220"; original_biotype "trna"; product "tRNA-Pro";
+NZ_CP027599.1 tRNAscan-SE exon 235087 235163 . + . gene_id "gene-C7A06_RS01220"; transcript_id "rna-C7A06_RS01220"; ID "exon-C7A06_RS01220-1"; Parent "rna-C7A06_RS01220"; anticodon "(pos:235121..235123)"; gbkey "tRNA"; inference "COORDINATES: profile:tRNAscan-SE:2.0.7"; locus_tag "C7A06_RS01220"; product "tRNA-Pro";
+NZ_CP027599.1 RefSeq gene 235198 235331 . + . gene_id "gene-C7A06_RS01225"; ID "gene-C7A06_RS01225"; Name "C7A06_RS01225"; gbkey "Gene"; gene_biotype "ncRNA"; locus_tag "C7A06_RS01225";
+NZ_CP027599.1 cmsearch transcript 235198 235331 . + . gene_id "gene-C7A06_RS01225"; transcript_id "rna-C7A06_RS01225"; Dbxref "RFAM:RF00391"; ID "rna-C7A06_RS01225"; Note "rtT sRNA, processed from tyrT transcript"; Parent "gene-C7A06_RS01225"; gbkey "ncRNA"; inference "COORDINATES: profile:INFERNAL:1.1.1"; locus_tag "C7A06_RS01225"; original_biotype "ncrna"; product "RtT sRNA";
+NZ_CP027599.1 cmsearch exon 235198 235331 . + . gene_id "gene-C7A06_RS01225"; transcript_id "rna-C7A06_RS01225"; Dbxref "RFAM:RF00391"; ID "exon-C7A06_RS01225-1"; Note "rtT sRNA, processed from tyrT transcript"; Parent "rna-C7A06_RS01225"; gbkey "ncRNA"; inference "COORDINATES: profile:INFERNAL:1.1.1"; locus_tag "C7A06_RS01225"; product "RtT sRNA";
+NZ_CP027599.1 RefSeq gene 235531 236511 . - . gene_id "nbis-gene-207"; ID "nbis-gene-207"; Name "C7A06_RS01235"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01235";
+NZ_CP027599.1 RefSeq transcript 235531 236511 . - . gene_id "nbis-gene-207"; transcript_id "gene-C7A06_RS01235"; ID "gene-C7A06_RS01235"; Name "C7A06_RS01235"; Parent "nbis-gene-207"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01235"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 235531 236511 . - . gene_id "nbis-gene-207"; transcript_id "gene-C7A06_RS01235"; Dbxref "Genbank:WP_000399648.1"; ID "nbis-exon-216"; Name "WP_000399648.1"; Parent "gene-C7A06_RS01235"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012904434.1"; locus_tag "C7A06_RS01235"; product "IS110-like element IS621 family transposase"; protein_id "WP_000399648.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 235531 236511 . - 0 gene_id "nbis-gene-207"; transcript_id "gene-C7A06_RS01235"; Dbxref "Genbank:WP_000399648.1"; ID "cds-WP_000399648.1"; Name "WP_000399648.1"; Parent "gene-C7A06_RS01235"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012904434.1"; locus_tag "C7A06_RS01235"; product "IS110-like element IS621 family transposase"; protein_id "WP_000399648.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 236503 237003 . + . gene_id "nbis-gene-5830"; ID "nbis-gene-5830"; Name "C7A06_RS34810"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34810";
+NZ_CP027599.1 RefSeq transcript 236503 237003 . + . gene_id "nbis-gene-5830"; transcript_id "gene-C7A06_RS34810"; ID "gene-C7A06_RS34810"; Name "C7A06_RS34810"; Parent "nbis-gene-5830"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34810"; original_biotype "mrna";
+NZ_CP027599.1 GeneMarkS-2+ exon 236503 237003 . + . gene_id "nbis-gene-5830"; transcript_id "gene-C7A06_RS34810"; Dbxref "Genbank:WP_000469071.1"; ID "nbis-exon-6142"; Name "WP_000469071.1"; Parent "gene-C7A06_RS34810"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS34810"; product "hypothetical protein"; protein_id "WP_000469071.1"; transl_table "11";
+NZ_CP027599.1 GeneMarkS-2+ CDS 236503 237003 . + 0 gene_id "nbis-gene-5830"; transcript_id "gene-C7A06_RS34810"; Dbxref "Genbank:WP_000469071.1"; ID "cds-WP_000469071.1"; Name "WP_000469071.1"; Parent "gene-C7A06_RS34810"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS34810"; product "hypothetical protein"; protein_id "WP_000469071.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 237355 238962 . + . gene_id "nbis-gene-208"; ID "nbis-gene-208"; Name "dppA"; gbkey "Gene"; gene "dppA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01245";
+NZ_CP027599.1 RefSeq transcript 237355 238962 . + . gene_id "nbis-gene-208"; transcript_id "gene-C7A06_RS01245"; ID "gene-C7A06_RS01245"; Name "dppA"; Parent "nbis-gene-208"; gbkey "Gene"; gene "dppA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01245"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 237355 238962 . + . gene_id "nbis-gene-208"; transcript_id "gene-C7A06_RS01245"; Dbxref "Genbank:WP_001222883.1"; ID "nbis-exon-217"; Name "WP_001222883.1"; Parent "gene-C7A06_RS01245"; gbkey "CDS"; gene "dppA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418001.1"; locus_tag "C7A06_RS01245"; product "dipeptide ABC transporter substrate-binding protein DppA"; protein_id "WP_001222883.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 237355 238962 . + 0 gene_id "nbis-gene-208"; transcript_id "gene-C7A06_RS01245"; Dbxref "Genbank:WP_001222883.1"; ID "cds-WP_001222883.1"; Name "WP_001222883.1"; Parent "gene-C7A06_RS01245"; gbkey "CDS"; gene "dppA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418001.1"; locus_tag "C7A06_RS01245"; product "dipeptide ABC transporter substrate-binding protein DppA"; protein_id "WP_001222883.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 239113 240132 . + . gene_id "nbis-gene-209"; ID "nbis-gene-209"; Name "dppB"; gbkey "Gene"; gene "dppB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01255";
+NZ_CP027599.1 RefSeq transcript 239113 240132 . + . gene_id "nbis-gene-209"; transcript_id "gene-C7A06_RS01255"; ID "gene-C7A06_RS01255"; Name "dppB"; Parent "nbis-gene-209"; gbkey "Gene"; gene "dppB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01255"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 239113 240132 . + . gene_id "nbis-gene-209"; transcript_id "gene-C7A06_RS01255"; Dbxref "Genbank:WP_000938864.1"; ID "nbis-exon-218"; Name "WP_000938864.1"; Parent "gene-C7A06_RS01255"; gbkey "CDS"; gene "dppB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005133865.1"; locus_tag "C7A06_RS01255"; product "dipeptide ABC transporter permease DppB"; protein_id "WP_000938864.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 239113 240132 . + 0 gene_id "nbis-gene-209"; transcript_id "gene-C7A06_RS01255"; Dbxref "Genbank:WP_000938864.1"; ID "cds-WP_000938864.1"; Name "WP_000938864.1"; Parent "gene-C7A06_RS01255"; gbkey "CDS"; gene "dppB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005133865.1"; locus_tag "C7A06_RS01255"; product "dipeptide ABC transporter permease DppB"; protein_id "WP_000938864.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 240142 241044 . + . gene_id "nbis-gene-210"; ID "nbis-gene-210"; Name "dppC"; gbkey "Gene"; gene "dppC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01260";
+NZ_CP027599.1 RefSeq transcript 240142 241044 . + . gene_id "nbis-gene-210"; transcript_id "gene-C7A06_RS01260"; ID "gene-C7A06_RS01260"; Name "dppC"; Parent "nbis-gene-210"; gbkey "Gene"; gene "dppC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01260"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 240142 241044 . + . gene_id "nbis-gene-210"; transcript_id "gene-C7A06_RS01260"; Dbxref "Genbank:WP_000084677.1"; ID "nbis-exon-219"; Name "WP_000084677.1"; Ontology_term "GO:0055085"; Parent "gene-C7A06_RS01260"; gbkey "CDS"; gene "dppC"; go_process "transmembrane transport|0055085||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_010426221.1"; locus_tag "C7A06_RS01260"; product "dipeptide ABC transporter permease DppC"; protein_id "WP_000084677.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 240142 241044 . + 0 gene_id "nbis-gene-210"; transcript_id "gene-C7A06_RS01260"; Dbxref "Genbank:WP_000084677.1"; ID "cds-WP_000084677.1"; Name "WP_000084677.1"; Ontology_term "GO:0055085"; Parent "gene-C7A06_RS01260"; gbkey "CDS"; gene "dppC"; go_process "transmembrane transport|0055085||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_010426221.1"; locus_tag "C7A06_RS01260"; product "dipeptide ABC transporter permease DppC"; protein_id "WP_000084677.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 241055 242038 . + . gene_id "nbis-gene-211"; ID "nbis-gene-211"; Name "dppD"; gbkey "Gene"; gene "dppD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01265";
+NZ_CP027599.1 RefSeq transcript 241055 242038 . + . gene_id "nbis-gene-211"; transcript_id "gene-C7A06_RS01265"; ID "gene-C7A06_RS01265"; Name "dppD"; Parent "nbis-gene-211"; gbkey "Gene"; gene "dppD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01265"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 241055 242038 . + . gene_id "nbis-gene-211"; transcript_id "gene-C7A06_RS01265"; Dbxref "Genbank:WP_001196495.1"; ID "nbis-exon-220"; Name "WP_001196495.1"; Ontology_term "GO:0015833" "GO:0000166" "GO:0005524"; Parent "gene-C7A06_RS01265"; gbkey "CDS"; gene "dppD"; go_function "nucleotide binding|0000166||IEA" "ATP binding|0005524||IEA"; go_process "peptide transport|0015833||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312448.1"; locus_tag "C7A06_RS01265"; product "dipeptide ABC transporter ATP-binding protein"; protein_id "WP_001196495.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 241055 242038 . + 0 gene_id "nbis-gene-211"; transcript_id "gene-C7A06_RS01265"; Dbxref "Genbank:WP_001196495.1"; ID "cds-WP_001196495.1"; Name "WP_001196495.1"; Ontology_term "GO:0015833" "GO:0000166" "GO:0005524"; Parent "gene-C7A06_RS01265"; gbkey "CDS"; gene "dppD"; go_function "nucleotide binding|0000166||IEA" "ATP binding|0005524||IEA"; go_process "peptide transport|0015833||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312448.1"; locus_tag "C7A06_RS01265"; product "dipeptide ABC transporter ATP-binding protein"; protein_id "WP_001196495.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 242035 243039 . + . gene_id "nbis-gene-212"; ID "nbis-gene-212"; Name "dppF"; gbkey "Gene"; gene "dppF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01270";
+NZ_CP027599.1 RefSeq transcript 242035 243039 . + . gene_id "nbis-gene-212"; transcript_id "gene-C7A06_RS01270"; ID "gene-C7A06_RS01270"; Name "dppF"; Parent "nbis-gene-212"; gbkey "Gene"; gene "dppF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01270"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 242035 243039 . + . gene_id "nbis-gene-212"; transcript_id "gene-C7A06_RS01270"; Dbxref "Genbank:WP_000107031.1"; ID "nbis-exon-221"; Name "WP_000107031.1"; Parent "gene-C7A06_RS01270"; gbkey "CDS"; gene "dppF"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312447.1"; locus_tag "C7A06_RS01270"; product "dipeptide ABC transporter ATP-binding subunit DppF"; protein_id "WP_000107031.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 242035 243039 . + 0 gene_id "nbis-gene-212"; transcript_id "gene-C7A06_RS01270"; Dbxref "Genbank:WP_000107031.1"; ID "cds-WP_000107031.1"; Name "WP_000107031.1"; Parent "gene-C7A06_RS01270"; gbkey "CDS"; gene "dppF"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312447.1"; locus_tag "C7A06_RS01270"; product "dipeptide ABC transporter ATP-binding subunit DppF"; protein_id "WP_000107031.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 243069 244340 . - . gene_id "nbis-gene-213"; ID "nbis-gene-213"; Name "yhjV"; gbkey "Gene"; gene "yhjV"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01275";
+NZ_CP027599.1 RefSeq transcript 243069 244340 . - . gene_id "nbis-gene-213"; transcript_id "gene-C7A06_RS01275"; ID "gene-C7A06_RS01275"; Name "yhjV"; Parent "nbis-gene-213"; gbkey "Gene"; gene "yhjV"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01275"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 243069 244340 . - . gene_id "nbis-gene-213"; transcript_id "gene-C7A06_RS01275"; Dbxref "Genbank:WP_001296805.1"; ID "nbis-exon-222"; Name "WP_001296805.1"; Parent "gene-C7A06_RS01275"; gbkey "CDS"; gene "yhjV"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417996.1"; locus_tag "C7A06_RS01275"; product "amino acid permease"; protein_id "WP_001296805.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 243069 244340 . - 0 gene_id "nbis-gene-213"; transcript_id "gene-C7A06_RS01275"; Dbxref "Genbank:WP_001296805.1"; ID "cds-WP_001296805.1"; Name "WP_001296805.1"; Parent "gene-C7A06_RS01275"; gbkey "CDS"; gene "yhjV"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417996.1"; locus_tag "C7A06_RS01275"; product "amino acid permease"; protein_id "WP_001296805.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 244816 244923 . + . gene_id "nbis-gene-214"; ID "nbis-gene-214"; Name "C7A06_RS01285"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01285";
+NZ_CP027599.1 RefSeq transcript 244816 244923 . + . gene_id "nbis-gene-214"; transcript_id "gene-C7A06_RS01285"; ID "gene-C7A06_RS01285"; Name "C7A06_RS01285"; Parent "nbis-gene-214"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01285"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 244816 244923 . + . gene_id "nbis-gene-214"; transcript_id "gene-C7A06_RS01285"; Dbxref "Genbank:WP_001295224.1"; ID "nbis-exon-223"; Name "WP_001295224.1"; Parent "gene-C7A06_RS01285"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502657.1"; locus_tag "C7A06_RS01285"; product "type I toxin-antitoxin system toxin Ldr family protein"; protein_id "WP_001295224.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 244816 244923 . + 0 gene_id "nbis-gene-214"; transcript_id "gene-C7A06_RS01285"; Dbxref "Genbank:WP_001295224.1"; ID "cds-WP_001295224.1"; Name "WP_001295224.1"; Parent "gene-C7A06_RS01285"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502657.1"; locus_tag "C7A06_RS01285"; product "type I toxin-antitoxin system toxin Ldr family protein"; protein_id "WP_001295224.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 245299 245406 . + . gene_id "nbis-gene-5707"; ID "nbis-gene-5707"; Name "C7A06_RS33915"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33915";
+NZ_CP027599.1 RefSeq transcript 245299 245406 . + . gene_id "nbis-gene-5707"; transcript_id "gene-C7A06_RS33915"; ID "gene-C7A06_RS33915"; Name "C7A06_RS33915"; Parent "nbis-gene-5707"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33915"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 245299 245406 . + . gene_id "nbis-gene-5707"; transcript_id "gene-C7A06_RS33915"; Dbxref "Genbank:WP_001295224.1"; ID "nbis-exon-5989"; Name "WP_001295224.1"; Parent "gene-C7A06_RS33915"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502657.1"; locus_tag "C7A06_RS33915"; product "type I toxin-antitoxin system toxin Ldr family protein"; protein_id "WP_001295224.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 245299 245406 . + 0 gene_id "nbis-gene-5707"; transcript_id "gene-C7A06_RS33915"; Dbxref "Genbank:WP_001295224.1"; ID "cds-WP_001295224.1-2"; Name "WP_001295224.1"; Parent "gene-C7A06_RS33915"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502657.1"; locus_tag "C7A06_RS33915"; product "type I toxin-antitoxin system toxin Ldr family protein"; protein_id "WP_001295224.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 245782 245889 . + . gene_id "nbis-gene-5708"; ID "nbis-gene-5708"; Name "C7A06_RS33920"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33920";
+NZ_CP027599.1 RefSeq transcript 245782 245889 . + . gene_id "nbis-gene-5708"; transcript_id "gene-C7A06_RS33920"; ID "gene-C7A06_RS33920"; Name "C7A06_RS33920"; Parent "nbis-gene-5708"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33920"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 245782 245889 . + . gene_id "nbis-gene-5708"; transcript_id "gene-C7A06_RS33920"; Dbxref "Genbank:WP_001295224.1"; ID "nbis-exon-5990"; Name "WP_001295224.1"; Parent "gene-C7A06_RS33920"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502657.1"; locus_tag "C7A06_RS33920"; product "type I toxin-antitoxin system toxin Ldr family protein"; protein_id "WP_001295224.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 245782 245889 . + 0 gene_id "nbis-gene-5708"; transcript_id "gene-C7A06_RS33920"; Dbxref "Genbank:WP_001295224.1"; ID "cds-WP_001295224.1-3"; Name "WP_001295224.1"; Parent "gene-C7A06_RS33920"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502657.1"; locus_tag "C7A06_RS33920"; product "type I toxin-antitoxin system toxin Ldr family protein"; protein_id "WP_001295224.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 246265 246372 . + . gene_id "nbis-gene-215"; ID "nbis-gene-215"; Name "C7A06_RS01315"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01315";
+NZ_CP027599.1 RefSeq transcript 246265 246372 . + . gene_id "nbis-gene-215"; transcript_id "gene-C7A06_RS01315"; ID "gene-C7A06_RS01315"; Name "C7A06_RS01315"; Parent "nbis-gene-215"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01315"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 246265 246372 . + . gene_id "nbis-gene-215"; transcript_id "gene-C7A06_RS01315"; Dbxref "Genbank:WP_001295224.1"; ID "nbis-exon-224"; Name "WP_001295224.1"; Parent "gene-C7A06_RS01315"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502657.1"; locus_tag "C7A06_RS01315"; product "type I toxin-antitoxin system toxin Ldr family protein"; protein_id "WP_001295224.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 246265 246372 . + 0 gene_id "nbis-gene-215"; transcript_id "gene-C7A06_RS01315"; Dbxref "Genbank:WP_001295224.1"; ID "cds-WP_001295224.1-4"; Name "WP_001295224.1"; Parent "gene-C7A06_RS01315"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502657.1"; locus_tag "C7A06_RS01315"; product "type I toxin-antitoxin system toxin Ldr family protein"; protein_id "WP_001295224.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 246459 248138 . - . gene_id "nbis-gene-216"; ID "nbis-gene-216"; Name "bcsG"; gbkey "Gene"; gene "bcsG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01320";
+NZ_CP027599.1 RefSeq transcript 246459 248138 . - . gene_id "nbis-gene-216"; transcript_id "gene-C7A06_RS01320"; ID "gene-C7A06_RS01320"; Name "bcsG"; Parent "nbis-gene-216"; gbkey "Gene"; gene "bcsG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01320"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 246459 248138 . - . gene_id "nbis-gene-216"; transcript_id "gene-C7A06_RS01320"; Dbxref "Genbank:WP_000191606.1"; ID "nbis-exon-225"; Name "WP_000191606.1"; Ontology_term "GO:0030244" "GO:0003674" "GO:0005575"; Parent "gene-C7A06_RS01320"; gbkey "CDS"; gene "bcsG"; go_component "cellular_component|0005575||IEA"; go_function "molecular_function|0003674||IEA"; go_process "cellulose biosynthetic process|0030244||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312445.1"; locus_tag "C7A06_RS01320"; product "cellulose biosynthesis protein BcsG"; protein_id "WP_000191606.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 246459 248138 . - 0 gene_id "nbis-gene-216"; transcript_id "gene-C7A06_RS01320"; Dbxref "Genbank:WP_000191606.1"; ID "cds-WP_000191606.1"; Name "WP_000191606.1"; Ontology_term "GO:0030244" "GO:0003674" "GO:0005575"; Parent "gene-C7A06_RS01320"; gbkey "CDS"; gene "bcsG"; go_component "cellular_component|0005575||IEA"; go_function "molecular_function|0003674||IEA"; go_process "cellulose biosynthetic process|0030244||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312445.1"; locus_tag "C7A06_RS01320"; product "cellulose biosynthesis protein BcsG"; protein_id "WP_000191606.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 248135 248326 . - . gene_id "nbis-gene-217"; ID "nbis-gene-217"; Name "bcsF"; gbkey "Gene"; gene "bcsF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01325";
+NZ_CP027599.1 RefSeq transcript 248135 248326 . - . gene_id "nbis-gene-217"; transcript_id "gene-C7A06_RS01325"; ID "gene-C7A06_RS01325"; Name "bcsF"; Parent "nbis-gene-217"; gbkey "Gene"; gene "bcsF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01325"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 248135 248326 . - . gene_id "nbis-gene-217"; transcript_id "gene-C7A06_RS01325"; Dbxref "Genbank:WP_000988308.1"; ID "nbis-exon-226"; Name "WP_000988308.1"; Ontology_term "GO:0052324" "GO:0003674" "GO:0005575"; Parent "gene-C7A06_RS01325"; gbkey "CDS"; gene "bcsF"; go_component "cellular_component|0005575||IEA"; go_function "molecular_function|0003674||IEA"; go_process "plant-type cell wall cellulose biosynthetic process|0052324||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417994.2"; locus_tag "C7A06_RS01325"; product "cellulose biosynthesis protein BcsF"; protein_id "WP_000988308.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 248135 248326 . - 0 gene_id "nbis-gene-217"; transcript_id "gene-C7A06_RS01325"; Dbxref "Genbank:WP_000988308.1"; ID "cds-WP_000988308.1"; Name "WP_000988308.1"; Ontology_term "GO:0052324" "GO:0003674" "GO:0005575"; Parent "gene-C7A06_RS01325"; gbkey "CDS"; gene "bcsF"; go_component "cellular_component|0005575||IEA"; go_function "molecular_function|0003674||IEA"; go_process "plant-type cell wall cellulose biosynthetic process|0052324||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417994.2"; locus_tag "C7A06_RS01325"; product "cellulose biosynthesis protein BcsF"; protein_id "WP_000988308.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 248323 249894 . - . gene_id "nbis-gene-218"; ID "nbis-gene-218"; Name "bcsE"; gbkey "Gene"; gene "bcsE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01330";
+NZ_CP027599.1 RefSeq transcript 248323 249894 . - . gene_id "nbis-gene-218"; transcript_id "gene-C7A06_RS01330"; ID "gene-C7A06_RS01330"; Name "bcsE"; Parent "nbis-gene-218"; gbkey "Gene"; gene "bcsE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01330"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 248323 249894 . - . gene_id "nbis-gene-218"; transcript_id "gene-C7A06_RS01330"; Dbxref "Genbank:WP_001204931.1"; ID "nbis-exon-227"; Name "WP_001204931.1"; Ontology_term "GO:0035438"; Parent "gene-C7A06_RS01330"; gbkey "CDS"; gene "bcsE"; go_function "cyclic-di-GMP binding|0035438||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417993.1"; locus_tag "C7A06_RS01330"; product "cellulose biosynthesis protein BcsE"; protein_id "WP_001204931.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 248323 249894 . - 0 gene_id "nbis-gene-218"; transcript_id "gene-C7A06_RS01330"; Dbxref "Genbank:WP_001204931.1"; ID "cds-WP_001204931.1"; Name "WP_001204931.1"; Ontology_term "GO:0035438"; Parent "gene-C7A06_RS01330"; gbkey "CDS"; gene "bcsE"; go_function "cyclic-di-GMP binding|0035438||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417993.1"; locus_tag "C7A06_RS01330"; product "cellulose biosynthesis protein BcsE"; protein_id "WP_001204931.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 250167 250355 . + . gene_id "nbis-gene-219"; ID "nbis-gene-219"; Name "bcsR"; gbkey "Gene"; gene "bcsR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01335";
+NZ_CP027599.1 RefSeq transcript 250167 250355 . + . gene_id "nbis-gene-219"; transcript_id "gene-C7A06_RS01335"; ID "gene-C7A06_RS01335"; Name "bcsR"; Parent "nbis-gene-219"; gbkey "Gene"; gene "bcsR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01335"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 250167 250355 . + . gene_id "nbis-gene-219"; transcript_id "gene-C7A06_RS01335"; Dbxref "Genbank:WP_001063318.1"; ID "nbis-exon-228"; Name "WP_001063318.1"; Parent "gene-C7A06_RS01335"; gbkey "CDS"; gene "bcsR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417992.1"; locus_tag "C7A06_RS01335"; product "cellulose biosynthesis protein BcsR"; protein_id "WP_001063318.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 250167 250355 . + 0 gene_id "nbis-gene-219"; transcript_id "gene-C7A06_RS01335"; Dbxref "Genbank:WP_001063318.1"; ID "cds-WP_001063318.1"; Name "WP_001063318.1"; Parent "gene-C7A06_RS01335"; gbkey "CDS"; gene "bcsR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417992.1"; locus_tag "C7A06_RS01335"; product "cellulose biosynthesis protein BcsR"; protein_id "WP_001063318.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 250367 251119 . + . gene_id "nbis-gene-220"; ID "nbis-gene-220"; Name "bcsQ"; gbkey "Gene"; gene "bcsQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01340";
+NZ_CP027599.1 RefSeq transcript 250367 251119 . + . gene_id "nbis-gene-220"; transcript_id "gene-C7A06_RS01340"; ID "gene-C7A06_RS01340"; Name "bcsQ"; Parent "nbis-gene-220"; gbkey "Gene"; gene "bcsQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01340"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 250367 251119 . + . gene_id "nbis-gene-220"; transcript_id "gene-C7A06_RS01340"; Dbxref "Genbank:WP_000279530.1"; ID "nbis-exon-229"; Name "WP_000279530.1"; Parent "gene-C7A06_RS01340"; gbkey "CDS"; gene "bcsQ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709309.1"; locus_tag "C7A06_RS01340"; product "cellulose biosynthesis protein BcsQ"; protein_id "WP_000279530.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 250367 251119 . + 0 gene_id "nbis-gene-220"; transcript_id "gene-C7A06_RS01340"; Dbxref "Genbank:WP_000279530.1"; ID "cds-WP_000279530.1"; Name "WP_000279530.1"; Parent "gene-C7A06_RS01340"; gbkey "CDS"; gene "bcsQ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709309.1"; locus_tag "C7A06_RS01340"; product "cellulose biosynthesis protein BcsQ"; protein_id "WP_000279530.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 251116 253734 . + . gene_id "nbis-gene-221"; ID "nbis-gene-221"; Name "bcsA"; gbkey "Gene"; gene "bcsA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01345";
+NZ_CP027599.1 RefSeq transcript 251116 253734 . + . gene_id "nbis-gene-221"; transcript_id "gene-C7A06_RS01345"; ID "gene-C7A06_RS01345"; Name "bcsA"; Parent "nbis-gene-221"; gbkey "Gene"; gene "bcsA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01345"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 251116 253734 . + . gene_id "nbis-gene-221"; transcript_id "gene-C7A06_RS01345"; Dbxref "Genbank:WP_000025892.1"; ID "nbis-exon-230"; Name "WP_000025892.1"; Ontology_term "GO:0006011" "GO:0030244" "GO:0016760" "GO:0035438" "GO:0016020"; Parent "gene-C7A06_RS01345"; gbkey "CDS"; gene "bcsA"; go_component "membrane|0016020||IEA"; go_function "cellulose synthase (UDP-forming) activity|0016760||IEA" "cyclic-di-GMP binding|0035438||IEA"; go_process "UDP-glucose metabolic process|0006011||IEA" "cellulose biosynthetic process|0030244||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417990.4"; locus_tag "C7A06_RS01345"; product "UDP-forming cellulose synthase catalytic subunit"; protein_id "WP_000025892.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 251116 253734 . + 0 gene_id "nbis-gene-221"; transcript_id "gene-C7A06_RS01345"; Dbxref "Genbank:WP_000025892.1"; ID "cds-WP_000025892.1"; Name "WP_000025892.1"; Ontology_term "GO:0006011" "GO:0030244" "GO:0016760" "GO:0035438" "GO:0016020"; Parent "gene-C7A06_RS01345"; gbkey "CDS"; gene "bcsA"; go_component "membrane|0016020||IEA"; go_function "cellulose synthase (UDP-forming) activity|0016760||IEA" "cyclic-di-GMP binding|0035438||IEA"; go_process "UDP-glucose metabolic process|0006011||IEA" "cellulose biosynthetic process|0030244||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417990.4"; locus_tag "C7A06_RS01345"; product "UDP-forming cellulose synthase catalytic subunit"; protein_id "WP_000025892.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 253745 256084 . + . gene_id "nbis-gene-222"; ID "nbis-gene-222"; Name "bcsB"; gbkey "Gene"; gene "bcsB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01350";
+NZ_CP027599.1 RefSeq transcript 253745 256084 . + . gene_id "nbis-gene-222"; transcript_id "gene-C7A06_RS01350"; ID "gene-C7A06_RS01350"; Name "bcsB"; Parent "nbis-gene-222"; gbkey "Gene"; gene "bcsB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01350"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 253745 256084 . + . gene_id "nbis-gene-222"; transcript_id "gene-C7A06_RS01350"; Dbxref "Genbank:WP_000823624.1"; ID "nbis-exon-231"; Name "WP_000823624.1"; Parent "gene-C7A06_RS01350"; gbkey "CDS"; gene "bcsB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417989.1"; locus_tag "C7A06_RS01350"; product "cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB"; protein_id "WP_000823624.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 253745 256084 . + 0 gene_id "nbis-gene-222"; transcript_id "gene-C7A06_RS01350"; Dbxref "Genbank:WP_000823624.1"; ID "cds-WP_000823624.1"; Name "WP_000823624.1"; Parent "gene-C7A06_RS01350"; gbkey "CDS"; gene "bcsB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417989.1"; locus_tag "C7A06_RS01350"; product "cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB"; protein_id "WP_000823624.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 256091 257197 . + . gene_id "nbis-gene-223"; ID "nbis-gene-223"; Name "bcsZ"; gbkey "Gene"; gene "bcsZ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01355";
+NZ_CP027599.1 RefSeq transcript 256091 257197 . + . gene_id "nbis-gene-223"; transcript_id "gene-C7A06_RS01355"; ID "gene-C7A06_RS01355"; Name "bcsZ"; Parent "nbis-gene-223"; gbkey "Gene"; gene "bcsZ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01355"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 256091 257197 . + . gene_id "nbis-gene-223"; transcript_id "gene-C7A06_RS01355"; Dbxref "Genbank:WP_001341948.1"; ID "nbis-exon-232"; Name "WP_001341948.1"; Ontology_term "GO:0005975" "GO:0004553"; Parent "gene-C7A06_RS01355"; gbkey "CDS"; gene "bcsZ"; go_function "hydrolase activity, hydrolyzing O-glycosyl compounds|0004553||IEA"; go_process "carbohydrate metabolic process|0005975||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312438.1"; locus_tag "C7A06_RS01355"; product "cellulose synthase complex periplasmic endoglucanase BcsZ"; protein_id "WP_001341948.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 256091 257197 . + 0 gene_id "nbis-gene-223"; transcript_id "gene-C7A06_RS01355"; Dbxref "Genbank:WP_001341948.1"; ID "cds-WP_001341948.1"; Name "WP_001341948.1"; Ontology_term "GO:0005975" "GO:0004553"; Parent "gene-C7A06_RS01355"; gbkey "CDS"; gene "bcsZ"; go_function "hydrolase activity, hydrolyzing O-glycosyl compounds|0004553||IEA"; go_process "carbohydrate metabolic process|0005975||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312438.1"; locus_tag "C7A06_RS01355"; product "cellulose synthase complex periplasmic endoglucanase BcsZ"; protein_id "WP_001341948.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 257179 260652 . + . gene_id "nbis-gene-224"; ID "nbis-gene-224"; Name "bcsC"; gbkey "Gene"; gene "bcsC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01360";
+NZ_CP027599.1 RefSeq transcript 257179 260652 . + . gene_id "nbis-gene-224"; transcript_id "gene-C7A06_RS01360"; ID "gene-C7A06_RS01360"; Name "bcsC"; Parent "nbis-gene-224"; gbkey "Gene"; gene "bcsC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01360"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 257179 260652 . + . gene_id "nbis-gene-224"; transcript_id "gene-C7A06_RS01360"; Dbxref "Genbank:WP_001225108.1"; ID "nbis-exon-233"; Name "WP_001225108.1"; Ontology_term "GO:0030244" "GO:0005515" "GO:0019867"; Parent "gene-C7A06_RS01360"; gbkey "CDS"; gene "bcsC"; go_component "outer membrane|0019867||IEA"; go_function "protein binding|0005515||IEA"; go_process "cellulose biosynthetic process|0030244||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026226.4"; locus_tag "C7A06_RS01360"; product "cellulose synthase complex outer membrane protein BcsC"; protein_id "WP_001225108.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 257179 260652 . + 0 gene_id "nbis-gene-224"; transcript_id "gene-C7A06_RS01360"; Dbxref "Genbank:WP_001225108.1"; ID "cds-WP_001225108.1"; Name "WP_001225108.1"; Ontology_term "GO:0030244" "GO:0005515" "GO:0019867"; Parent "gene-C7A06_RS01360"; gbkey "CDS"; gene "bcsC"; go_component "outer membrane|0019867||IEA"; go_function "protein binding|0005515||IEA"; go_process "cellulose biosynthetic process|0030244||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026226.4"; locus_tag "C7A06_RS01360"; product "cellulose synthase complex outer membrane protein BcsC"; protein_id "WP_001225108.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 260734 262722 . + . gene_id "nbis-gene-225"; ID "nbis-gene-225"; Name "hmsP"; gbkey "Gene"; gene "hmsP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01365";
+NZ_CP027599.1 RefSeq transcript 260734 262722 . + . gene_id "nbis-gene-225"; transcript_id "gene-C7A06_RS01365"; ID "gene-C7A06_RS01365"; Name "hmsP"; Parent "nbis-gene-225"; gbkey "Gene"; gene "hmsP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01365"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 260734 262722 . + . gene_id "nbis-gene-225"; transcript_id "gene-C7A06_RS01365"; Dbxref "Genbank:WP_001266286.1"; ID "nbis-exon-234"; Name "WP_001266286.1"; Ontology_term "GO:0007165"; Parent "gene-C7A06_RS01365"; gbkey "CDS"; gene "hmsP"; go_process "signal transduction|0007165||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417986.4"; locus_tag "C7A06_RS01365"; product "biofilm formation regulator HmsP"; protein_id "WP_001266286.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 260734 262722 . + 0 gene_id "nbis-gene-225"; transcript_id "gene-C7A06_RS01365"; Dbxref "Genbank:WP_001266286.1"; ID "cds-WP_001266286.1"; Name "WP_001266286.1"; Ontology_term "GO:0007165"; Parent "gene-C7A06_RS01365"; gbkey "CDS"; gene "hmsP"; go_process "signal transduction|0007165||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417986.4"; locus_tag "C7A06_RS01365"; product "biofilm formation regulator HmsP"; protein_id "WP_001266286.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 262905 264191 . + . gene_id "nbis-gene-226"; ID "nbis-gene-226"; Name "dctA"; gbkey "Gene"; gene "dctA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01375";
+NZ_CP027599.1 RefSeq transcript 262905 264191 . + . gene_id "nbis-gene-226"; transcript_id "gene-C7A06_RS01375"; ID "gene-C7A06_RS01375"; Name "dctA"; Parent "nbis-gene-226"; gbkey "Gene"; gene "dctA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01375"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 262905 264191 . + . gene_id "nbis-gene-226"; transcript_id "gene-C7A06_RS01375"; Dbxref "Genbank:WP_044164517.1"; ID "nbis-exon-235"; Name "WP_044164517.1"; Parent "gene-C7A06_RS01375"; gbkey "CDS"; gene "dctA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417985.1"; locus_tag "C7A06_RS01375"; product "C4-dicarboxylate transporter DctC"; protein_id "WP_044164517.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 262905 264191 . + 0 gene_id "nbis-gene-226"; transcript_id "gene-C7A06_RS01375"; Dbxref "Genbank:WP_044164517.1"; ID "cds-WP_044164517.1"; Name "WP_044164517.1"; Parent "gene-C7A06_RS01375"; gbkey "CDS"; gene "dctA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417985.1"; locus_tag "C7A06_RS01375"; product "C4-dicarboxylate transporter DctC"; protein_id "WP_044164517.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 264411 265907 . + . gene_id "nbis-gene-227"; ID "nbis-gene-227"; Name "yhjJ"; gbkey "Gene"; gene "yhjJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01385";
+NZ_CP027599.1 RefSeq transcript 264411 265907 . + . gene_id "nbis-gene-227"; transcript_id "gene-C7A06_RS01385"; ID "gene-C7A06_RS01385"; Name "yhjJ"; Parent "nbis-gene-227"; gbkey "Gene"; gene "yhjJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01385"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 264411 265907 . + . gene_id "nbis-gene-227"; transcript_id "gene-C7A06_RS01385"; Dbxref "Genbank:WP_001163135.1"; ID "nbis-exon-236"; Name "WP_001163135.1"; Parent "gene-C7A06_RS01385"; gbkey "CDS"; gene "yhjJ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312434.1"; locus_tag "C7A06_RS01385"; product "insulinase family protein"; protein_id "WP_001163135.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 264411 265907 . + 0 gene_id "nbis-gene-227"; transcript_id "gene-C7A06_RS01385"; Dbxref "Genbank:WP_001163135.1"; ID "cds-WP_001163135.1"; Name "WP_001163135.1"; Parent "gene-C7A06_RS01385"; gbkey "CDS"; gene "yhjJ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312434.1"; locus_tag "C7A06_RS01385"; product "insulinase family protein"; protein_id "WP_001163135.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 266003 266932 . - . gene_id "nbis-gene-228"; ID "nbis-gene-228"; Name "kdgK"; gbkey "Gene"; gene "kdgK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01390";
+NZ_CP027599.1 RefSeq transcript 266003 266932 . - . gene_id "nbis-gene-228"; transcript_id "gene-C7A06_RS01390"; ID "gene-C7A06_RS01390"; Name "kdgK"; Parent "nbis-gene-228"; gbkey "Gene"; gene "kdgK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01390"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 266003 266932 . - . gene_id "nbis-gene-228"; transcript_id "gene-C7A06_RS01390"; Dbxref "Genbank:WP_001296796.1"; ID "nbis-exon-237"; Name "WP_001296796.1"; Parent "gene-C7A06_RS01390"; gbkey "CDS"; gene "kdgK"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417983.2"; locus_tag "C7A06_RS01390"; product "2-dehydro-3-deoxygluconokinase"; protein_id "WP_001296796.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 266003 266932 . - 0 gene_id "nbis-gene-228"; transcript_id "gene-C7A06_RS01390"; Dbxref "Genbank:WP_001296796.1"; ID "cds-WP_001296796.1"; Name "WP_001296796.1"; Parent "gene-C7A06_RS01390"; gbkey "CDS"; gene "kdgK"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417983.2"; locus_tag "C7A06_RS01390"; product "2-dehydro-3-deoxygluconokinase"; protein_id "WP_001296796.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 267164 267931 . + . gene_id "nbis-gene-229"; ID "nbis-gene-229"; Name "pdeH"; gbkey "Gene"; gene "pdeH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01400";
+NZ_CP027599.1 RefSeq transcript 267164 267931 . + . gene_id "nbis-gene-229"; transcript_id "gene-C7A06_RS01400"; ID "gene-C7A06_RS01400"; Name "pdeH"; Parent "nbis-gene-229"; gbkey "Gene"; gene "pdeH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01400"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 267164 267931 . + . gene_id "nbis-gene-229"; transcript_id "gene-C7A06_RS01400"; Dbxref "Genbank:WP_001295219.1"; ID "nbis-exon-238"; Name "WP_001295219.1"; Parent "gene-C7A06_RS01400"; gbkey "CDS"; gene "pdeH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417982.2"; locus_tag "C7A06_RS01400"; product "cyclic-guanylate-specific phosphodiesterase"; protein_id "WP_001295219.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 267164 267931 . + 0 gene_id "nbis-gene-229"; transcript_id "gene-C7A06_RS01400"; Dbxref "Genbank:WP_001295219.1"; ID "cds-WP_001295219.1"; Name "WP_001295219.1"; Parent "gene-C7A06_RS01400"; gbkey "CDS"; gene "pdeH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417982.2"; locus_tag "C7A06_RS01400"; product "cyclic-guanylate-specific phosphodiesterase"; protein_id "WP_001295219.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 268001 270061 . + . gene_id "nbis-gene-230"; ID "nbis-gene-230"; Name "yhjG"; gbkey "Gene"; gene "yhjG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01405";
+NZ_CP027599.1 RefSeq transcript 268001 270061 . + . gene_id "nbis-gene-230"; transcript_id "gene-C7A06_RS01405"; ID "gene-C7A06_RS01405"; Name "yhjG"; Parent "nbis-gene-230"; gbkey "Gene"; gene "yhjG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01405"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 268001 270061 . + . gene_id "nbis-gene-230"; transcript_id "gene-C7A06_RS01405"; Dbxref "Genbank:WP_001344892.1"; ID "nbis-exon-239"; Name "WP_001344892.1"; Parent "gene-C7A06_RS01405"; gbkey "CDS"; gene "yhjG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417981.2"; locus_tag "C7A06_RS01405"; product "AsmA family protein"; protein_id "WP_001344892.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 268001 270061 . + 0 gene_id "nbis-gene-230"; transcript_id "gene-C7A06_RS01405"; Dbxref "Genbank:WP_001344892.1"; ID "cds-WP_001344892.1"; Name "WP_001344892.1"; Parent "gene-C7A06_RS01405"; gbkey "CDS"; gene "yhjG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417981.2"; locus_tag "C7A06_RS01405"; product "AsmA family protein"; protein_id "WP_001344892.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 270295 271617 . - . gene_id "nbis-gene-231"; ID "nbis-gene-231"; Name "yhjE"; gbkey "Gene"; gene "yhjE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01410";
+NZ_CP027599.1 RefSeq transcript 270295 271617 . - . gene_id "nbis-gene-231"; transcript_id "gene-C7A06_RS01410"; ID "gene-C7A06_RS01410"; Name "yhjE"; Parent "nbis-gene-231"; gbkey "Gene"; gene "yhjE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01410"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 270295 271617 . - . gene_id "nbis-gene-231"; transcript_id "gene-C7A06_RS01410"; Dbxref "Genbank:WP_001149002.1"; ID "nbis-exon-240"; Name "WP_001149002.1"; Parent "gene-C7A06_RS01410"; gbkey "CDS"; gene "yhjE"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417980.1"; locus_tag "C7A06_RS01410"; product "MHS family MFS transporter"; protein_id "WP_001149002.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 270295 271617 . - 0 gene_id "nbis-gene-231"; transcript_id "gene-C7A06_RS01410"; Dbxref "Genbank:WP_001149002.1"; ID "cds-WP_001149002.1"; Name "WP_001149002.1"; Parent "gene-C7A06_RS01410"; gbkey "CDS"; gene "yhjE"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417980.1"; locus_tag "C7A06_RS01410"; product "MHS family MFS transporter"; protein_id "WP_001149002.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 272028 273041 . - . gene_id "nbis-gene-232"; ID "nbis-gene-232"; Name "yhjD"; gbkey "Gene"; gene "yhjD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01415";
+NZ_CP027599.1 RefSeq transcript 272028 273041 . - . gene_id "nbis-gene-232"; transcript_id "gene-C7A06_RS01415"; ID "gene-C7A06_RS01415"; Name "yhjD"; Parent "nbis-gene-232"; gbkey "Gene"; gene "yhjD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01415"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 272028 273041 . - . gene_id "nbis-gene-232"; transcript_id "gene-C7A06_RS01415"; Dbxref "Genbank:WP_000191257.1"; ID "nbis-exon-241"; Name "WP_000191257.1"; Parent "gene-C7A06_RS01415"; gbkey "CDS"; gene "yhjD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312429.1"; locus_tag "C7A06_RS01415"; product "inner membrane protein YhjD"; protein_id "WP_000191257.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 272028 273041 . - 0 gene_id "nbis-gene-232"; transcript_id "gene-C7A06_RS01415"; Dbxref "Genbank:WP_000191257.1"; ID "cds-WP_000191257.1"; Name "WP_000191257.1"; Parent "gene-C7A06_RS01415"; gbkey "CDS"; gene "yhjD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312429.1"; locus_tag "C7A06_RS01415"; product "inner membrane protein YhjD"; protein_id "WP_000191257.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 273090 273989 . - . gene_id "nbis-gene-233"; ID "nbis-gene-233"; Name "rcdB"; gbkey "Gene"; gene "rcdB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01420";
+NZ_CP027599.1 RefSeq transcript 273090 273989 . - . gene_id "nbis-gene-233"; transcript_id "gene-C7A06_RS01420"; ID "gene-C7A06_RS01420"; Name "rcdB"; Parent "nbis-gene-233"; gbkey "Gene"; gene "rcdB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01420"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 273090 273989 . - . gene_id "nbis-gene-233"; transcript_id "gene-C7A06_RS01420"; Dbxref "Genbank:WP_001307449.1"; ID "nbis-exon-242"; Name "WP_001307449.1"; Parent "gene-C7A06_RS01420"; gbkey "CDS"; gene "rcdB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417978.2"; locus_tag "C7A06_RS01420"; product "LysR family transcriptional regulator"; protein_id "WP_001307449.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 273090 273989 . - 0 gene_id "nbis-gene-233"; transcript_id "gene-C7A06_RS01420"; Dbxref "Genbank:WP_001307449.1"; ID "cds-WP_001307449.1"; Name "WP_001307449.1"; Parent "gene-C7A06_RS01420"; gbkey "CDS"; gene "rcdB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417978.2"; locus_tag "C7A06_RS01420"; product "LysR family transcriptional regulator"; protein_id "WP_001307449.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 274509 275111 . + . gene_id "nbis-gene-234"; ID "nbis-gene-234"; Name "yhjB"; gbkey "Gene"; gene "yhjB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01425";
+NZ_CP027599.1 RefSeq transcript 274509 275111 . + . gene_id "nbis-gene-234"; transcript_id "gene-C7A06_RS01425"; ID "gene-C7A06_RS01425"; Name "yhjB"; Parent "nbis-gene-234"; gbkey "Gene"; gene "yhjB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01425"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 274509 275111 . + . gene_id "nbis-gene-234"; transcript_id "gene-C7A06_RS01425"; Dbxref "Genbank:WP_001167676.1"; ID "nbis-exon-243"; Name "WP_001167676.1"; Parent "gene-C7A06_RS01425"; gbkey "CDS"; gene "yhjB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417977.1"; locus_tag "C7A06_RS01425"; product "response regulator transcription factor"; protein_id "WP_001167676.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 274509 275111 . + 0 gene_id "nbis-gene-234"; transcript_id "gene-C7A06_RS01425"; Dbxref "Genbank:WP_001167676.1"; ID "cds-WP_001167676.1"; Name "WP_001167676.1"; Parent "gene-C7A06_RS01425"; gbkey "CDS"; gene "yhjB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417977.1"; locus_tag "C7A06_RS01425"; product "response regulator transcription factor"; protein_id "WP_001167676.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 275162 276811 . - . gene_id "nbis-gene-235"; ID "nbis-gene-235"; Name "treF"; gbkey "Gene"; gene "treF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01430";
+NZ_CP027599.1 RefSeq transcript 275162 276811 . - . gene_id "nbis-gene-235"; transcript_id "gene-C7A06_RS01430"; ID "gene-C7A06_RS01430"; Name "treF"; Parent "nbis-gene-235"; gbkey "Gene"; gene "treF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01430"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 275162 276811 . - . gene_id "nbis-gene-235"; transcript_id "gene-C7A06_RS01430"; Dbxref "Genbank:WP_000934218.1"; ID "nbis-exon-244"; Name "WP_000934218.1"; Parent "gene-C7A06_RS01430"; gbkey "CDS"; gene "treF"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709297.1"; locus_tag "C7A06_RS01430"; product "alpha,alpha-trehalase"; protein_id "WP_000934218.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 275162 276811 . - 0 gene_id "nbis-gene-235"; transcript_id "gene-C7A06_RS01430"; Dbxref "Genbank:WP_000934218.1"; ID "cds-WP_000934218.1"; Name "WP_000934218.1"; Parent "gene-C7A06_RS01430"; gbkey "CDS"; gene "treF"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709297.1"; locus_tag "C7A06_RS01430"; product "alpha,alpha-trehalase"; protein_id "WP_000934218.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 277216 278613 . + . gene_id "nbis-gene-236"; ID "nbis-gene-236"; Name "ccp"; gbkey "Gene"; gene "ccp"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01435";
+NZ_CP027599.1 RefSeq transcript 277216 278613 . + . gene_id "nbis-gene-236"; transcript_id "gene-C7A06_RS01435"; ID "gene-C7A06_RS01435"; Name "ccp"; Parent "nbis-gene-236"; gbkey "Gene"; gene "ccp"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01435"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 277216 278613 . + . gene_id "nbis-gene-236"; transcript_id "gene-C7A06_RS01435"; Dbxref "Genbank:WP_000784821.1"; ID "nbis-exon-245"; Name "WP_000784821.1"; Parent "gene-C7A06_RS01435"; gbkey "CDS"; gene "ccp"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312425.1"; locus_tag "C7A06_RS01435"; product "cytochrome c peroxidase"; protein_id "WP_000784821.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 277216 278613 . + 0 gene_id "nbis-gene-236"; transcript_id "gene-C7A06_RS01435"; Dbxref "Genbank:WP_000784821.1"; ID "cds-WP_000784821.1"; Name "WP_000784821.1"; Parent "gene-C7A06_RS01435"; gbkey "CDS"; gene "ccp"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312425.1"; locus_tag "C7A06_RS01435"; product "cytochrome c peroxidase"; protein_id "WP_000784821.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 278824 280224 . + . gene_id "nbis-gene-237"; ID "nbis-gene-237"; Name "gadA"; gbkey "Gene"; gene "gadA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01440";
+NZ_CP027599.1 RefSeq transcript 278824 280224 . + . gene_id "nbis-gene-237"; transcript_id "gene-C7A06_RS01440"; ID "gene-C7A06_RS01440"; Name "gadA"; Parent "nbis-gene-237"; gbkey "Gene"; gene "gadA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01440"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 278824 280224 . + . gene_id "nbis-gene-237"; transcript_id "gene-C7A06_RS01440"; Dbxref "Genbank:WP_000372240.1"; ID "nbis-exon-246"; Name "WP_000372240.1"; Ontology_term "GO:0006540" "GO:0004351"; Parent "gene-C7A06_RS01440"; gbkey "CDS"; gene "gadA"; go_function "glutamate decarboxylase activity|0004351||IEA"; go_process "glutamate decarboxylation to succinate|0006540||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417974.1"; locus_tag "C7A06_RS01440"; product "glutamate decarboxylase"; protein_id "WP_000372240.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 278824 280224 . + 0 gene_id "nbis-gene-237"; transcript_id "gene-C7A06_RS01440"; Dbxref "Genbank:WP_000372240.1"; ID "cds-WP_000372240.1"; Name "WP_000372240.1"; Ontology_term "GO:0006540" "GO:0004351"; Parent "gene-C7A06_RS01440"; gbkey "CDS"; gene "gadA"; go_function "glutamate decarboxylase activity|0004351||IEA"; go_process "glutamate decarboxylation to succinate|0006540||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417974.1"; locus_tag "C7A06_RS01440"; product "glutamate decarboxylase"; protein_id "WP_000372240.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 280594 281418 . + . gene_id "nbis-gene-238"; ID "nbis-gene-238"; Name "gadX"; gbkey "Gene"; gene "gadX"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01445";
+NZ_CP027599.1 RefSeq transcript 280594 281418 . + . gene_id "nbis-gene-238"; transcript_id "gene-C7A06_RS01445"; ID "gene-C7A06_RS01445"; Name "gadX"; Parent "nbis-gene-238"; gbkey "Gene"; gene "gadX"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01445"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 280594 281418 . + . gene_id "nbis-gene-238"; transcript_id "gene-C7A06_RS01445"; Dbxref "Genbank:WP_001191068.1"; ID "nbis-exon-247"; Name "WP_001191068.1"; Parent "gene-C7A06_RS01445"; gbkey "CDS"; gene "gadX"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709339.1"; locus_tag "C7A06_RS01445"; product "acid resistance transcriptional activator GadX"; protein_id "WP_001191068.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 280594 281418 . + 0 gene_id "nbis-gene-238"; transcript_id "gene-C7A06_RS01445"; Dbxref "Genbank:WP_001191068.1"; ID "cds-WP_001191068.1"; Name "WP_001191068.1"; Parent "gene-C7A06_RS01445"; gbkey "CDS"; gene "gadX"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709339.1"; locus_tag "C7A06_RS01445"; product "acid resistance transcriptional activator GadX"; protein_id "WP_001191068.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 281786 282514 . + . gene_id "nbis-gene-239"; ID "nbis-gene-239"; Name "gadW"; gbkey "Gene"; gene "gadW"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01450";
+NZ_CP027599.1 RefSeq transcript 281786 282514 . + . gene_id "nbis-gene-239"; transcript_id "gene-C7A06_RS01450"; ID "gene-C7A06_RS01450"; Name "gadW"; Parent "nbis-gene-239"; gbkey "Gene"; gene "gadW"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01450"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 281786 282514 . + . gene_id "nbis-gene-239"; transcript_id "gene-C7A06_RS01450"; Dbxref "Genbank:WP_000149991.1"; ID "nbis-exon-248"; Name "WP_000149991.1"; Parent "gene-C7A06_RS01450"; gbkey "CDS"; gene "gadW"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312422.1"; locus_tag "C7A06_RS01450"; product "acid resistance transcriptional activator GadW"; protein_id "WP_000149991.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 281786 282514 . + 0 gene_id "nbis-gene-239"; transcript_id "gene-C7A06_RS01450"; Dbxref "Genbank:WP_000149991.1"; ID "cds-WP_000149991.1"; Name "WP_000149991.1"; Parent "gene-C7A06_RS01450"; gbkey "CDS"; gene "gadW"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312422.1"; locus_tag "C7A06_RS01450"; product "acid resistance transcriptional activator GadW"; protein_id "WP_000149991.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 282877 285990 . - . gene_id "nbis-gene-240"; ID "nbis-gene-240"; Name "mdtF"; gbkey "Gene"; gene "mdtF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01460";
+NZ_CP027599.1 RefSeq transcript 282877 285990 . - . gene_id "nbis-gene-240"; transcript_id "gene-C7A06_RS01460"; ID "gene-C7A06_RS01460"; Name "mdtF"; Parent "nbis-gene-240"; gbkey "Gene"; gene "mdtF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01460"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 282877 285990 . - . gene_id "nbis-gene-240"; transcript_id "gene-C7A06_RS01460"; Dbxref "Genbank:WP_000024892.1"; ID "nbis-exon-249"; Name "WP_000024892.1"; Parent "gene-C7A06_RS01460"; gbkey "CDS"; gene "mdtF"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312421.1"; locus_tag "C7A06_RS01460"; product "multidrug efflux pump RND permease MdtF"; protein_id "WP_000024892.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 282877 285990 . - 0 gene_id "nbis-gene-240"; transcript_id "gene-C7A06_RS01460"; Dbxref "Genbank:WP_000024892.1"; ID "cds-WP_000024892.1"; Name "WP_000024892.1"; Parent "gene-C7A06_RS01460"; gbkey "CDS"; gene "mdtF"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312421.1"; locus_tag "C7A06_RS01460"; product "multidrug efflux pump RND permease MdtF"; protein_id "WP_000024892.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 286015 287172 . - . gene_id "nbis-gene-241"; ID "nbis-gene-241"; Name "mdtE"; gbkey "Gene"; gene "mdtE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01465";
+NZ_CP027599.1 RefSeq transcript 286015 287172 . - . gene_id "nbis-gene-241"; transcript_id "gene-C7A06_RS01465"; ID "gene-C7A06_RS01465"; Name "mdtE"; Parent "nbis-gene-241"; gbkey "Gene"; gene "mdtE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01465"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 286015 287172 . - . gene_id "nbis-gene-241"; transcript_id "gene-C7A06_RS01465"; Dbxref "Genbank:WP_001081984.1"; ID "nbis-exon-250"; Name "WP_001081984.1"; Parent "gene-C7A06_RS01465"; gbkey "CDS"; gene "mdtE"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417970.1"; locus_tag "C7A06_RS01465"; product "multidrug transporter subunit MdtE"; protein_id "WP_001081984.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 286015 287172 . - 0 gene_id "nbis-gene-241"; transcript_id "gene-C7A06_RS01465"; Dbxref "Genbank:WP_001081984.1"; ID "cds-WP_001081984.1"; Name "WP_001081984.1"; Parent "gene-C7A06_RS01465"; gbkey "CDS"; gene "mdtE"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417970.1"; locus_tag "C7A06_RS01465"; product "multidrug transporter subunit MdtE"; protein_id "WP_001081984.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 287232 287510 . + . gene_id "nbis-gene-242"; ID "nbis-gene-242"; Name "C7A06_RS01470"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01470";
+NZ_CP027599.1 RefSeq transcript 287232 287510 . + . gene_id "nbis-gene-242"; transcript_id "gene-C7A06_RS01470"; ID "gene-C7A06_RS01470"; Name "C7A06_RS01470"; Parent "nbis-gene-242"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01470"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 287232 287510 . + . gene_id "nbis-gene-242"; transcript_id "gene-C7A06_RS01470"; Dbxref "Genbank:WP_001205329.1"; ID "nbis-exon-251"; Name "WP_001205329.1"; Parent "gene-C7A06_RS01470"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502656.1"; locus_tag "C7A06_RS01470"; product "hypothetical protein"; protein_id "WP_001205329.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 287232 287510 . + 0 gene_id "nbis-gene-242"; transcript_id "gene-C7A06_RS01470"; Dbxref "Genbank:WP_001205329.1"; ID "cds-WP_001205329.1"; Name "WP_001205329.1"; Parent "gene-C7A06_RS01470"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502656.1"; locus_tag "C7A06_RS01470"; product "hypothetical protein"; protein_id "WP_001205329.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 287511 288038 . - . gene_id "nbis-gene-243"; ID "nbis-gene-243"; Name "gadE"; gbkey "Gene"; gene "gadE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01475";
+NZ_CP027599.1 RefSeq transcript 287511 288038 . - . gene_id "nbis-gene-243"; transcript_id "gene-C7A06_RS01475"; ID "gene-C7A06_RS01475"; Name "gadE"; Parent "nbis-gene-243"; gbkey "Gene"; gene "gadE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01475"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 287511 288038 . - . gene_id "nbis-gene-243"; transcript_id "gene-C7A06_RS01475"; Dbxref "Genbank:WP_000576690.1"; ID "nbis-exon-252"; Name "WP_000576690.1"; Parent "gene-C7A06_RS01475"; gbkey "CDS"; gene "gadE"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312419.1"; locus_tag "C7A06_RS01475"; product "acid resistance transcriptional activator GadE"; protein_id "WP_000576690.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 287511 288038 . - 0 gene_id "nbis-gene-243"; transcript_id "gene-C7A06_RS01475"; Dbxref "Genbank:WP_000576690.1"; ID "cds-WP_000576690.1"; Name "WP_000576690.1"; Parent "gene-C7A06_RS01475"; gbkey "CDS"; gene "gadE"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312419.1"; locus_tag "C7A06_RS01475"; product "acid resistance transcriptional activator GadE"; protein_id "WP_000576690.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 288837 289409 . - . gene_id "nbis-gene-244"; ID "nbis-gene-244"; Name "hdeD"; gbkey "Gene"; gene "hdeD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01480";
+NZ_CP027599.1 RefSeq transcript 288837 289409 . - . gene_id "nbis-gene-244"; transcript_id "gene-C7A06_RS01480"; ID "gene-C7A06_RS01480"; Name "hdeD"; Parent "nbis-gene-244"; gbkey "Gene"; gene "hdeD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01480"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 288837 289409 . - . gene_id "nbis-gene-244"; transcript_id "gene-C7A06_RS01480"; Dbxref "Genbank:WP_000965672.1"; ID "nbis-exon-253"; Name "WP_000965672.1"; Parent "gene-C7A06_RS01480"; gbkey "CDS"; gene "hdeD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312418.1"; locus_tag "C7A06_RS01480"; product "acid-resistance protein HdeD"; protein_id "WP_000965672.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 288837 289409 . - 0 gene_id "nbis-gene-244"; transcript_id "gene-C7A06_RS01480"; Dbxref "Genbank:WP_000965672.1"; ID "cds-WP_000965672.1"; Name "WP_000965672.1"; Parent "gene-C7A06_RS01480"; gbkey "CDS"; gene "hdeD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312418.1"; locus_tag "C7A06_RS01480"; product "acid-resistance protein HdeD"; protein_id "WP_000965672.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 289664 289996 . + . gene_id "nbis-gene-245"; ID "nbis-gene-245"; Name "hdeA"; gbkey "Gene"; gene "hdeA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01485";
+NZ_CP027599.1 RefSeq transcript 289664 289996 . + . gene_id "nbis-gene-245"; transcript_id "gene-C7A06_RS01485"; ID "gene-C7A06_RS01485"; Name "hdeA"; Parent "nbis-gene-245"; gbkey "Gene"; gene "hdeA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01485"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 289664 289996 . + . gene_id "nbis-gene-245"; transcript_id "gene-C7A06_RS01485"; Dbxref "Genbank:WP_000756550.1"; ID "nbis-exon-254"; Name "WP_000756550.1"; Parent "gene-C7A06_RS01485"; gbkey "CDS"; gene "hdeA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312417.1"; locus_tag "C7A06_RS01485"; product "acid-activated periplasmic chaperone HdeA"; protein_id "WP_000756550.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 289664 289996 . + 0 gene_id "nbis-gene-245"; transcript_id "gene-C7A06_RS01485"; Dbxref "Genbank:WP_000756550.1"; ID "cds-WP_000756550.1"; Name "WP_000756550.1"; Parent "gene-C7A06_RS01485"; gbkey "CDS"; gene "hdeA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312417.1"; locus_tag "C7A06_RS01485"; product "acid-activated periplasmic chaperone HdeA"; protein_id "WP_000756550.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 290112 290438 . + . gene_id "nbis-gene-246"; ID "nbis-gene-246"; Name "hdeB"; gbkey "Gene"; gene "hdeB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01490";
+NZ_CP027599.1 RefSeq transcript 290112 290438 . + . gene_id "nbis-gene-246"; transcript_id "gene-C7A06_RS01490"; ID "gene-C7A06_RS01490"; Name "hdeB"; Parent "nbis-gene-246"; gbkey "Gene"; gene "hdeB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01490"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 290112 290438 . + . gene_id "nbis-gene-246"; transcript_id "gene-C7A06_RS01490"; Dbxref "Genbank:WP_001298717.1"; ID "nbis-exon-255"; Name "WP_001298717.1"; Parent "gene-C7A06_RS01490"; gbkey "CDS"; gene "hdeB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417966.4"; locus_tag "C7A06_RS01490"; product "acid-activated periplasmic chaperone HdeB"; protein_id "WP_001298717.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 290112 290438 . + 0 gene_id "nbis-gene-246"; transcript_id "gene-C7A06_RS01490"; Dbxref "Genbank:WP_001298717.1"; ID "cds-WP_001298717.1"; Name "WP_001298717.1"; Parent "gene-C7A06_RS01490"; gbkey "CDS"; gene "hdeB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417966.4"; locus_tag "C7A06_RS01490"; product "acid-activated periplasmic chaperone HdeB"; protein_id "WP_001298717.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 290502 291149 . + . gene_id "nbis-gene-247"; ID "nbis-gene-247"; Name "yhiD"; gbkey "Gene"; gene "yhiD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01495";
+NZ_CP027599.1 RefSeq transcript 290502 291149 . + . gene_id "nbis-gene-247"; transcript_id "gene-C7A06_RS01495"; ID "gene-C7A06_RS01495"; Name "yhiD"; Parent "nbis-gene-247"; gbkey "Gene"; gene "yhiD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01495"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 290502 291149 . + . gene_id "nbis-gene-247"; transcript_id "gene-C7A06_RS01495"; Dbxref "Genbank:WP_001341943.1"; ID "nbis-exon-256"; Name "WP_001341943.1"; Parent "gene-C7A06_RS01495"; gbkey "CDS"; gene "yhiD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417965.1"; locus_tag "C7A06_RS01495"; product "MgtC/SapB family protein"; protein_id "WP_001341943.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 290502 291149 . + 0 gene_id "nbis-gene-247"; transcript_id "gene-C7A06_RS01495"; Dbxref "Genbank:WP_001341943.1"; ID "cds-WP_001341943.1"; Name "WP_001341943.1"; Parent "gene-C7A06_RS01495"; gbkey "CDS"; gene "yhiD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417965.1"; locus_tag "C7A06_RS01495"; product "MgtC/SapB family protein"; protein_id "WP_001341943.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 291191 291721 . - . gene_id "nbis-gene-248"; ID "nbis-gene-248"; Name "dctR"; gbkey "Gene"; gene "dctR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01500";
+NZ_CP027599.1 RefSeq transcript 291191 291721 . - . gene_id "nbis-gene-248"; transcript_id "gene-C7A06_RS01500"; ID "gene-C7A06_RS01500"; Name "dctR"; Parent "nbis-gene-248"; gbkey "Gene"; gene "dctR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01500"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 291191 291721 . - . gene_id "nbis-gene-248"; transcript_id "gene-C7A06_RS01500"; Dbxref "Genbank:WP_000478623.1"; ID "nbis-exon-257"; Name "WP_000478623.1"; Ontology_term "GO:0006355"; Parent "gene-C7A06_RS01500"; gbkey "CDS"; gene "dctR"; go_process "regulation of transcription, DNA-templated|0006355||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709290.2"; locus_tag "C7A06_RS01500"; product "LuxR C-terminal-related transcriptional regulator"; protein_id "WP_000478623.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 291191 291721 . - 0 gene_id "nbis-gene-248"; transcript_id "gene-C7A06_RS01500"; Dbxref "Genbank:WP_000478623.1"; ID "cds-WP_000478623.1"; Name "WP_000478623.1"; Ontology_term "GO:0006355"; Parent "gene-C7A06_RS01500"; gbkey "CDS"; gene "dctR"; go_process "regulation of transcription, DNA-templated|0006355||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709290.2"; locus_tag "C7A06_RS01500"; product "LuxR C-terminal-related transcriptional regulator"; protein_id "WP_000478623.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 291877 292443 . - . gene_id "nbis-gene-249"; ID "nbis-gene-249"; Name "slp"; gbkey "Gene"; gene "slp"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01510";
+NZ_CP027599.1 RefSeq transcript 291877 292443 . - . gene_id "nbis-gene-249"; transcript_id "gene-C7A06_RS01510"; ID "gene-C7A06_RS01510"; Name "slp"; Parent "nbis-gene-249"; gbkey "Gene"; gene "slp"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01510"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 291877 292443 . - . gene_id "nbis-gene-249"; transcript_id "gene-C7A06_RS01510"; Dbxref "Genbank:WP_001057453.1"; ID "nbis-exon-258"; Name "WP_001057453.1"; Parent "gene-C7A06_RS01510"; gbkey "CDS"; gene "slp"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312404.2"; locus_tag "C7A06_RS01510"; product "outer membrane lipoprotein Slp"; protein_id "WP_001057453.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 291877 292443 . - 0 gene_id "nbis-gene-249"; transcript_id "gene-C7A06_RS01510"; Dbxref "Genbank:WP_001057453.1"; ID "cds-WP_001057453.1"; Name "WP_001057453.1"; Parent "gene-C7A06_RS01510"; gbkey "CDS"; gene "slp"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312404.2"; locus_tag "C7A06_RS01510"; product "outer membrane lipoprotein Slp"; protein_id "WP_001057453.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 292798 293913 . - . gene_id "nbis-pseudogene-291"; ID "nbis-pseudogene-291"; Name "C7A06_RS34385"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34385"; original_biotype "pseudogene"; pseudo "true";
+NZ_CP027599.1 RefSeq transcript 292798 293913 . - . gene_id "nbis-pseudogene-291"; transcript_id "gene-C7A06_RS34385"; ID "gene-C7A06_RS34385"; Name "C7A06_RS34385"; Parent "nbis-pseudogene-291"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34385"; original_biotype "mrna"; pseudo "true";
+NZ_CP027599.1 Protein Homology exon 292798 293913 . - . gene_id "nbis-pseudogene-291"; transcript_id "gene-C7A06_RS34385"; ID "nbis-exon-6064"; Note "frameshifted; internal stop"; Parent "gene-C7A06_RS34385"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312403.1"; locus_tag "C7A06_RS34385"; product "hypothetical protein"; pseudo "true"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 292798 293913 . - 0 gene_id "nbis-pseudogene-291"; transcript_id "gene-C7A06_RS34385"; ID "cds-C7A06_RS34385"; Note "frameshifted; internal stop"; Parent "gene-C7A06_RS34385"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312403.1"; locus_tag "C7A06_RS34385"; product "hypothetical protein"; pseudo "true"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 294493 295494 . - . gene_id "nbis-gene-250"; ID "nbis-gene-250"; Name "C7A06_RS01520"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01520";
+NZ_CP027599.1 RefSeq transcript 294493 295494 . - . gene_id "nbis-gene-250"; transcript_id "gene-C7A06_RS01520"; ID "gene-C7A06_RS01520"; Name "C7A06_RS01520"; Parent "nbis-gene-250"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01520"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 294493 295494 . - . gene_id "nbis-gene-250"; transcript_id "gene-C7A06_RS01520"; Dbxref "Genbank:WP_000100276.1"; ID "nbis-exon-259"; Name "WP_000100276.1"; Parent "gene-C7A06_RS01520"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000100290.1"; locus_tag "C7A06_RS01520"; product "permease"; protein_id "WP_000100276.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 294493 295494 . - 0 gene_id "nbis-gene-250"; transcript_id "gene-C7A06_RS01520"; Dbxref "Genbank:WP_000100276.1"; ID "cds-WP_000100276.1"; Name "WP_000100276.1"; Parent "gene-C7A06_RS01520"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000100290.1"; locus_tag "C7A06_RS01520"; product "permease"; protein_id "WP_000100276.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 295601 295897 . + . gene_id "nbis-gene-251"; ID "nbis-gene-251"; Name "C7A06_RS01525"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01525";
+NZ_CP027599.1 RefSeq transcript 295601 295897 . + . gene_id "nbis-gene-251"; transcript_id "gene-C7A06_RS01525"; ID "gene-C7A06_RS01525"; Name "C7A06_RS01525"; Parent "nbis-gene-251"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01525"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 295601 295897 . + . gene_id "nbis-gene-251"; transcript_id "gene-C7A06_RS01525"; Dbxref "Genbank:WP_001175589.1"; ID "nbis-exon-260"; Name "WP_001175589.1"; Parent "gene-C7A06_RS01525"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001465662.1"; locus_tag "C7A06_RS01525"; product "helix-turn-helix domain-containing protein"; protein_id "WP_001175589.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 295601 295897 . + 0 gene_id "nbis-gene-251"; transcript_id "gene-C7A06_RS01525"; Dbxref "Genbank:WP_001175589.1"; ID "cds-WP_001175589.1"; Name "WP_001175589.1"; Parent "gene-C7A06_RS01525"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001465662.1"; locus_tag "C7A06_RS01525"; product "helix-turn-helix domain-containing protein"; protein_id "WP_001175589.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 296031 296456 . - . gene_id "nbis-gene-252"; ID "nbis-gene-252"; Name "arsC"; gbkey "Gene"; gene "arsC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01530";
+NZ_CP027599.1 RefSeq transcript 296031 296456 . - . gene_id "nbis-gene-252"; transcript_id "gene-C7A06_RS01530"; ID "gene-C7A06_RS01530"; Name "arsC"; Parent "nbis-gene-252"; gbkey "Gene"; gene "arsC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01530"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 296031 296456 . - . gene_id "nbis-gene-252"; transcript_id "gene-C7A06_RS01530"; Dbxref "Genbank:WP_000065769.1"; ID "nbis-exon-261"; Name "WP_000065769.1"; Ontology_term "GO:0008794"; Parent "gene-C7A06_RS01530"; gbkey "CDS"; gene "arsC"; go_function "arsenate reductase (glutaredoxin) activity|0008794||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417960.1"; locus_tag "C7A06_RS01530"; product "glutaredoxin-dependent arsenate reductase"; protein_id "WP_000065769.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 296031 296456 . - 0 gene_id "nbis-gene-252"; transcript_id "gene-C7A06_RS01530"; Dbxref "Genbank:WP_000065769.1"; ID "cds-WP_000065769.1"; Name "WP_000065769.1"; Ontology_term "GO:0008794"; Parent "gene-C7A06_RS01530"; gbkey "CDS"; gene "arsC"; go_function "arsenate reductase (glutaredoxin) activity|0008794||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417960.1"; locus_tag "C7A06_RS01530"; product "glutaredoxin-dependent arsenate reductase"; protein_id "WP_000065769.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 296469 297758 . - . gene_id "nbis-gene-253"; ID "nbis-gene-253"; Name "arsB"; gbkey "Gene"; gene "arsB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01535";
+NZ_CP027599.1 RefSeq transcript 296469 297758 . - . gene_id "nbis-gene-253"; transcript_id "gene-C7A06_RS01535"; ID "gene-C7A06_RS01535"; Name "arsB"; Parent "nbis-gene-253"; gbkey "Gene"; gene "arsB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01535"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 296469 297758 . - . gene_id "nbis-gene-253"; transcript_id "gene-C7A06_RS01535"; Dbxref "Genbank:WP_000922639.1"; ID "nbis-exon-262"; Name "WP_000922639.1"; Parent "gene-C7A06_RS01535"; gbkey "CDS"; gene "arsB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312401.1"; locus_tag "C7A06_RS01535"; product "arsenite/antimonite:H(+) antiporter ArsB"; protein_id "WP_000922639.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 296469 297758 . - 0 gene_id "nbis-gene-253"; transcript_id "gene-C7A06_RS01535"; Dbxref "Genbank:WP_000922639.1"; ID "cds-WP_000922639.1"; Name "WP_000922639.1"; Parent "gene-C7A06_RS01535"; gbkey "CDS"; gene "arsB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312401.1"; locus_tag "C7A06_RS01535"; product "arsenite/antimonite:H(+) antiporter ArsB"; protein_id "WP_000922639.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 297812 298165 . - . gene_id "nbis-gene-254"; ID "nbis-gene-254"; Name "arsR"; gbkey "Gene"; gene "arsR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01540";
+NZ_CP027599.1 RefSeq transcript 297812 298165 . - . gene_id "nbis-gene-254"; transcript_id "gene-C7A06_RS01540"; ID "gene-C7A06_RS01540"; Name "arsR"; Parent "nbis-gene-254"; gbkey "Gene"; gene "arsR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01540"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 297812 298165 . - . gene_id "nbis-gene-254"; transcript_id "gene-C7A06_RS01540"; Dbxref "Genbank:WP_000008957.1"; ID "nbis-exon-263"; Name "WP_000008957.1"; Parent "gene-C7A06_RS01540"; gbkey "CDS"; gene "arsR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417958.1"; locus_tag "C7A06_RS01540"; product "As(III)-sensing metalloregulatory transcriptional repressor ArsR"; protein_id "WP_000008957.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 297812 298165 . - 0 gene_id "nbis-gene-254"; transcript_id "gene-C7A06_RS01540"; Dbxref "Genbank:WP_000008957.1"; ID "cds-WP_000008957.1"; Name "WP_000008957.1"; Parent "gene-C7A06_RS01540"; gbkey "CDS"; gene "arsR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417958.1"; locus_tag "C7A06_RS01540"; product "As(III)-sensing metalloregulatory transcriptional repressor ArsR"; protein_id "WP_000008957.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 298905 298988 . + . gene_id "nbis-gene-255"; ID "nbis-gene-255"; Name "dinQ"; gbkey "Gene"; gene "dinQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01550";
+NZ_CP027599.1 RefSeq transcript 298905 298988 . + . gene_id "nbis-gene-255"; transcript_id "gene-C7A06_RS01550"; ID "gene-C7A06_RS01550"; Name "dinQ"; Parent "nbis-gene-255"; gbkey "Gene"; gene "dinQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01550"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 298905 298988 . + . gene_id "nbis-gene-255"; transcript_id "gene-C7A06_RS01550"; Dbxref "Genbank:WP_001295215.1"; ID "nbis-exon-264"; Name "WP_001295215.1"; Parent "gene-C7A06_RS01550"; gbkey "CDS"; gene "dinQ"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_001165328.2"; locus_tag "C7A06_RS01550"; product "hypothetical protein"; protein_id "WP_001295215.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 298905 298988 . + 0 gene_id "nbis-gene-255"; transcript_id "gene-C7A06_RS01550"; Dbxref "Genbank:WP_001295215.1"; ID "cds-WP_001295215.1"; Name "WP_001295215.1"; Parent "gene-C7A06_RS01550"; gbkey "CDS"; gene "dinQ"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_001165328.2"; locus_tag "C7A06_RS01550"; product "hypothetical protein"; protein_id "WP_001295215.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 299042 300394 . - . gene_id "nbis-gene-256"; ID "nbis-gene-256"; Name "gorA"; gbkey "Gene"; gene "gorA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01555";
+NZ_CP027599.1 RefSeq transcript 299042 300394 . - . gene_id "nbis-gene-256"; transcript_id "gene-C7A06_RS01555"; ID "gene-C7A06_RS01555"; Name "gorA"; Parent "nbis-gene-256"; gbkey "Gene"; gene "gorA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01555"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 299042 300394 . - . gene_id "nbis-gene-256"; transcript_id "gene-C7A06_RS01555"; Dbxref "Genbank:WP_000160808.1"; ID "nbis-exon-265"; Name "WP_000160808.1"; Ontology_term "GO:0006749" "GO:0045454" "GO:0004362" "GO:0050660" "GO:0050661"; Parent "gene-C7A06_RS01555"; gbkey "CDS"; gene "gorA"; go_function "glutathione-disulfide reductase (NADPH) activity|0004362||IEA" "flavin adenine dinucleotide binding|0050660||IEA" "NADP binding|0050661||IEA"; go_process "glutathione metabolic process|0006749||IEA" "cell redox homeostasis|0045454||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_003861215.1"; locus_tag "C7A06_RS01555"; product "glutathione-disulfide reductase"; protein_id "WP_000160808.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 299042 300394 . - 0 gene_id "nbis-gene-256"; transcript_id "gene-C7A06_RS01555"; Dbxref "Genbank:WP_000160808.1"; ID "cds-WP_000160808.1"; Name "WP_000160808.1"; Ontology_term "GO:0006749" "GO:0045454" "GO:0004362" "GO:0050660" "GO:0050661"; Parent "gene-C7A06_RS01555"; gbkey "CDS"; gene "gorA"; go_function "glutathione-disulfide reductase (NADPH) activity|0004362||IEA" "flavin adenine dinucleotide binding|0050660||IEA" "NADP binding|0050661||IEA"; go_process "glutathione metabolic process|0006749||IEA" "cell redox homeostasis|0045454||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_003861215.1"; locus_tag "C7A06_RS01555"; product "glutathione-disulfide reductase"; protein_id "WP_000160808.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 300466 301308 . - . gene_id "nbis-gene-257"; ID "nbis-gene-257"; Name "rlmJ"; gbkey "Gene"; gene "rlmJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01560";
+NZ_CP027599.1 RefSeq transcript 300466 301308 . - . gene_id "nbis-gene-257"; transcript_id "gene-C7A06_RS01560"; ID "gene-C7A06_RS01560"; Name "rlmJ"; Parent "nbis-gene-257"; gbkey "Gene"; gene "rlmJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01560"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 300466 301308 . - . gene_id "nbis-gene-257"; transcript_id "gene-C7A06_RS01560"; Dbxref "Genbank:WP_000954225.1"; ID "nbis-exon-266"; Name "WP_000954225.1"; Parent "gene-C7A06_RS01560"; gbkey "CDS"; gene "rlmJ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312398.1"; locus_tag "C7A06_RS01560"; product "23S rRNA (adenine(2030)-N(6))-methyltransferase"; protein_id "WP_000954225.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 300466 301308 . - 0 gene_id "nbis-gene-257"; transcript_id "gene-C7A06_RS01560"; Dbxref "Genbank:WP_000954225.1"; ID "cds-WP_000954225.1"; Name "WP_000954225.1"; Parent "gene-C7A06_RS01560"; gbkey "CDS"; gene "rlmJ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312398.1"; locus_tag "C7A06_RS01560"; product "23S rRNA (adenine(2030)-N(6))-methyltransferase"; protein_id "WP_000954225.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 301511 303553 . + . gene_id "nbis-gene-258"; ID "nbis-gene-258"; Name "prlC"; gbkey "Gene"; gene "prlC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01565";
+NZ_CP027599.1 RefSeq transcript 301511 303553 . + . gene_id "nbis-gene-258"; transcript_id "gene-C7A06_RS01565"; ID "gene-C7A06_RS01565"; Name "prlC"; Parent "nbis-gene-258"; gbkey "Gene"; gene "prlC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01565"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 301511 303553 . + . gene_id "nbis-gene-258"; transcript_id "gene-C7A06_RS01565"; Dbxref "Genbank:WP_001341942.1"; ID "nbis-exon-267"; Name "WP_001341942.1"; Ontology_term "GO:0006508" "GO:0004222"; Parent "gene-C7A06_RS01565"; gbkey "CDS"; gene "prlC"; go_function "metalloendopeptidase activity|0004222||IEA"; go_process "proteolysis|0006508||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020317218.1"; locus_tag "C7A06_RS01565"; product "oligopeptidase A"; protein_id "WP_001341942.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 301511 303553 . + 0 gene_id "nbis-gene-258"; transcript_id "gene-C7A06_RS01565"; Dbxref "Genbank:WP_001341942.1"; ID "cds-WP_001341942.1"; Name "WP_001341942.1"; Ontology_term "GO:0006508" "GO:0004222"; Parent "gene-C7A06_RS01565"; gbkey "CDS"; gene "prlC"; go_function "metalloendopeptidase activity|0004222||IEA"; go_process "proteolysis|0006508||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020317218.1"; locus_tag "C7A06_RS01565"; product "oligopeptidase A"; protein_id "WP_001341942.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 303561 304313 . + . gene_id "nbis-gene-259"; ID "nbis-gene-259"; Name "rsmJ"; gbkey "Gene"; gene "rsmJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01570";
+NZ_CP027599.1 RefSeq transcript 303561 304313 . + . gene_id "nbis-gene-259"; transcript_id "gene-C7A06_RS01570"; ID "gene-C7A06_RS01570"; Name "rsmJ"; Parent "nbis-gene-259"; gbkey "Gene"; gene "rsmJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01570"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 303561 304313 . + . gene_id "nbis-gene-259"; transcript_id "gene-C7A06_RS01570"; Dbxref "Genbank:WP_000686608.1"; ID "nbis-exon-268"; Name "WP_000686608.1"; Ontology_term "GO:0031167" "GO:0008990"; Parent "gene-C7A06_RS01570"; gbkey "CDS"; gene "rsmJ"; go_function "rRNA (guanine-N2-)-methyltransferase activity|0008990||IEA"; go_process "rRNA methylation|0031167||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709277.2"; locus_tag "C7A06_RS01570"; product "16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ"; protein_id "WP_000686608.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 303561 304313 . + 0 gene_id "nbis-gene-259"; transcript_id "gene-C7A06_RS01570"; Dbxref "Genbank:WP_000686608.1"; ID "cds-WP_000686608.1"; Name "WP_000686608.1"; Ontology_term "GO:0031167" "GO:0008990"; Parent "gene-C7A06_RS01570"; gbkey "CDS"; gene "rsmJ"; go_function "rRNA (guanine-N2-)-methyltransferase activity|0008990||IEA"; go_process "rRNA methylation|0031167||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709277.2"; locus_tag "C7A06_RS01570"; product "16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ"; protein_id "WP_000686608.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 304362 305831 . - . gene_id "nbis-gene-260"; ID "nbis-gene-260"; Name "dtpB"; gbkey "Gene"; gene "dtpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01575";
+NZ_CP027599.1 RefSeq transcript 304362 305831 . - . gene_id "nbis-gene-260"; transcript_id "gene-C7A06_RS01575"; ID "gene-C7A06_RS01575"; Name "dtpB"; Parent "nbis-gene-260"; gbkey "Gene"; gene "dtpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01575"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 304362 305831 . - . gene_id "nbis-gene-260"; transcript_id "gene-C7A06_RS01575"; Dbxref "Genbank:WP_001098647.1"; ID "nbis-exon-269"; Name "WP_001098647.1"; Parent "gene-C7A06_RS01575"; gbkey "CDS"; gene "dtpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417953.1"; locus_tag "C7A06_RS01575"; product "dipeptide/tripeptide permease DtpB"; protein_id "WP_001098647.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 304362 305831 . - 0 gene_id "nbis-gene-260"; transcript_id "gene-C7A06_RS01575"; Dbxref "Genbank:WP_001098647.1"; ID "cds-WP_001098647.1"; Name "WP_001098647.1"; Parent "gene-C7A06_RS01575"; gbkey "CDS"; gene "dtpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417953.1"; locus_tag "C7A06_RS01575"; product "dipeptide/tripeptide permease DtpB"; protein_id "WP_001098647.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 305997 306050 . + . gene_id "nbis-gene-5809"; ID "nbis-gene-5809"; Name "C7A06_RS34680"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34680";
+NZ_CP027599.1 RefSeq transcript 305997 306050 . + . gene_id "nbis-gene-5809"; transcript_id "gene-C7A06_RS34680"; ID "gene-C7A06_RS34680"; Name "C7A06_RS34680"; Parent "nbis-gene-5809"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34680"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 305997 306050 . + . gene_id "nbis-gene-5809"; transcript_id "gene-C7A06_RS34680"; Dbxref "Genbank:WP_212591402.1"; ID "nbis-exon-6118"; Name "WP_212591402.1"; Parent "gene-C7A06_RS34680"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_010051205.1"; locus_tag "C7A06_RS34680"; product "hypothetical protein"; protein_id "WP_212591402.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 305997 306050 . + 0 gene_id "nbis-gene-5809"; transcript_id "gene-C7A06_RS34680"; Dbxref "Genbank:WP_212591402.1"; ID "cds-WP_212591402.1"; Name "WP_212591402.1"; Parent "gene-C7A06_RS34680"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_010051205.1"; locus_tag "C7A06_RS34680"; product "hypothetical protein"; protein_id "WP_212591402.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 306149 306583 . - . gene_id "nbis-gene-261"; ID "nbis-gene-261"; Name "uspA"; gbkey "Gene"; gene "uspA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01585";
+NZ_CP027599.1 RefSeq transcript 306149 306583 . - . gene_id "nbis-gene-261"; transcript_id "gene-C7A06_RS01585"; ID "gene-C7A06_RS01585"; Name "uspA"; Parent "nbis-gene-261"; gbkey "Gene"; gene "uspA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01585"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 306149 306583 . - . gene_id "nbis-gene-261"; transcript_id "gene-C7A06_RS01585"; Dbxref "Genbank:WP_000323571.1"; ID "nbis-exon-270"; Name "WP_000323571.1"; Parent "gene-C7A06_RS01585"; gbkey "CDS"; gene "uspA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312394.1"; locus_tag "C7A06_RS01585"; product "universal stress protein UspA"; protein_id "WP_000323571.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 306149 306583 . - 0 gene_id "nbis-gene-261"; transcript_id "gene-C7A06_RS01585"; Dbxref "Genbank:WP_000323571.1"; ID "cds-WP_000323571.1"; Name "WP_000323571.1"; Parent "gene-C7A06_RS01585"; gbkey "CDS"; gene "uspA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312394.1"; locus_tag "C7A06_RS01585"; product "universal stress protein UspA"; protein_id "WP_000323571.1"; transl_table "11";
\ No newline at end of file
diff -r 000000000000 -r cffa21bb7a92 test-data/annotation_broken.gff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/annotation_broken.gff Tue May 23 13:42:43 2023 +0000
@@ -0,0 +1,44 @@
+##gff-version 3
+##gtf-version 3
+#!gff-spec-version 1.21
+#!processor NCBI annotwriter
+#!genome-build ASM301845v1
+#!genome-build-accession NCBI_Assembly:GCF_003018455.1
+#!annotation-date 05/25/2022 04:54:31
+#!annotation-source NCBI RefSeq
+##sequence-region NZ_CP027599.1 1 5942969
+##species https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=562
+NZ_CP027599.1 RefSeq gene 1052 2152 . + . ID=nbis-gene-2;Name=dnaN;gbkey=Gene;gene=dnaN;gene_biotype=protein_coding;gene_id=nbis-gene-2;locus_tag=C7A06_RS00010
+NZ_CP027599.1 RefSeq transcript 1052 2152 . + . ID=gene-C7A06_RS00010;Parent=nbis-gene-2;Name=dnaN;gbkey=Gene;gene=dnaN;gene_biotype=protein_coding;gene_id=nbis-gene-2;locus_tag=C7A06_RS00010;original_biotype=mrna;transcript_id=gene-C7A06_RS00010
+NZ_CP027599.1 Protein Homology exon 1052 2152 . + . ID=nbis-exon-2;Parent=gene-C7A06_RS00010;Dbxref=Genbank:WP_000673464.1;Name=WP_000673464.1;Ontology_term=GO:0006260,GO:0003887,GO:0009360;gbkey=CDS;gene=dnaN;gene_id=nbis-gene-2;go_component=DNA polymerase III complex|0009360||IEA;go_function=DNA-directed DNA polymerase activity|0003887||IEA;go_process=DNA replication|0006260||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1;locus_tag=C7A06_RS00010;product=DNA polymerase III subunit beta;protein_id=WP_000673464.1;transcript_id=gene-C7A06_RS00010;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 1052 2152 . + 0 ID=cds-WP_000673464.1;Parent=gene-C7A06_RS00010;Dbxref=Genbank:WP_000673464.1;Name=WP_000673464.1;Ontology_term=GO:0006260,GO:0003887,GO:0009360;gbkey=CDS;gene=dnaN;gene_id=nbis-gene-2;go_component=DNA polymerase III complex|0009360||IEA;go_function=DNA-directed DNA polymerase activity|0003887||IEA;go_process=DNA replication|0006260||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1;locus_tag=C7A06_RS00010;product=DNA polymerase III subunit beta;protein_id=WP_000673464.1;transcript_id=gene-C7A06_RS00010;transl_table=11
+NZ_CP027599.1 RefSeq gene 2152 3225 . + . ID=nbis-gene-3;Name=recF;gbkey=Gene;gene=recF;gene_biotype=protein_coding;gene_id=nbis-gene-3;locus_tag=C7A06_RS00015
+NZ_CP027599.1 RefSeq transcript 2152 3225 . + . ID=gene-C7A06_RS00015;Parent=nbis-gene-3;Name=recF;gbkey=Gene;gene=recF;gene_biotype=protein_coding;gene_id=nbis-gene-3;locus_tag=C7A06_RS00015;original_biotype=mrna;transcript_id=gene-C7A06_RS00015
+NZ_CP027599.1 Protein Homology CDS 2152 3225 . + 0 ID=cds-WP_000060112.1;Parent=gene-C7A06_RS00015;Dbxref=Genbank:WP_000060112.1;Name=WP_000060112.1;Ontology_term=GO:0006281,GO:0003697,GO:0005524;gbkey=CDS;gene=recF;gene_id=nbis-gene-3;go_function=single-stranded DNA binding|0003697||IEA,ATP binding|0005524||IEA;go_process=DNA repair|0006281||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1;locus_tag=C7A06_RS00015;product=DNA replication/repair protein RecF;protein_id=WP_000060112.1;transcript_id=gene-C7A06_RS00015;transl_table=11
+NZ_CP027599.1 RefSeq gene 3254 5668 . + . ID=nbis-gene-4;Name=gyrB;gbkey=Gene;gene=gyrB;gene_biotype=protein_coding;gene_id=nbis-gene-4;locus_tag=C7A06_RS00020
+NZ_CP027599.1 Protein Homology CDS 3254 5668 . + 0 ID=cds-WP_000072067.1;Parent=gene-C7A06_RS00020;Dbxref=Genbank:WP_000072067.1;Name=WP_000072067.1;Ontology_term=GO:0006265,GO:0003918,GO:0009330;gbkey=CDS;gene=gyrB;gene_id=nbis-gene-4;go_component=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) complex|0009330||IEA;go_function=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) activity|0003918||IEA;go_process=DNA topological change|0006265||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1;locus_tag=C7A06_RS00020;product=DNA topoisomerase (ATP-hydrolyzing) subunit B;protein_id=WP_000072067.1;transcript_id=gene-C7A06_RS00020;transl_table=11
+NZ_CP027599.1 RefSeq gene 5908 6306 . + . ID=nbis-gene-5;Name=yidB;gbkey=Gene;gene=yidB;gene_biotype=protein_coding;gene_id=nbis-gene-5;locus_tag=C7A06_RS00025
+NZ_CP027599.1 RefSeq transcript 5908 6306 . + . ID=gene-C7A06_RS00025;Parent=nbis-gene-5;Name=yidB;gbkey=Gene;gene=yidB;gene_biotype=protein_coding;gene_id=nbis-gene-5;locus_tag=C7A06_RS00025;original_biotype=mrna;transcript_id=gene-C7A06_RS00025
+NZ_CP027599.1 Protein Homology exon 5908 6306 . + . ID=nbis-exon-5;Parent=gene-C7A06_RS00025;Dbxref=Genbank:WP_000522208.1;Name=WP_000522208.1;gbkey=CDS;gene=yidB;gene_id=nbis-gene-5;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418153.4;locus_tag=C7A06_RS00025;product=YidB family protein;protein_id=WP_000522208.1;transcript_id=gene-C7A06_RS00025;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 5908 6306 . + 0 ID=cds-WP_000522208.1;Parent=gene-C7A06_RS00025;Dbxref=Genbank:WP_000522208.1;Name=WP_000522208.1;gbkey=CDS;gene=yidB;gene_id=nbis-gene-5;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418153.4;locus_tag=C7A06_RS00025;product=YidB family protein;protein_id=WP_000522208.1;transcript_id=gene-C7A06_RS00025;transl_table=11
+NZ_CP027599.1 RefSeq gene 6421 7233 . + . ID=nbis-gene-6;Name=yidA;gbkey=Gene;gene=yidA;gene_biotype=protein_coding;gene_id=nbis-gene-6;locus_tag=C7A06_RS00030
+NZ_CP027599.1 RefSeq transcript 6421 7233 . + . ID=gene-C7A06_RS00030;Parent=nbis-gene-6;Name=yidA;gbkey=Gene;gene=yidA;gene_biotype=protein_coding;gene_id=nbis-gene-6;locus_tag=C7A06_RS00030;original_biotype=mrna;transcript_id=gene-C7A06_RS00030
+NZ_CP027599.1 Protein Homology exon 6421 7233 . + . ID=nbis-exon-6;Parent=gene-C7A06_RS00030;Dbxref=Genbank:WP_000985541.1;Name=WP_000985541.1;Ontology_term=GO:0016787;gbkey=CDS;gene=yidA;gene_id=nbis-gene-6;go_function=hydrolase activity|0016787||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418152.1;locus_tag=C7A06_RS00030;product=sugar-phosphatase;protein_id=WP_000985541.1;transcript_id=gene-C7A06_RS00030;transl_table=11
+NZ_CP027599.1 RefSeq transcript 7279 7935 . - . ID=gene-C7A06_RS00035;Parent=nbis-gene-7;Name=C7A06_RS00035;gbkey=Gene;gene_biotype=protein_coding;gene_id=nbis-gene-7;locus_tag=C7A06_RS00035;original_biotype=mrna;transcript_id=gene-C7A06_RS00035
+NZ_CP027599.1 Protein Homology exon 7279 7935 . - . ID=nbis-exon-7;Parent=gene-C7A06_RS00035;Dbxref=Genbank:WP_000772931.1;Name=WP_000772931.1;gbkey=CDS;gene_id=nbis-gene-7;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709504.1;locus_tag=C7A06_RS00035;product=hypothetical protein;protein_id=WP_000772931.1;transcript_id=gene-C7A06_RS00035;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 7279 7935 . - 0 ID=cds-WP_000772931.1;Parent=gene-C7A06_RS00035;Dbxref=Genbank:WP_000772931.1;Name=WP_000772931.1;gbkey=CDS;gene_id=nbis-gene-7;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709504.1;locus_tag=C7A06_RS00035;product=hypothetical protein;protein_id=WP_000772931.1;transcript_id=gene-C7A06_RS00035;transl_table=11
+NZ_CP027599.1 RefSeq gene 8213 8902 . + . ID=nbis-gene-8;Name=dgoR;gbkey=Gene;gene=dgoR;gene_biotype=protein_coding;gene_id=nbis-gene-8;locus_tag=C7A06_RS00040
+NZ_CP027599.1 RefSeq transcript 8213 8902 . + . ID=gene-C7A06_RS00040;Parent=nbis-gene-8;Name=dgoR;gbkey=Gene;gene=dgoR;gene_biotype=protein_coding;gene_id=nbis-gene-8;locus_tag=C7A06_RS00040;original_biotype=mrna;transcript_id=gene-C7A06_RS00040
+NZ_CP027599.1 Protein Homology exon 8213 8902 . + . ID=nbis-exon-8;Parent=gene-C7A06_RS00040;Dbxref=Genbank:WP_000174305.1;Name=WP_000174305.1;gbkey=CDS;gene=dgoR;gene_id=nbis-gene-8;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709505.1;locus_tag=C7A06_RS00040;product=D-galactonate utilization transcriptional regulator DgoR;protein_id=WP_000174305.1;transcript_id=gene-C7A06_RS00040;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 8213 8902 . + 0 ID=cds-WP_000174305.1;Parent=gene-C7A06_RS00040;Dbxref=Genbank:WP_000174305.1;Name=WP_000174305.1;gbkey=CDS;gene=dgoR;gene_id=nbis-gene-8;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709505.1;locus_tag=C7A06_RS00040;product=D-galactonate utilization transcriptional regulator DgoR;protein_id=WP_000174305.1;transcript_id=gene-C7A06_RS00040;transl_table=11
+NZ_CP027599.1 RefSeq gene 8899 9777 . + . ID=nbis-gene-9;Name=dgoK;gbkey=Gene;gene=dgoK;gene_biotype=protein_coding;gene_id=nbis-gene-9;locus_tag=C7A06_RS00045
+NZ_CP027599.1 Protein Homology exon 8899 9777 . + . ID=nbis-exon-9;Parent=gene-C7A06_RS00045;Dbxref=Genbank:WP_000127112.1;Name=WP_000127112.1;gbkey=CDS;gene=dgoK;gene_id=nbis-gene-9;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709506.1;locus_tag=C7A06_RS00045;product=2-dehydro-3-deoxygalactonokinase;protein_id=WP_000127112.1;transcript_id=gene-C7A06_RS00045;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 8899 9777 . + 0 ID=cds-WP_000127112.1;Parent=gene-C7A06_RS00045;Dbxref=Genbank:WP_000127112.1;Name=WP_000127112.1;gbkey=CDS;gene=dgoK;gene_id=nbis-gene-9;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709506.1;locus_tag=C7A06_RS00045;product=2-dehydro-3-deoxygalactonokinase;protein_id=WP_000127112.1;transcript_id=gene-C7A06_RS00045;transl_table=11
+NZ_CP027599.1 RefSeq gene 9761 10378 . + . ID=nbis-gene-10;Name=dgoA;gbkey=Gene;gene=dgoA;gene_biotype=protein_coding;gene_id=nbis-gene-10;locus_tag=C7A06_RS00050
+NZ_CP027599.1 RefSeq transcript 9761 10378 . + . ID=gene-C7A06_RS00050;Parent=nbis-gene-10;Name=dgoA;gbkey=Gene;gene=dgoA;gene_biotype=protein_coding;gene_id=nbis-gene-10;locus_tag=C7A06_RS00050;original_biotype=mrna;transcript_id=gene-C7A06_RS00050
+NZ_CP027599.1 Protein Homology exon 9761 10378 . + . ID=nbis-exon-10;Parent=gene-C7A06_RS00050;Dbxref=Genbank:WP_001198699.1;Name=WP_001198699.1;gbkey=CDS;gene=dgoA;gene_id=nbis-gene-10;inference=COORDINATES: similar to AA sequence:RefSeq:YP_026238.1;locus_tag=C7A06_RS00050;product=2-dehydro-3-deoxy-6-phosphogalactonate aldolase;protein_id=WP_001198699.1;transcript_id=gene-C7A06_RS00050;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 9761 10378 . + 0 ID=cds-WP_001198699.1;Parent=gene-C7A06_RS00050;Dbxref=Genbank:WP_001198699.1;Name=WP_001198699.1;gbkey=CDS;gene=dgoA;gene_id=nbis-gene-10;inference=COORDINATES: similar to AA sequence:RefSeq:YP_026238.1;locus_tag=C7A06_RS00050;product=2-dehydro-3-deoxy-6-phosphogalactonate aldolase;protein_id=WP_001198699.1;transcript_id=gene-C7A06_RS00050;transl_table=11
+NZ_CP027599.1 RefSeq gene 10375 11523 . + . ID=nbis-gene-11;Name=dgoD;gbkey=Gene;gene=dgoD;gene_biotype=protein_coding;gene_id=nbis-gene-11;locus_tag=C7A06_RS00055
+NZ_CP027599.1 RefSeq transcript 10375 11523 . + . ID=gene-C7A06_RS00055;Parent=nbis-gene-11;Name=dgoD;gbkey=Gene;gene=dgoD;gene_biotype=protein_coding;gene_id=nbis-gene-11;locus_tag=C7A06_RS00055;original_biotype=mrna;transcript_id=gene-C7A06_RS00055
+NZ_CP027599.1 Protein Homology exon 10375 11523 . + . ID=nbis-exon-11;Parent=gene-C7A06_RS00055;Dbxref=Genbank:WP_000705001.1;Name=WP_000705001.1;Ontology_term=GO:0009063,GO:0008869;gbkey=CDS;gene=dgoD;gene_id=nbis-gene-11;go_function=galactonate dehydratase activity|0008869||IEA;go_process=cellular amino acid catabolic process|0009063||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1;locus_tag=C7A06_RS00055;product=galactonate dehydratase;protein_id=WP_000705001.1;transcript_id=gene-C7A06_RS00055;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 10375 11523 . + 0 ID=cds-WP_000705001.1;Parent=gene-C7A06_RS00055;Dbxref=Genbank:WP_000705001.1;Name=WP_000705001.1;Ontology_term=GO:0009063,GO:0008869;gbkey=CDS;gene=dgoD;gene_id=nbis-gene-11;go_function=galactonate dehydratase activity|0008869||IEA;go_process=cellular amino acid catabolic process|0009063||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1;locus_tag=C7A06_RS00055;product=galactonate dehydratase;protein_id=WP_000705001.1;transcript_id=gene-C7A06_RS00055;transl_table=11
diff -r 000000000000 -r cffa21bb7a92 test-data/annotation_broken.gff.gz
Binary file test-data/annotation_broken.gff.gz has changed
diff -r 000000000000 -r cffa21bb7a92 test-data/annotation_fixed.gff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/annotation_fixed.gff Tue May 23 13:42:43 2023 +0000
@@ -0,0 +1,49 @@
+##gff-version 3
+##gtf-version 3
+#!gff-spec-version 1.21
+#!processor NCBI annotwriter
+#!genome-build ASM301845v1
+#!genome-build-accession NCBI_Assembly:GCF_003018455.1
+#!annotation-date 05/25/2022 04:54:31
+#!annotation-source NCBI RefSeq
+##sequence-region NZ_CP027599.1 1 5942969
+##species https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=562
+NZ_CP027599.1 RefSeq gene 1052 2152 . + . ID=nbis-gene-2;Name=dnaN;gbkey=Gene;gene=dnaN;gene_biotype=protein_coding;gene_id=nbis-gene-2;locus_tag=C7A06_RS00010
+NZ_CP027599.1 RefSeq transcript 1052 2152 . + . ID=gene-C7A06_RS00010;Parent=nbis-gene-2;Name=dnaN;gbkey=Gene;gene=dnaN;gene_biotype=protein_coding;gene_id=nbis-gene-2;locus_tag=C7A06_RS00010;original_biotype=mrna;transcript_id=gene-C7A06_RS00010
+NZ_CP027599.1 Protein Homology exon 1052 2152 . + . ID=nbis-exon-2;Parent=gene-C7A06_RS00010;Dbxref=Genbank:WP_000673464.1;Name=WP_000673464.1;Ontology_term=GO:0006260,GO:0003887,GO:0009360;gbkey=CDS;gene=dnaN;gene_id=nbis-gene-2;go_component=DNA polymerase III complex|0009360||IEA;go_function=DNA-directed DNA polymerase activity|0003887||IEA;go_process=DNA replication|0006260||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1;locus_tag=C7A06_RS00010;product=DNA polymerase III subunit beta;protein_id=WP_000673464.1;transcript_id=gene-C7A06_RS00010;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 1052 2152 . + 0 ID=cds-WP_000673464.1;Parent=gene-C7A06_RS00010;Dbxref=Genbank:WP_000673464.1;Name=WP_000673464.1;Ontology_term=GO:0006260,GO:0003887,GO:0009360;gbkey=CDS;gene=dnaN;gene_id=nbis-gene-2;go_component=DNA polymerase III complex|0009360||IEA;go_function=DNA-directed DNA polymerase activity|0003887||IEA;go_process=DNA replication|0006260||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1;locus_tag=C7A06_RS00010;product=DNA polymerase III subunit beta;protein_id=WP_000673464.1;transcript_id=gene-C7A06_RS00010;transl_table=11
+NZ_CP027599.1 RefSeq gene 2152 3225 . + . ID=nbis-gene-3;Name=recF;gbkey=Gene;gene=recF;gene_biotype=protein_coding;gene_id=nbis-gene-3;locus_tag=C7A06_RS00015
+NZ_CP027599.1 RefSeq transcript 2152 3225 . + . ID=gene-C7A06_RS00015;Parent=nbis-gene-3;Name=recF;gbkey=Gene;gene=recF;gene_biotype=protein_coding;gene_id=nbis-gene-3;locus_tag=C7A06_RS00015;original_biotype=mrna;transcript_id=gene-C7A06_RS00015
+NZ_CP027599.1 Protein Homology exon 2152 3225 . + . ID=nbis-exon-1;Parent=gene-C7A06_RS00015;Dbxref=Genbank:WP_000060112.1;Name=WP_000060112.1;Ontology_term=GO:0006281,GO:0003697,GO:0005524;gbkey=CDS;gene=recF;gene_id=nbis-gene-3;go_function=single-stranded DNA binding|0003697||IEA,ATP binding|0005524||IEA;go_process=DNA repair|0006281||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1;locus_tag=C7A06_RS00015;product=DNA replication/repair protein RecF;protein_id=WP_000060112.1;transcript_id=gene-C7A06_RS00015;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 2152 3225 . + 0 ID=cds-WP_000060112.1;Parent=gene-C7A06_RS00015;Dbxref=Genbank:WP_000060112.1;Name=WP_000060112.1;Ontology_term=GO:0006281,GO:0003697,GO:0005524;gbkey=CDS;gene=recF;gene_id=nbis-gene-3;go_function=single-stranded DNA binding|0003697||IEA,ATP binding|0005524||IEA;go_process=DNA repair|0006281||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1;locus_tag=C7A06_RS00015;product=DNA replication/repair protein RecF;protein_id=WP_000060112.1;transcript_id=gene-C7A06_RS00015;transl_table=11
+NZ_CP027599.1 RefSeq gene 3254 5668 . + . ID=nbis-gene-4;Name=gyrB;gbkey=Gene;gene=gyrB;gene_biotype=protein_coding;gene_id=nbis-gene-4;locus_tag=C7A06_RS00020
+NZ_CP027599.1 RefSeq mRNA 3254 5668 . + . ID=gene-C7A06_RS00020;Parent=nbis-gene-4;Name=gyrB;gbkey=Gene;gene=gyrB;gene_biotype=protein_coding;gene_id=nbis-gene-4;locus_tag=C7A06_RS00020
+NZ_CP027599.1 Protein Homology exon 3254 5668 . + . ID=nbis-exon-3;Parent=gene-C7A06_RS00020;Dbxref=Genbank:WP_000072067.1;Name=WP_000072067.1;Ontology_term=GO:0006265,GO:0003918,GO:0009330;gbkey=CDS;gene=gyrB;gene_id=nbis-gene-4;go_component=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) complex|0009330||IEA;go_function=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) activity|0003918||IEA;go_process=DNA topological change|0006265||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1;locus_tag=C7A06_RS00020;product=DNA topoisomerase (ATP-hydrolyzing) subunit B;protein_id=WP_000072067.1;transcript_id=gene-C7A06_RS00020;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 3254 5668 . + 0 ID=cds-WP_000072067.1;Parent=gene-C7A06_RS00020;Dbxref=Genbank:WP_000072067.1;Name=WP_000072067.1;Ontology_term=GO:0006265,GO:0003918,GO:0009330;gbkey=CDS;gene=gyrB;gene_id=nbis-gene-4;go_component=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) complex|0009330||IEA;go_function=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) activity|0003918||IEA;go_process=DNA topological change|0006265||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1;locus_tag=C7A06_RS00020;product=DNA topoisomerase (ATP-hydrolyzing) subunit B;protein_id=WP_000072067.1;transcript_id=gene-C7A06_RS00020;transl_table=11
+NZ_CP027599.1 RefSeq gene 5908 6306 . + . ID=nbis-gene-5;Name=yidB;gbkey=Gene;gene=yidB;gene_biotype=protein_coding;gene_id=nbis-gene-5;locus_tag=C7A06_RS00025
+NZ_CP027599.1 RefSeq transcript 5908 6306 . + . ID=gene-C7A06_RS00025;Parent=nbis-gene-5;Name=yidB;gbkey=Gene;gene=yidB;gene_biotype=protein_coding;gene_id=nbis-gene-5;locus_tag=C7A06_RS00025;original_biotype=mrna;transcript_id=gene-C7A06_RS00025
+NZ_CP027599.1 Protein Homology exon 5908 6306 . + . ID=nbis-exon-5;Parent=gene-C7A06_RS00025;Dbxref=Genbank:WP_000522208.1;Name=WP_000522208.1;gbkey=CDS;gene=yidB;gene_id=nbis-gene-5;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418153.4;locus_tag=C7A06_RS00025;product=YidB family protein;protein_id=WP_000522208.1;transcript_id=gene-C7A06_RS00025;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 5908 6306 . + 0 ID=cds-WP_000522208.1;Parent=gene-C7A06_RS00025;Dbxref=Genbank:WP_000522208.1;Name=WP_000522208.1;gbkey=CDS;gene=yidB;gene_id=nbis-gene-5;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418153.4;locus_tag=C7A06_RS00025;product=YidB family protein;protein_id=WP_000522208.1;transcript_id=gene-C7A06_RS00025;transl_table=11
+NZ_CP027599.1 RefSeq gene 6421 7233 . + . ID=nbis-gene-6;Name=yidA;gbkey=Gene;gene=yidA;gene_biotype=protein_coding;gene_id=nbis-gene-6;locus_tag=C7A06_RS00030
+NZ_CP027599.1 RefSeq transcript 6421 7233 . + . ID=gene-C7A06_RS00030;Parent=nbis-gene-6;Name=yidA;gbkey=Gene;gene=yidA;gene_biotype=protein_coding;gene_id=nbis-gene-6;locus_tag=C7A06_RS00030;original_biotype=mrna;transcript_id=gene-C7A06_RS00030
+NZ_CP027599.1 Protein Homology exon 6421 7233 . + . ID=nbis-exon-6;Parent=gene-C7A06_RS00030;Dbxref=Genbank:WP_000985541.1;Name=WP_000985541.1;Ontology_term=GO:0016787;gbkey=CDS;gene=yidA;gene_id=nbis-gene-6;go_function=hydrolase activity|0016787||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418152.1;locus_tag=C7A06_RS00030;product=sugar-phosphatase;protein_id=WP_000985541.1;transcript_id=gene-C7A06_RS00030;transl_table=11
+NZ_CP027599.1 RefSeq gene 7279 7935 . - . ID=nbis-gene-7;Name=C7A06_RS00035;gbkey=Gene;gene_biotype=protein_coding;gene_id=nbis-gene-7;locus_tag=C7A06_RS00035;original_biotype=mrna;transcript_id=gene-C7A06_RS00035
+NZ_CP027599.1 RefSeq transcript 7279 7935 . - . ID=gene-C7A06_RS00035;Parent=nbis-gene-7;Name=C7A06_RS00035;gbkey=Gene;gene_biotype=protein_coding;gene_id=nbis-gene-7;locus_tag=C7A06_RS00035;original_biotype=mrna;transcript_id=gene-C7A06_RS00035
+NZ_CP027599.1 Protein Homology exon 7279 7935 . - . ID=nbis-exon-7;Parent=gene-C7A06_RS00035;Dbxref=Genbank:WP_000772931.1;Name=WP_000772931.1;gbkey=CDS;gene_id=nbis-gene-7;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709504.1;locus_tag=C7A06_RS00035;product=hypothetical protein;protein_id=WP_000772931.1;transcript_id=gene-C7A06_RS00035;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 7279 7935 . - 0 ID=cds-WP_000772931.1;Parent=gene-C7A06_RS00035;Dbxref=Genbank:WP_000772931.1;Name=WP_000772931.1;gbkey=CDS;gene_id=nbis-gene-7;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709504.1;locus_tag=C7A06_RS00035;product=hypothetical protein;protein_id=WP_000772931.1;transcript_id=gene-C7A06_RS00035;transl_table=11
+NZ_CP027599.1 RefSeq gene 8213 8902 . + . ID=nbis-gene-8;Name=dgoR;gbkey=Gene;gene=dgoR;gene_biotype=protein_coding;gene_id=nbis-gene-8;locus_tag=C7A06_RS00040
+NZ_CP027599.1 RefSeq transcript 8213 8902 . + . ID=gene-C7A06_RS00040;Parent=nbis-gene-8;Name=dgoR;gbkey=Gene;gene=dgoR;gene_biotype=protein_coding;gene_id=nbis-gene-8;locus_tag=C7A06_RS00040;original_biotype=mrna;transcript_id=gene-C7A06_RS00040
+NZ_CP027599.1 Protein Homology exon 8213 8902 . + . ID=nbis-exon-8;Parent=gene-C7A06_RS00040;Dbxref=Genbank:WP_000174305.1;Name=WP_000174305.1;gbkey=CDS;gene=dgoR;gene_id=nbis-gene-8;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709505.1;locus_tag=C7A06_RS00040;product=D-galactonate utilization transcriptional regulator DgoR;protein_id=WP_000174305.1;transcript_id=gene-C7A06_RS00040;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 8213 8902 . + 0 ID=cds-WP_000174305.1;Parent=gene-C7A06_RS00040;Dbxref=Genbank:WP_000174305.1;Name=WP_000174305.1;gbkey=CDS;gene=dgoR;gene_id=nbis-gene-8;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709505.1;locus_tag=C7A06_RS00040;product=D-galactonate utilization transcriptional regulator DgoR;protein_id=WP_000174305.1;transcript_id=gene-C7A06_RS00040;transl_table=11
+NZ_CP027599.1 RefSeq gene 8899 9777 . + . ID=nbis-gene-9;Name=dgoK;gbkey=Gene;gene=dgoK;gene_biotype=protein_coding;gene_id=nbis-gene-9;locus_tag=C7A06_RS00045
+NZ_CP027599.1 RefSeq mRNA 8899 9777 . + . ID=gene-C7A06_RS00045;Parent=nbis-gene-9;Name=dgoK;gbkey=Gene;gene=dgoK;gene_biotype=protein_coding;gene_id=nbis-gene-9;locus_tag=C7A06_RS00045
+NZ_CP027599.1 Protein Homology exon 8899 9777 . + . ID=nbis-exon-9;Parent=gene-C7A06_RS00045;Dbxref=Genbank:WP_000127112.1;Name=WP_000127112.1;gbkey=CDS;gene=dgoK;gene_id=nbis-gene-9;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709506.1;locus_tag=C7A06_RS00045;product=2-dehydro-3-deoxygalactonokinase;protein_id=WP_000127112.1;transcript_id=gene-C7A06_RS00045;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 8899 9777 . + 0 ID=cds-WP_000127112.1;Parent=gene-C7A06_RS00045;Dbxref=Genbank:WP_000127112.1;Name=WP_000127112.1;gbkey=CDS;gene=dgoK;gene_id=nbis-gene-9;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709506.1;locus_tag=C7A06_RS00045;product=2-dehydro-3-deoxygalactonokinase;protein_id=WP_000127112.1;transcript_id=gene-C7A06_RS00045;transl_table=11
+NZ_CP027599.1 RefSeq gene 9761 10378 . + . ID=nbis-gene-10;Name=dgoA;gbkey=Gene;gene=dgoA;gene_biotype=protein_coding;gene_id=nbis-gene-10;locus_tag=C7A06_RS00050
+NZ_CP027599.1 RefSeq transcript 9761 10378 . + . ID=gene-C7A06_RS00050;Parent=nbis-gene-10;Name=dgoA;gbkey=Gene;gene=dgoA;gene_biotype=protein_coding;gene_id=nbis-gene-10;locus_tag=C7A06_RS00050;original_biotype=mrna;transcript_id=gene-C7A06_RS00050
+NZ_CP027599.1 Protein Homology exon 9761 10378 . + . ID=nbis-exon-10;Parent=gene-C7A06_RS00050;Dbxref=Genbank:WP_001198699.1;Name=WP_001198699.1;gbkey=CDS;gene=dgoA;gene_id=nbis-gene-10;inference=COORDINATES: similar to AA sequence:RefSeq:YP_026238.1;locus_tag=C7A06_RS00050;product=2-dehydro-3-deoxy-6-phosphogalactonate aldolase;protein_id=WP_001198699.1;transcript_id=gene-C7A06_RS00050;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 9761 10378 . + 0 ID=cds-WP_001198699.1;Parent=gene-C7A06_RS00050;Dbxref=Genbank:WP_001198699.1;Name=WP_001198699.1;gbkey=CDS;gene=dgoA;gene_id=nbis-gene-10;inference=COORDINATES: similar to AA sequence:RefSeq:YP_026238.1;locus_tag=C7A06_RS00050;product=2-dehydro-3-deoxy-6-phosphogalactonate aldolase;protein_id=WP_001198699.1;transcript_id=gene-C7A06_RS00050;transl_table=11
+NZ_CP027599.1 RefSeq gene 10375 11523 . + . ID=nbis-gene-11;Name=dgoD;gbkey=Gene;gene=dgoD;gene_biotype=protein_coding;gene_id=nbis-gene-11;locus_tag=C7A06_RS00055
+NZ_CP027599.1 RefSeq transcript 10375 11523 . + . ID=gene-C7A06_RS00055;Parent=nbis-gene-11;Name=dgoD;gbkey=Gene;gene=dgoD;gene_biotype=protein_coding;gene_id=nbis-gene-11;locus_tag=C7A06_RS00055;original_biotype=mrna;transcript_id=gene-C7A06_RS00055
+NZ_CP027599.1 Protein Homology exon 10375 11523 . + . ID=nbis-exon-11;Parent=gene-C7A06_RS00055;Dbxref=Genbank:WP_000705001.1;Name=WP_000705001.1;Ontology_term=GO:0009063,GO:0008869;gbkey=CDS;gene=dgoD;gene_id=nbis-gene-11;go_function=galactonate dehydratase activity|0008869||IEA;go_process=cellular amino acid catabolic process|0009063||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1;locus_tag=C7A06_RS00055;product=galactonate dehydratase;protein_id=WP_000705001.1;transcript_id=gene-C7A06_RS00055;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 10375 11523 . + 0 ID=cds-WP_000705001.1;Parent=gene-C7A06_RS00055;Dbxref=Genbank:WP_000705001.1;Name=WP_000705001.1;Ontology_term=GO:0009063,GO:0008869;gbkey=CDS;gene=dgoD;gene_id=nbis-gene-11;go_function=galactonate dehydratase activity|0008869||IEA;go_process=cellular amino acid catabolic process|0009063||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1;locus_tag=C7A06_RS00055;product=galactonate dehydratase;protein_id=WP_000705001.1;transcript_id=gene-C7A06_RS00055;transl_table=11
diff -r 000000000000 -r cffa21bb7a92 test-data/annotation_small.gtf
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/annotation_small.gtf Tue May 23 13:42:43 2023 +0000
@@ -0,0 +1,49 @@
+##gtf-version 3
+#!gff-spec-version 1.21
+#!processor NCBI annotwriter
+#!genome-build ASM301845v1
+#!genome-build-accession NCBI_Assembly:GCF_003018455.1
+#!annotation-date 05/25/2022 04:54:31
+#!annotation-source NCBI RefSeq
+##sequence-region NZ_CP027599.1 1 5942969
+##species https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=562
+NZ_CP027599.1 RefSeq gene 1052 2152 . + . gene_id "nbis-gene-2"; ID "nbis-gene-2"; Name "dnaN"; gbkey "Gene"; gene "dnaN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00010";
+NZ_CP027599.1 RefSeq transcript 1052 2152 . + . gene_id "nbis-gene-2"; transcript_id "gene-C7A06_RS00010"; ID "gene-C7A06_RS00010"; Name "dnaN"; Parent "nbis-gene-2"; gbkey "Gene"; gene "dnaN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00010"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 1052 2152 . + . gene_id "nbis-gene-2"; transcript_id "gene-C7A06_RS00010"; Dbxref "Genbank:WP_000673464.1"; ID "nbis-exon-2"; Name "WP_000673464.1"; Ontology_term "GO:0006260" "GO:0003887" "GO:0009360"; Parent "gene-C7A06_RS00010"; gbkey "CDS"; gene "dnaN"; go_component "DNA polymerase III complex|0009360||IEA"; go_function "DNA-directed DNA polymerase activity|0003887||IEA"; go_process "DNA replication|0006260||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1"; locus_tag "C7A06_RS00010"; product "DNA polymerase III subunit beta"; protein_id "WP_000673464.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 1052 2152 . + 0 gene_id "nbis-gene-2"; transcript_id "gene-C7A06_RS00010"; Dbxref "Genbank:WP_000673464.1"; ID "cds-WP_000673464.1"; Name "WP_000673464.1"; Ontology_term "GO:0006260" "GO:0003887" "GO:0009360"; Parent "gene-C7A06_RS00010"; gbkey "CDS"; gene "dnaN"; go_component "DNA polymerase III complex|0009360||IEA"; go_function "DNA-directed DNA polymerase activity|0003887||IEA"; go_process "DNA replication|0006260||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1"; locus_tag "C7A06_RS00010"; product "DNA polymerase III subunit beta"; protein_id "WP_000673464.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 2152 3225 . + . gene_id "nbis-gene-3"; ID "nbis-gene-3"; Name "recF"; gbkey "Gene"; gene "recF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00015";
+NZ_CP027599.1 RefSeq transcript 2152 3225 . + . gene_id "nbis-gene-3"; transcript_id "gene-C7A06_RS00015"; ID "gene-C7A06_RS00015"; Name "recF"; Parent "nbis-gene-3"; gbkey "Gene"; gene "recF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00015"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 2152 3225 . + . gene_id "nbis-gene-3"; transcript_id "gene-C7A06_RS00015"; Dbxref "Genbank:WP_000060112.1"; ID "nbis-exon-3"; Name "WP_000060112.1"; Ontology_term "GO:0006281" "GO:0003697" "GO:0005524"; Parent "gene-C7A06_RS00015"; gbkey "CDS"; gene "recF"; go_function "single-stranded DNA binding|0003697||IEA" "ATP binding|0005524||IEA"; go_process "DNA repair|0006281||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1"; locus_tag "C7A06_RS00015"; product "DNA replication/repair protein RecF"; protein_id "WP_000060112.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 2152 3225 . + 0 gene_id "nbis-gene-3"; transcript_id "gene-C7A06_RS00015"; Dbxref "Genbank:WP_000060112.1"; ID "cds-WP_000060112.1"; Name "WP_000060112.1"; Ontology_term "GO:0006281" "GO:0003697" "GO:0005524"; Parent "gene-C7A06_RS00015"; gbkey "CDS"; gene "recF"; go_function "single-stranded DNA binding|0003697||IEA" "ATP binding|0005524||IEA"; go_process "DNA repair|0006281||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1"; locus_tag "C7A06_RS00015"; product "DNA replication/repair protein RecF"; protein_id "WP_000060112.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 3254 5668 . + . gene_id "nbis-gene-4"; ID "nbis-gene-4"; Name "gyrB"; gbkey "Gene"; gene "gyrB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00020";
+NZ_CP027599.1 RefSeq transcript 3254 5668 . + . gene_id "nbis-gene-4"; transcript_id "gene-C7A06_RS00020"; ID "gene-C7A06_RS00020"; Name "gyrB"; Parent "nbis-gene-4"; gbkey "Gene"; gene "gyrB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00020"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 3254 5668 . + . gene_id "nbis-gene-4"; transcript_id "gene-C7A06_RS00020"; Dbxref "Genbank:WP_000072067.1"; ID "nbis-exon-4"; Name "WP_000072067.1"; Ontology_term "GO:0006265" "GO:0003918" "GO:0009330"; Parent "gene-C7A06_RS00020"; gbkey "CDS"; gene "gyrB"; go_component "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) complex|0009330||IEA"; go_function "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) activity|0003918||IEA"; go_process "DNA topological change|0006265||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1"; locus_tag "C7A06_RS00020"; product "DNA topoisomerase (ATP-hydrolyzing) subunit B"; protein_id "WP_000072067.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 3254 5668 . + 0 gene_id "nbis-gene-4"; transcript_id "gene-C7A06_RS00020"; Dbxref "Genbank:WP_000072067.1"; ID "cds-WP_000072067.1"; Name "WP_000072067.1"; Ontology_term "GO:0006265" "GO:0003918" "GO:0009330"; Parent "gene-C7A06_RS00020"; gbkey "CDS"; gene "gyrB"; go_component "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) complex|0009330||IEA"; go_function "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) activity|0003918||IEA"; go_process "DNA topological change|0006265||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1"; locus_tag "C7A06_RS00020"; product "DNA topoisomerase (ATP-hydrolyzing) subunit B"; protein_id "WP_000072067.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 5908 6306 . + . gene_id "nbis-gene-5"; ID "nbis-gene-5"; Name "yidB"; gbkey "Gene"; gene "yidB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00025";
+NZ_CP027599.1 RefSeq transcript 5908 6306 . + . gene_id "nbis-gene-5"; transcript_id "gene-C7A06_RS00025"; ID "gene-C7A06_RS00025"; Name "yidB"; Parent "nbis-gene-5"; gbkey "Gene"; gene "yidB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00025"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 5908 6306 . + . gene_id "nbis-gene-5"; transcript_id "gene-C7A06_RS00025"; Dbxref "Genbank:WP_000522208.1"; ID "nbis-exon-5"; Name "WP_000522208.1"; Parent "gene-C7A06_RS00025"; gbkey "CDS"; gene "yidB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418153.4"; locus_tag "C7A06_RS00025"; product "YidB family protein"; protein_id "WP_000522208.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 5908 6306 . + 0 gene_id "nbis-gene-5"; transcript_id "gene-C7A06_RS00025"; Dbxref "Genbank:WP_000522208.1"; ID "cds-WP_000522208.1"; Name "WP_000522208.1"; Parent "gene-C7A06_RS00025"; gbkey "CDS"; gene "yidB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418153.4"; locus_tag "C7A06_RS00025"; product "YidB family protein"; protein_id "WP_000522208.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 6421 7233 . + . gene_id "nbis-gene-6"; ID "nbis-gene-6"; Name "yidA"; gbkey "Gene"; gene "yidA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00030";
+NZ_CP027599.1 RefSeq transcript 6421 7233 . + . gene_id "nbis-gene-6"; transcript_id "gene-C7A06_RS00030"; ID "gene-C7A06_RS00030"; Name "yidA"; Parent "nbis-gene-6"; gbkey "Gene"; gene "yidA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00030"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 6421 7233 . + . gene_id "nbis-gene-6"; transcript_id "gene-C7A06_RS00030"; Dbxref "Genbank:WP_000985541.1"; ID "nbis-exon-6"; Name "WP_000985541.1"; Ontology_term "GO:0016787"; Parent "gene-C7A06_RS00030"; gbkey "CDS"; gene "yidA"; go_function "hydrolase activity|0016787||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418152.1"; locus_tag "C7A06_RS00030"; product "sugar-phosphatase"; protein_id "WP_000985541.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 6421 7233 . + 0 gene_id "nbis-gene-6"; transcript_id "gene-C7A06_RS00030"; Dbxref "Genbank:WP_000985541.1"; ID "cds-WP_000985541.1"; Name "WP_000985541.1"; Ontology_term "GO:0016787"; Parent "gene-C7A06_RS00030"; gbkey "CDS"; gene "yidA"; go_function "hydrolase activity|0016787||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418152.1"; locus_tag "C7A06_RS00030"; product "sugar-phosphatase"; protein_id "WP_000985541.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 7279 7935 . - . gene_id "nbis-gene-7"; ID "nbis-gene-7"; Name "C7A06_RS00035"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00035";
+NZ_CP027599.1 RefSeq transcript 7279 7935 . - . gene_id "nbis-gene-7"; transcript_id "gene-C7A06_RS00035"; ID "gene-C7A06_RS00035"; Name "C7A06_RS00035"; Parent "nbis-gene-7"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00035"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 7279 7935 . - . gene_id "nbis-gene-7"; transcript_id "gene-C7A06_RS00035"; Dbxref "Genbank:WP_000772931.1"; ID "nbis-exon-7"; Name "WP_000772931.1"; Parent "gene-C7A06_RS00035"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709504.1"; locus_tag "C7A06_RS00035"; product "hypothetical protein"; protein_id "WP_000772931.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 7279 7935 . - 0 gene_id "nbis-gene-7"; transcript_id "gene-C7A06_RS00035"; Dbxref "Genbank:WP_000772931.1"; ID "cds-WP_000772931.1"; Name "WP_000772931.1"; Parent "gene-C7A06_RS00035"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709504.1"; locus_tag "C7A06_RS00035"; product "hypothetical protein"; protein_id "WP_000772931.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 8213 8902 . + . gene_id "nbis-gene-8"; ID "nbis-gene-8"; Name "dgoR"; gbkey "Gene"; gene "dgoR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00040";
+NZ_CP027599.1 RefSeq transcript 8213 8902 . + . gene_id "nbis-gene-8"; transcript_id "gene-C7A06_RS00040"; ID "gene-C7A06_RS00040"; Name "dgoR"; Parent "nbis-gene-8"; gbkey "Gene"; gene "dgoR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00040"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 8213 8902 . + . gene_id "nbis-gene-8"; transcript_id "gene-C7A06_RS00040"; Dbxref "Genbank:WP_000174305.1"; ID "nbis-exon-8"; Name "WP_000174305.1"; Parent "gene-C7A06_RS00040"; gbkey "CDS"; gene "dgoR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709505.1"; locus_tag "C7A06_RS00040"; product "D-galactonate utilization transcriptional regulator DgoR"; protein_id "WP_000174305.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 8213 8902 . + 0 gene_id "nbis-gene-8"; transcript_id "gene-C7A06_RS00040"; Dbxref "Genbank:WP_000174305.1"; ID "cds-WP_000174305.1"; Name "WP_000174305.1"; Parent "gene-C7A06_RS00040"; gbkey "CDS"; gene "dgoR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709505.1"; locus_tag "C7A06_RS00040"; product "D-galactonate utilization transcriptional regulator DgoR"; protein_id "WP_000174305.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 8899 9777 . + . gene_id "nbis-gene-9"; ID "nbis-gene-9"; Name "dgoK"; gbkey "Gene"; gene "dgoK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00045";
+NZ_CP027599.1 RefSeq transcript 8899 9777 . + . gene_id "nbis-gene-9"; transcript_id "gene-C7A06_RS00045"; ID "gene-C7A06_RS00045"; Name "dgoK"; Parent "nbis-gene-9"; gbkey "Gene"; gene "dgoK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00045"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 8899 9777 . + . gene_id "nbis-gene-9"; transcript_id "gene-C7A06_RS00045"; Dbxref "Genbank:WP_000127112.1"; ID "nbis-exon-9"; Name "WP_000127112.1"; Parent "gene-C7A06_RS00045"; gbkey "CDS"; gene "dgoK"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709506.1"; locus_tag "C7A06_RS00045"; product "2-dehydro-3-deoxygalactonokinase"; protein_id "WP_000127112.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 8899 9777 . + 0 gene_id "nbis-gene-9"; transcript_id "gene-C7A06_RS00045"; Dbxref "Genbank:WP_000127112.1"; ID "cds-WP_000127112.1"; Name "WP_000127112.1"; Parent "gene-C7A06_RS00045"; gbkey "CDS"; gene "dgoK"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709506.1"; locus_tag "C7A06_RS00045"; product "2-dehydro-3-deoxygalactonokinase"; protein_id "WP_000127112.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 9761 10378 . + . gene_id "nbis-gene-10"; ID "nbis-gene-10"; Name "dgoA"; gbkey "Gene"; gene "dgoA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00050";
+NZ_CP027599.1 RefSeq transcript 9761 10378 . + . gene_id "nbis-gene-10"; transcript_id "gene-C7A06_RS00050"; ID "gene-C7A06_RS00050"; Name "dgoA"; Parent "nbis-gene-10"; gbkey "Gene"; gene "dgoA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00050"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 9761 10378 . + . gene_id "nbis-gene-10"; transcript_id "gene-C7A06_RS00050"; Dbxref "Genbank:WP_001198699.1"; ID "nbis-exon-10"; Name "WP_001198699.1"; Parent "gene-C7A06_RS00050"; gbkey "CDS"; gene "dgoA"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026238.1"; locus_tag "C7A06_RS00050"; product "2-dehydro-3-deoxy-6-phosphogalactonate aldolase"; protein_id "WP_001198699.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 9761 10378 . + 0 gene_id "nbis-gene-10"; transcript_id "gene-C7A06_RS00050"; Dbxref "Genbank:WP_001198699.1"; ID "cds-WP_001198699.1"; Name "WP_001198699.1"; Parent "gene-C7A06_RS00050"; gbkey "CDS"; gene "dgoA"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026238.1"; locus_tag "C7A06_RS00050"; product "2-dehydro-3-deoxy-6-phosphogalactonate aldolase"; protein_id "WP_001198699.1"; transl_table "11";
+NZ_CP027599.1 RefSeq gene 10375 11523 . + . gene_id "nbis-gene-11"; ID "nbis-gene-11"; Name "dgoD"; gbkey "Gene"; gene "dgoD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00055";
+NZ_CP027599.1 RefSeq transcript 10375 11523 . + . gene_id "nbis-gene-11"; transcript_id "gene-C7A06_RS00055"; ID "gene-C7A06_RS00055"; Name "dgoD"; Parent "nbis-gene-11"; gbkey "Gene"; gene "dgoD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00055"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 10375 11523 . + . gene_id "nbis-gene-11"; transcript_id "gene-C7A06_RS00055"; Dbxref "Genbank:WP_000705001.1"; ID "nbis-exon-11"; Name "WP_000705001.1"; Ontology_term "GO:0009063" "GO:0008869"; Parent "gene-C7A06_RS00055"; gbkey "CDS"; gene "dgoD"; go_function "galactonate dehydratase activity|0008869||IEA"; go_process "cellular amino acid catabolic process|0009063||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1"; locus_tag "C7A06_RS00055"; product "galactonate dehydratase"; protein_id "WP_000705001.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 10375 11523 . + 0 gene_id "nbis-gene-11"; transcript_id "gene-C7A06_RS00055"; Dbxref "Genbank:WP_000705001.1"; ID "cds-WP_000705001.1"; Name "WP_000705001.1"; Ontology_term "GO:0009063" "GO:0008869"; Parent "gene-C7A06_RS00055"; gbkey "CDS"; gene "dgoD"; go_function "galactonate dehydratase activity|0008869||IEA"; go_process "cellular amino acid catabolic process|0009063||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1"; locus_tag "C7A06_RS00055"; product "galactonate dehydratase"; protein_id "WP_000705001.1"; transl_table "11";
\ No newline at end of file
diff -r 000000000000 -r cffa21bb7a92 test-data/annotation_unique.gtf
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/annotation_unique.gtf Tue May 23 13:42:43 2023 +0000
@@ -0,0 +1,13 @@
+##gtf-version 3
+#!gff-spec-version 1.21
+#!processor NCBI annotwriter
+#!genome-build ASM301845v1
+#!genome-build-accession NCBI_Assembly:GCF_003018455.1
+#!annotation-date 05/25/2022 04:54:31
+#!annotation-source NCBI RefSeq
+##sequence-region NZ_CP027599.1 1 5942969
+##species https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=562
+NZ_CP027599.1 RefSeq gene 11598 12935 . + . gene_id "nbis-gene-12"; ID "nbis-gene-12"; Name "dgoT"; gbkey "Gene"; gene "dgoT"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00060";
+NZ_CP027599.1 RefSeq transcript 11598 12935 . + . gene_id "nbis-gene-12"; transcript_id "gene-C7A06_RS00060"; ID "gene-C7A06_RS00060"; Name "dgoT"; Parent "nbis-gene-12"; gbkey "Gene"; gene "dgoT"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00060"; original_biotype "mrna";
+NZ_CP027599.1 Protein Homology exon 11598 12935 . + . gene_id "nbis-gene-12"; transcript_id "gene-C7A06_RS00060"; Dbxref "Genbank:WP_000253455.1"; ID "nbis-exon-12"; Name "WP_000253455.1"; Parent "gene-C7A06_RS00060"; gbkey "CDS"; gene "dgoT"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709507.1"; locus_tag "C7A06_RS00060"; product "MFS transporter"; protein_id "WP_000253455.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 11598 12935 . + 0 gene_id "nbis-gene-12"; transcript_id "gene-C7A06_RS00060"; Dbxref "Genbank:WP_000253455.1"; ID "cds-WP_000253455.1"; Name "WP_000253455.1"; Parent "gene-C7A06_RS00060"; gbkey "CDS"; gene "dgoT"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709507.1"; locus_tag "C7A06_RS00060"; product "MFS transporter"; protein_id "WP_000253455.1"; transl_table "11";
diff -r 000000000000 -r cffa21bb7a92 test-data/fasta_indexes.loc
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fasta_indexes.loc Tue May 23 13:42:43 2023 +0000
@@ -0,0 +1,1 @@
+phix174 phiX174 PhiX174 bacteriophage ${__HERE__}/test-cache/reference.fasta
diff -r 000000000000 -r cffa21bb7a92 test-data/genome.fasta.gz
Binary file test-data/genome.fasta.gz has changed
diff -r 000000000000 -r cffa21bb7a92 test-data/phix174.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/phix174.fasta Tue May 23 13:42:43 2023 +0000
@@ -0,0 +1,2 @@
+>K03455
+TGGAAGGGCTAATTCACTCCCAACGAAGACAAGATATCCTTGATCTGTGGATCTACCACACACAAGGCTACTTCCCTGATTAGCAGAACTACACACCAGGGCCAGGGATCAGATATCCACTGACCTTTGGATGGTGCTACAAGCTAGTACCAGTTGAGCCAGAGAAGTTAGAAGAAGCCAACAAAGGAGAGAACACCAGCTTGTTACACCCTGTGAGCCTGCATGGAATGGATGACCCGGAGAGAGAAGTGTTAGAGTGGAGGTTTGACAGCCGCCTAGCATTTCATCACATGGCCCGAGAGCTGCATCCGGAGTACTTCAAGAACTGCTGACATCGAGCTTGCTACAAGGGACTTTCCGCTGGGGACTTTCCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATCCTGCATATAAGCAGCTGCTTTTTGCCTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACCTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCAAAACAAAAGTAAGAAAAAAGCACAGCAAGCAGCAGCTGACACAGGACACAGCAATCAGGTCAGCCAAAATTACCCTATAGTGCAGAACATCCAGGGGCAAATGGTACATCAGGCCATATCACCTAGAACTTTAAATGCATGGGTAAAAGTAGTAGAAGAGAAGGCTTTCAGCCCAGAAGTGATACCCATGTTTTCAGCATTATCAGAAGGAGCCACCCCACAAGATTTAAACACCATGCTAAACACAGTGGGGGGACATCAAGCAGCCATGCAAATGTTAAAAGAGACCATCAATGAGGAAGCTGCAGAATGGGATAGAGTGCATCCAGTGCATGCAGGGCCTATTGCACCAGGCCAGATGAGAGAACCAAGGGGAAGTGACATAGCAGGAACTACTAGTACCCTTCAGGAACAAATAGGATGGATGACAAATAATCCACCTATCCCAGTAGGAGAAATTTATAAAAGATGGATAATCCTGGGATTAAATAAAATAGTAAGAATGTATAGCCCTACCAGCATTCTGGACATAAGACAAGGACCAAAGGAACCCTTTAGAGACTATGTAGACCGGTTCTATAAAACTCTAAGAGCCGAGCAAGCTTCACAGGAGGTAAAAAATTGGATGACAGAAACCTTGTTGGTCCAAAATGCGAACCCAGATTGTAAGACTATTTTAAAAGCATTGGGACCAGCGGCTACACTAGAAGAAATGATGACAGCATGTCAGGGAGTAGGAGGACCCGGCCATAAGGCAAGAGTTTTGGCTGAAGCAATGAGCCAAGTAACAAATTCAGCTACCATAATGATGCAGAGAGGCAATTTTAGGAACCAAAGAAAGATTGTTAAGTGTTTCAATTGTGGCAAAGAAGGGCACACAGCCAGAAATTGCAGGGCCCCTAGGAAAAAGGGCTGTTGGAAATGTGGAAAGGAAGGACACCAAATGAAAGATTGTACTGAGAGACAGGCTAATTTTTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGACCAGAGCCAACAGCCCCACCAGAAGAGAGCTTCAGGTCTGGGGTAGAGACAACAACTCCCCCTCAGAAGCAGGAGCCGATAGACAAGGAACTGTATCCTTTAACTTCCCTCAGGTCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAACTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAGTTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGATACTCATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGATTGGTTGCACTTTAAATTTTCCCATTAGCCCTATTGAGACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAGATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAATTAGGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATGAAGACTTCAGGAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAGCCTTTTAGAAAACAAAATCCAGACATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAGCTGAGACAACATCTGTTGAGGTGGGGACTTACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTCCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTATAGTGCTGCCAGAAAAAGACAGCTGGACTGTCAATGACATACAGAAGTTAGTGGGGAAATTGAATTGGGCAAGTCAGATTTACCCAGGGATTAAAGTAAGGCAATTATGTAAACTCCTTAGAGGAACCAAAGCACTAACAGAAGTAATACCACTAACAGAAGAAGCAGAGCTAGAACTGGCAGAAAACAGAGAGATTCTAAAAGAACCAGTACATGGAGTGTATTATGACCCATCAAAAGACTTAATAGCAGAAATACAGAAGCAGGGGCAAGGCCAATGGACATATCAAATTTATCAAGAGCCATTTAAAAATCTGAAAACAGGAAAATATGCAAGAATGAGGGGTGCCCACACTAATGATGTAAAACAATTAACAGAGGCAGTGCAAAAAATAACCACAGAAAGCATAGTAATATGGGGAAAGACTCCTAAATTTAAACTGCCCATACAAAAGGAAACATGGGAAACATGGTGGACAGAGTATTGGCAAGCCACCTGGATTCCTGAGTGGGAGTTTGTTAATACCCCTCCCTTAGTGAAATTATGGTACCAGTTAGAGAAAGAACCCATAGTAGGAGCAGAAACCTTCTATGTAGATGGGGCAGCTAACAGGGAGACTAAATTAGGAAAAGCAGGATATGTTACTAATAGAGGAAGACAAAAAGTTGTCACCCTAACTGACACAACAAATCAGAAGACTGAGTTACAAGCAATTTATCTAGCTTTGCAGGATTCGGGATTAGAAGTAAACATAGTAACAGACTCACAATATGCATTAGGAATCATTCAAGCACAACCAGATCAAAGTGAATCAGAGTTAGTCAATCAAATAATAGAGCAGTTAATAAAAAAGGAAAAGGTCTATCTGGCATGGGTACCAGCACACAAAGGAATTGGAGGAAATGAACAAGTAGATAAATTAGTCAGTGCTGGAATCAGGAAAGTACTATTTTTAGATGGAATAGATAAGGCCCAAGATGAACATGAGAAATATCACAGTAATTGGAGAGCAATGGCTAGTGATTTTAACCTGCCACCTGTAGTAGCAAAAGAAATAGTAGCCAGCTGTGATAAATGTCAGCTAAAAGGAGAAGCCATGCATGGACAAGTAGACTGTAGTCCAGGAATATGGCAACTAGATTGTACACATTTAGAAGGAAAAGTTATCCTGGTAGCAGTTCATGTAGCCAGTGGATATATAGAAGCAGAAGTTATTCCAGCAGAAACAGGGCAGGAAACAGCATATTTTCTTTTAAAATTAGCAGGAAGATGGCCAGTAAAAACAATACATACTGACAATGGCAGCAATTTCACCGGTGCTACGGTTAGGGCCGCCTGTTGGTGGGCGGGAATCAAGCAGGAATTTGGAATTCCCTACAATCCCCAAAGTCAAGGAGTAGTAGAATCTATGAATAAAGAATTAAAGAAAATTATAGGACAGGTAAGAGATCAGGCTGAACATCTTAAGACAGCAGTACAAATGGCAGTATTCATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAAATCCACTTTGGAAAGGACCAGCAAAGCTCCTCTGGAAAGGTGAAGGGGCAGTAGTAATACAAGATAATAGTGACATAAAAGTAGTGCCAAGAAGAAAAGCAAAGATCATTAGGGATTATGGAAAACAGATGGCAGGTGATGATTGTGTGGCAAGTAGACAGGATGAGGATTAGAACATGGAAAAGTTTAGTAAAACACCATATGTATGTTTCAGGGAAAGCTAGGGGATGGTTTTATAGACATCACTATGAAAGCCCTCATCCAAGAATAAGTTCAGAAGTACACATCCCACTAGGGGATGCTAGATTGGTAATAACAACATATTGGGGTCTGCATACAGGAGAAAGAGACTGGCATTTGGGTCAGGGAGTCTCCATAGAATGGAGGAAAAAGAGATATAGCACACAAGTAGACCCTGAACTAGCAGACCAACTAATTCATCTGTATTACTTTGACTGTTTTTCAGACTCTGCTATAAGAAAGGCCTTATTAGGACACATAGTTAGCCCTAGGTGTGAATATCAAGCAGGACATAACAAGGTAGGATCTCTACAATACTTGGCACTAGCAGCATTAATAACACCAAAAAAGATAAAGCCACCTTTGCCTAGTGTTACGAAACTGACAGAGGATAGATGGAACAAGCCCCAGAAGACCAAGGGCCACAGAGGGAGCCACACAATGAATGGACACTAGAGCTTTTAGAGGAGCTTAAGAATGAAGCTGTTAGACATTTTCCTAGGATTTGGCTCCATGGCTTAGGGCAACATATCTATGAAACTTATGGGGATACTTGGGCAGGAGTGGAAGCCATAATAAGAATTCTGCAACAACTGCTGTTTATCCATTTTCAGAATTGGGTGTCGACATAGCAGAATAGGCGTTACTCGACAGAGGAGAGCAAGAAATGGAGCCAGTAGATCCTAGACTAGAGCCCTGGAAGCATCCAGGAAGTCAGCCTAAAACTGCTTGTACCAATTGCTATTGTAAAAAGTGTTGCTTTCATTGCCAAGTTTGTTTCATAACAAAAGCCTTAGGCATCTCCTATGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCTCATCAGAACAGTCAGACTCATCAAGCTTCTCTATCAAAGCAGTAAGTAGTACATGTAACGCAACCTATACCAATAGTAGCAATAGTAGCATTAGTAGTAGCAATAATAATAGCAATAGTTGTGTGGTCCATAGTAATCATAGAATATAGGAAAATATTAAGACAAAGAAAAATAGACAGGTTAATTGATAGACTAATAGAAAGAGCAGAAGACAGTGGCAATGAGAGTGAAGGAGAAATATCAGCACTTGTGGAGATGGGGGTGGAGATGGGGCACCATGCTCCTTGGGATGTTGATGATCTGTAGTGCTACAGAAAAATTGTGGGTCACAGTCTATTATGGGGTACCTGTGTGGAAGGAAGCAACCACCACTCTATTTTGTGCATCAGATGCTAAAGCATATGATACAGAGGTACATAATGTTTGGGCCACACATGCCTGTGTACCCACAGACCCCAACCCACAAGAAGTAGTATTGGTAAATGTGACAGAAAATTTTAACATGTGGAAAAATGACATGGTAGAACAGATGCATGAGGATATAATCAGTTTATGGGATCAAAGCCTAAAGCCATGTGTAAAATTAACCCCACTCTGTGTTAGTTTAAAGTGCACTGATTTGAAGAATGATACTAATACCAATAGTAGTAGCGGGAGAATGATAATGGAGAAAGGAGAGATAAAAAACTGCTCTTTCAATATCAGCACAAGCATAAGAGGTAAGGTGCAGAAAGAATATGCATTTTTTTATAAACTTGATATAATACCAATAGATAATGATACTACCAGCTATAAGTTGACAAGTTGTAACACCTCAGTCATTACACAGGCCTGTCCAAAGGTATCCTTTGAGCCAATTCCCATACATTATTGTGCCCCGGCTGGTTTTGCGATTCTAAAATGTAATAATAAGACGTTCAATGGAACAGGACCATGTACAAATGTCAGCACAGTACAATGTACACATGGAATTAGGCCAGTAGTATCAACTCAACTGCTGTTAAATGGCAGTCTAGCAGAAGAAGAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTGAACACATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGAATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTTACAATAGGAAAAATAGGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTAGCAAATTAAGAGAACAATTTGGAAATAATAAAACAATAATCTTTAAGCAATCCTCAGGAGGGGACCCAGAAATTGTAACGCACAGTTTTAATTGTGGAGGGGAATTTTTCTACTGTAATTCAACACAACTGTTTAATAGTACTTGGTTTAATAGTACTTGGAGTACTGAAGGGTCAAATAACACTGAAGGAAGTGACACAATCACCCTCCCATGCAGAATAAAACAAATTATAAACATGTGGCAGAAAGTAGGAAAAGCAATGTATGCCCCTCCCATCAGTGGACAAATTAGATGTTCATCAAATATTACAGGGCTGCTATTAACAAGAGATGGTGGTAATAGCAACAATGAGTCCGAGATCTTCAGACCTGGAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCCTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACACGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATACACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAATTATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAATTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTTTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATTCGATTAGTGAACGGATCCTTGGCACTTATCTGGGACGATCTGCGGAGCCTGTGCCTCTTCAGCTACCACCGCTTGAGAGACTTACTCTTGATTGTAACGAGGATTGTGGAACTTCTGGGACGCAGGGGGTGGGAAGCCCTCAAATATTGGTGGAATCTCCTACAGTATTGGAGTCAGGAACTAAAGAATAGTGCTGTTAGCTTGCTCAATGCCACAGCCATAGCAGTAGCTGAGGGGACAGATAGGGTTATAGAAGTAGTACAAGGAGCTTGTAGAGCTATTCGCCACATACCTAGAAGAATAAGACAGGGCTTGGAAAGGATTTTGCTATAAGATGGGTGGCAAGTGGTCAAAAAGTAGTGTGATTGGATGGCCTACTGTAAGGGAAAGAATGAGACGAGCTGAGCCAGCAGCAGATAGGGTGGGAGCAGCATCTCGAGACCTGGAAAAACATGGAGCAATCACAAGTAGCAATACAGCAGCTACCAATGCTGCTTGTGCCTGGCTAGAAGCACAAGAGGAGGAGGAGGTGGGTTTTCCAGTCACACCTCAGGTACCTTTAAGACCAATGACTTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAATTCACTCCCAAAGAAGACAAGATATCCTTGATCTGTGGATCTACCACACACAAGGCTACTTCCCTGATTAGCAGAACTACACACCAGGGCCAGGGGTCAGATATCCACTGACCTTTGGATGGTGCTACAAGCTAGTACCAGTTGAGCCAGATAAGATAGAAGAGGCCAATAAAGGAGAGAACACCAGCTTGTTACACCCTGTGAGCCTGCATGGGATGGATGACCCGGAGAGAGAAGTGTTAGAGTGGAGGTTTGACAGCCGCCTAGCATTTCATCACGTGGCCCGAGAGCTGCATCCGGAGTACTTCAAGAACTGCTGACATCGAGCTTGCTACAAGGGACTTTCCGCTGGGGACTTTCCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATCCTGCATATAAGCAGCTGCTTTTTGCCTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCA
diff -r 000000000000 -r cffa21bb7a92 test-data/phix174.gff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/phix174.gff Tue May 23 13:42:43 2023 +0000
@@ -0,0 +1,2 @@
+##gff-version 3
+K03455 data gene 2 2669 . . . ID=1
diff -r 000000000000 -r cffa21bb7a92 test-data/test-cache/reference.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test-cache/reference.fasta Tue May 23 13:42:43 2023 +0000
@@ -0,0 +1,2 @@
+>K03455
+TGGAAGGGCTAATTCACTCCCAACGAAGACAAGATATCCTTGATCTGTGGATCTACCACACACAAGGCTACTTCCCTGATTAGCAGAACTACACACCAGGGCCAGGGATCAGATATCCACTGACCTTTGGATGGTGCTACAAGCTAGTACCAGTTGAGCCAGAGAAGTTAGAAGAAGCCAACAAAGGAGAGAACACCAGCTTGTTACACCCTGTGAGCCTGCATGGAATGGATGACCCGGAGAGAGAAGTGTTAGAGTGGAGGTTTGACAGCCGCCTAGCATTTCATCACATGGCCCGAGAGCTGCATCCGGAGTACTTCAAGAACTGCTGACATCGAGCTTGCTACAAGGGACTTTCCGCTGGGGACTTTCCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATCCTGCATATAAGCAGCTGCTTTTTGCCTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACCTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCAAAACAAAAGTAAGAAAAAAGCACAGCAAGCAGCAGCTGACACAGGACACAGCAATCAGGTCAGCCAAAATTACCCTATAGTGCAGAACATCCAGGGGCAAATGGTACATCAGGCCATATCACCTAGAACTTTAAATGCATGGGTAAAAGTAGTAGAAGAGAAGGCTTTCAGCCCAGAAGTGATACCCATGTTTTCAGCATTATCAGAAGGAGCCACCCCACAAGATTTAAACACCATGCTAAACACAGTGGGGGGACATCAAGCAGCCATGCAAATGTTAAAAGAGACCATCAATGAGGAAGCTGCAGAATGGGATAGAGTGCATCCAGTGCATGCAGGGCCTATTGCACCAGGCCAGATGAGAGAACCAAGGGGAAGTGACATAGCAGGAACTACTAGTACCCTTCAGGAACAAATAGGATGGATGACAAATAATCCACCTATCCCAGTAGGAGAAATTTATAAAAGATGGATAATCCTGGGATTAAATAAAATAGTAAGAATGTATAGCCCTACCAGCATTCTGGACATAAGACAAGGACCAAAGGAACCCTTTAGAGACTATGTAGACCGGTTCTATAAAACTCTAAGAGCCGAGCAAGCTTCACAGGAGGTAAAAAATTGGATGACAGAAACCTTGTTGGTCCAAAATGCGAACCCAGATTGTAAGACTATTTTAAAAGCATTGGGACCAGCGGCTACACTAGAAGAAATGATGACAGCATGTCAGGGAGTAGGAGGACCCGGCCATAAGGCAAGAGTTTTGGCTGAAGCAATGAGCCAAGTAACAAATTCAGCTACCATAATGATGCAGAGAGGCAATTTTAGGAACCAAAGAAAGATTGTTAAGTGTTTCAATTGTGGCAAAGAAGGGCACACAGCCAGAAATTGCAGGGCCCCTAGGAAAAAGGGCTGTTGGAAATGTGGAAAGGAAGGACACCAAATGAAAGATTGTACTGAGAGACAGGCTAATTTTTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGACCAGAGCCAACAGCCCCACCAGAAGAGAGCTTCAGGTCTGGGGTAGAGACAACAACTCCCCCTCAGAAGCAGGAGCCGATAGACAAGGAACTGTATCCTTTAACTTCCCTCAGGTCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAACTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAGTTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGATACTCATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGATTGGTTGCACTTTAAATTTTCCCATTAGCCCTATTGAGACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAGATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAATTAGGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATGAAGACTTCAGGAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAGCCTTTTAGAAAACAAAATCCAGACATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAGCTGAGACAACATCTGTTGAGGTGGGGACTTACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTCCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTATAGTGCTGCCAGAAAAAGACAGCTGGACTGTCAATGACATACAGAAGTTAGTGGGGAAATTGAATTGGGCAAGTCAGATTTACCCAGGGATTAAAGTAAGGCAATTATGTAAACTCCTTAGAGGAACCAAAGCACTAACAGAAGTAATACCACTAACAGAAGAAGCAGAGCTAGAACTGGCAGAAAACAGAGAGATTCTAAAAGAACCAGTACATGGAGTGTATTATGACCCATCAAAAGACTTAATAGCAGAAATACAGAAGCAGGGGCAAGGCCAATGGACATATCAAATTTATCAAGAGCCATTTAAAAATCTGAAAACAGGAAAATATGCAAGAATGAGGGGTGCCCACACTAATGATGTAAAACAATTAACAGAGGCAGTGCAAAAAATAACCACAGAAAGCATAGTAATATGGGGAAAGACTCCTAAATTTAAACTGCCCATACAAAAGGAAACATGGGAAACATGGTGGACAGAGTATTGGCAAGCCACCTGGATTCCTGAGTGGGAGTTTGTTAATACCCCTCCCTTAGTGAAATTATGGTACCAGTTAGAGAAAGAACCCATAGTAGGAGCAGAAACCTTCTATGTAGATGGGGCAGCTAACAGGGAGACTAAATTAGGAAAAGCAGGATATGTTACTAATAGAGGAAGACAAAAAGTTGTCACCCTAACTGACACAACAAATCAGAAGACTGAGTTACAAGCAATTTATCTAGCTTTGCAGGATTCGGGATTAGAAGTAAACATAGTAACAGACTCACAATATGCATTAGGAATCATTCAAGCACAACCAGATCAAAGTGAATCAGAGTTAGTCAATCAAATAATAGAGCAGTTAATAAAAAAGGAAAAGGTCTATCTGGCATGGGTACCAGCACACAAAGGAATTGGAGGAAATGAACAAGTAGATAAATTAGTCAGTGCTGGAATCAGGAAAGTACTATTTTTAGATGGAATAGATAAGGCCCAAGATGAACATGAGAAATATCACAGTAATTGGAGAGCAATGGCTAGTGATTTTAACCTGCCACCTGTAGTAGCAAAAGAAATAGTAGCCAGCTGTGATAAATGTCAGCTAAAAGGAGAAGCCATGCATGGACAAGTAGACTGTAGTCCAGGAATATGGCAACTAGATTGTACACATTTAGAAGGAAAAGTTATCCTGGTAGCAGTTCATGTAGCCAGTGGATATATAGAAGCAGAAGTTATTCCAGCAGAAACAGGGCAGGAAACAGCATATTTTCTTTTAAAATTAGCAGGAAGATGGCCAGTAAAAACAATACATACTGACAATGGCAGCAATTTCACCGGTGCTACGGTTAGGGCCGCCTGTTGGTGGGCGGGAATCAAGCAGGAATTTGGAATTCCCTACAATCCCCAAAGTCAAGGAGTAGTAGAATCTATGAATAAAGAATTAAAGAAAATTATAGGACAGGTAAGAGATCAGGCTGAACATCTTAAGACAGCAGTACAAATGGCAGTATTCATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAAATCCACTTTGGAAAGGACCAGCAAAGCTCCTCTGGAAAGGTGAAGGGGCAGTAGTAATACAAGATAATAGTGACATAAAAGTAGTGCCAAGAAGAAAAGCAAAGATCATTAGGGATTATGGAAAACAGATGGCAGGTGATGATTGTGTGGCAAGTAGACAGGATGAGGATTAGAACATGGAAAAGTTTAGTAAAACACCATATGTATGTTTCAGGGAAAGCTAGGGGATGGTTTTATAGACATCACTATGAAAGCCCTCATCCAAGAATAAGTTCAGAAGTACACATCCCACTAGGGGATGCTAGATTGGTAATAACAACATATTGGGGTCTGCATACAGGAGAAAGAGACTGGCATTTGGGTCAGGGAGTCTCCATAGAATGGAGGAAAAAGAGATATAGCACACAAGTAGACCCTGAACTAGCAGACCAACTAATTCATCTGTATTACTTTGACTGTTTTTCAGACTCTGCTATAAGAAAGGCCTTATTAGGACACATAGTTAGCCCTAGGTGTGAATATCAAGCAGGACATAACAAGGTAGGATCTCTACAATACTTGGCACTAGCAGCATTAATAACACCAAAAAAGATAAAGCCACCTTTGCCTAGTGTTACGAAACTGACAGAGGATAGATGGAACAAGCCCCAGAAGACCAAGGGCCACAGAGGGAGCCACACAATGAATGGACACTAGAGCTTTTAGAGGAGCTTAAGAATGAAGCTGTTAGACATTTTCCTAGGATTTGGCTCCATGGCTTAGGGCAACATATCTATGAAACTTATGGGGATACTTGGGCAGGAGTGGAAGCCATAATAAGAATTCTGCAACAACTGCTGTTTATCCATTTTCAGAATTGGGTGTCGACATAGCAGAATAGGCGTTACTCGACAGAGGAGAGCAAGAAATGGAGCCAGTAGATCCTAGACTAGAGCCCTGGAAGCATCCAGGAAGTCAGCCTAAAACTGCTTGTACCAATTGCTATTGTAAAAAGTGTTGCTTTCATTGCCAAGTTTGTTTCATAACAAAAGCCTTAGGCATCTCCTATGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCTCATCAGAACAGTCAGACTCATCAAGCTTCTCTATCAAAGCAGTAAGTAGTACATGTAACGCAACCTATACCAATAGTAGCAATAGTAGCATTAGTAGTAGCAATAATAATAGCAATAGTTGTGTGGTCCATAGTAATCATAGAATATAGGAAAATATTAAGACAAAGAAAAATAGACAGGTTAATTGATAGACTAATAGAAAGAGCAGAAGACAGTGGCAATGAGAGTGAAGGAGAAATATCAGCACTTGTGGAGATGGGGGTGGAGATGGGGCACCATGCTCCTTGGGATGTTGATGATCTGTAGTGCTACAGAAAAATTGTGGGTCACAGTCTATTATGGGGTACCTGTGTGGAAGGAAGCAACCACCACTCTATTTTGTGCATCAGATGCTAAAGCATATGATACAGAGGTACATAATGTTTGGGCCACACATGCCTGTGTACCCACAGACCCCAACCCACAAGAAGTAGTATTGGTAAATGTGACAGAAAATTTTAACATGTGGAAAAATGACATGGTAGAACAGATGCATGAGGATATAATCAGTTTATGGGATCAAAGCCTAAAGCCATGTGTAAAATTAACCCCACTCTGTGTTAGTTTAAAGTGCACTGATTTGAAGAATGATACTAATACCAATAGTAGTAGCGGGAGAATGATAATGGAGAAAGGAGAGATAAAAAACTGCTCTTTCAATATCAGCACAAGCATAAGAGGTAAGGTGCAGAAAGAATATGCATTTTTTTATAAACTTGATATAATACCAATAGATAATGATACTACCAGCTATAAGTTGACAAGTTGTAACACCTCAGTCATTACACAGGCCTGTCCAAAGGTATCCTTTGAGCCAATTCCCATACATTATTGTGCCCCGGCTGGTTTTGCGATTCTAAAATGTAATAATAAGACGTTCAATGGAACAGGACCATGTACAAATGTCAGCACAGTACAATGTACACATGGAATTAGGCCAGTAGTATCAACTCAACTGCTGTTAAATGGCAGTCTAGCAGAAGAAGAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTGAACACATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGAATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTTACAATAGGAAAAATAGGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTAGCAAATTAAGAGAACAATTTGGAAATAATAAAACAATAATCTTTAAGCAATCCTCAGGAGGGGACCCAGAAATTGTAACGCACAGTTTTAATTGTGGAGGGGAATTTTTCTACTGTAATTCAACACAACTGTTTAATAGTACTTGGTTTAATAGTACTTGGAGTACTGAAGGGTCAAATAACACTGAAGGAAGTGACACAATCACCCTCCCATGCAGAATAAAACAAATTATAAACATGTGGCAGAAAGTAGGAAAAGCAATGTATGCCCCTCCCATCAGTGGACAAATTAGATGTTCATCAAATATTACAGGGCTGCTATTAACAAGAGATGGTGGTAATAGCAACAATGAGTCCGAGATCTTCAGACCTGGAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCCTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACACGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATACACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAATTATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAATTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTTTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATTCGATTAGTGAACGGATCCTTGGCACTTATCTGGGACGATCTGCGGAGCCTGTGCCTCTTCAGCTACCACCGCTTGAGAGACTTACTCTTGATTGTAACGAGGATTGTGGAACTTCTGGGACGCAGGGGGTGGGAAGCCCTCAAATATTGGTGGAATCTCCTACAGTATTGGAGTCAGGAACTAAAGAATAGTGCTGTTAGCTTGCTCAATGCCACAGCCATAGCAGTAGCTGAGGGGACAGATAGGGTTATAGAAGTAGTACAAGGAGCTTGTAGAGCTATTCGCCACATACCTAGAAGAATAAGACAGGGCTTGGAAAGGATTTTGCTATAAGATGGGTGGCAAGTGGTCAAAAAGTAGTGTGATTGGATGGCCTACTGTAAGGGAAAGAATGAGACGAGCTGAGCCAGCAGCAGATAGGGTGGGAGCAGCATCTCGAGACCTGGAAAAACATGGAGCAATCACAAGTAGCAATACAGCAGCTACCAATGCTGCTTGTGCCTGGCTAGAAGCACAAGAGGAGGAGGAGGTGGGTTTTCCAGTCACACCTCAGGTACCTTTAAGACCAATGACTTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAATTCACTCCCAAAGAAGACAAGATATCCTTGATCTGTGGATCTACCACACACAAGGCTACTTCCCTGATTAGCAGAACTACACACCAGGGCCAGGGGTCAGATATCCACTGACCTTTGGATGGTGCTACAAGCTAGTACCAGTTGAGCCAGATAAGATAGAAGAGGCCAATAAAGGAGAGAACACCAGCTTGTTACACCCTGTGAGCCTGCATGGGATGGATGACCCGGAGAGAGAAGTGTTAGAGTGGAGGTTTGACAGCCGCCTAGCATTTCATCACGTGGCCCGAGAGCTGCATCCGGAGTACTTCAAGAACTGCTGACATCGAGCTTGCTACAAGGGACTTTCCGCTGGGGACTTTCCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATCCTGCATATAAGCAGCTGCTTTTTGCCTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCA
diff -r 000000000000 -r cffa21bb7a92 test-data/test-cache/reference.fasta.fai
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test-cache/reference.fasta.fai Tue May 23 13:42:43 2023 +0000
@@ -0,0 +1,1 @@
+K03455 9719 8 9719 9720
diff -r 000000000000 -r cffa21bb7a92 test-data/test-cache/reference.fasta.index
Binary file test-data/test-cache/reference.fasta.index has changed
diff -r 000000000000 -r cffa21bb7a92 test-data/test01_plot1.pdf
Binary file test-data/test01_plot1.pdf has changed
diff -r 000000000000 -r cffa21bb7a92 test-data/test01_plot2.pdf
Binary file test-data/test01_plot2.pdf has changed
diff -r 000000000000 -r cffa21bb7a92 test-data/test01_stats.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test01_stats.txt Tue May 23 13:42:43 2023 +0000
@@ -0,0 +1,80 @@
+--------------------------------------------------------------------------------
+
+Compute transcript with isoforms if any
+
+Number of gene 379
+Number of transcript 379
+Number of cds 376
+Number of exon 379
+Number of exon in cds 376
+Number gene overlapping 62
+Number of single exon gene 379
+Number of single exon transcript 379
+mean transcripts per gene 1.0
+mean cdss per transcript 1.0
+mean exons per transcript 1.0
+mean exons per cds 1.0
+Total gene length 342644
+Total transcript length 342644
+Total cds length 342338
+Total exon length 342644
+mean gene length 904
+mean transcript length 904
+mean cds length 910
+mean exon length 904
+mean cds piece length 910
+% of genome covered by gene 33.1
+% of genome covered by transcript 33.1
+% of genome covered by cds 33.1
+% of genome covered by exon 33.1
+Longest gene 9499
+Longest transcript 9499
+Longest cds 9499
+Longest exon 9499
+Longest cds piece 9499
+Shortest gene 54
+Shortest transcript 54
+Shortest cds 54
+Shortest exon 54
+Shortest cds piece 54
+
+Re-compute transcript without isoforms asked. We remove shortest isoforms if any
+
+Number of gene 379
+Number of transcript 379
+Number of cds 376
+Number of exon 379
+Number of exon in cds 376
+Number gene overlapping 62
+Number of single exon gene 379
+Number of single exon transcript 379
+mean transcripts per gene 1.0
+mean cdss per transcript 1.0
+mean exons per transcript 1.0
+mean exons per cds 1.0
+Total gene length 342644
+Total transcript length 342644
+Total cds length 342338
+Total exon length 342644
+mean gene length 904
+mean transcript length 904
+mean cds length 910
+mean exon length 904
+mean cds piece length 910
+% of genome covered by gene 33.1
+% of genome covered by transcript 33.1
+% of genome covered by cds 33.1
+% of genome covered by exon 33.1
+Longest gene 9499
+Longest transcript 9499
+Longest cds 9499
+Longest exon 9499
+Longest cds piece 9499
+Shortest gene 54
+Shortest transcript 54
+Shortest cds 54
+Shortest exon 54
+Shortest cds piece 54
+
+--------------------------------------------------------------------------------
+
diff -r 000000000000 -r cffa21bb7a92 test-data/test02.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test02.fasta Tue May 23 13:42:43 2023 +0000
@@ -0,0 +1,183 @@
+>nbis-gene-2 seq_id=NZ_CP027599.1 type=gene 5'extra=10nt 3'extra=20nt
+TCGTAAACCTATGAAATTTACCGTAGAACGTGAGCATTTATTAAAACCGCTACAACAGGT
+GAGCGGTCCGTTAGGTGGTCGTCCTACGCTACCGATTCTCGGTAATCTGCTGTTACAGGT
+TGCTGACGGTACGTTGTCGCTGACCGGTACTGATCTCGAGATGGAAATGGTGGCACGTGT
+TGCGCTGGTTCAGCCACACGAGCCAGGAGCGACGACCGTTCCGGCGCGCAAATTCTTTGA
+TATCTGCCGTGGTCTGCCTGAAGGCGCGGAAATTGCCGTGCAGCTGGAAGGTGAACGGAT
+GCTGGTACGCTCCGGGCGTAGCCGTTTTTCGCTGTCTACCCTGCCAGCGGCGGATTTCCC
+GAACCTCGATGACTGGCAGAGTGAAGTCGAATTTACCCTGCCGCAGGCAACGATGAAGCG
+TCTGATTGAAGCGACCCAGTTTTCGATGGCGCATCAGGACGTTCGCTATTACTTAAATGG
+TATGCTGTTTGAAACCGAAGGTGAAGAACTGCGCACCGTGGCAACCGACGGCCACCGTCT
+GGCGGTCTGTTCAATGCCAATTGGTCAATCTTTGCCAAGCCATTCGGTGATCGTACCGCG
+TAAAGGCGTGATTGAACTGATGCGTATGCTCGACGGCGGCGACAATCCGCTGCGCGTGCA
+GATTGGCAGCAACAATATTCGCGCCCACGTTGGCGACTTTATCTTCACCTCCAAACTGGT
+GGATGGTCGCTTCCCGGATTACCGCCGCGTTCTGCCGAAGAATCCGGACAAACATCTGGA
+AGCTGGCTGCGATCTGCTCAAGCAGGCGTTTGCCCGTGCGGCAATTCTCTCTAACGAGAA
+ATTCCGCGGCGTGCGCCTGTATGTCAGCGAAAACCAGCTGAAAATCACCGCCAACAACCC
+GGAACAGGAAGAAGCGGAAGAGATCCTCGACGTTACCTATAGCGGTGCGGAGATGGAAAT
+CGGCTTCAACGTCAGCTATGTGCTGGATGTTCTGAACGCGCTGAAATGCGAAAACGTCCG
+CATGATGCTGACCGATTCGGTTTCCAGCGTGCAGATTGAAGATGCCGCATCACAGTCGGC
+TGCCTATGTTGTCATGCCAATGAGACTGTAATGTCCCTCACCCGCTTGTTG
+>nbis-gene-3 seq_id=NZ_CP027599.1 type=gene 5'extra=10nt 3'extra=20nt
+TGAGACTGTAATGTCCCTCACCCGCTTGTTGATCCGCGATTTCCGCAACATTGAAACCGC
+GGATCTCGCTTTATCTCCCGGCTTTAACTTTCTGGTAGGTGCCAACGGCAGTGGCAAAAC
+CAGCGTGCTGGAAGCCATCTATACGCTCGGCCATGGTCGGGCGTTTCGCAGTTTGCAGAT
+TGGTCGCGTCATTCGCCATGAGCAGGAGGCATTTGTTCTCCATGGGCGATTACAGGGCGA
+AGAGCGCGAGACGGCGATTGGCTTAACCAAGGACAAACAGGGCGACAGCAAAGTCCGCAT
+CGACGGTACTGACGGGCATAAAGTCGCGGAACTGGCGCACCTGATGCCAATGCAGCTGAT
+AACGCCAGAAGGGTTTACTTTACTCAACGGCGGCCCCAAATACAGAAGAGCATTCCTCGA
+CTGGGGATGCTTTCACAACGAACCCGGATTTTTCACCGCCTGGAGCAATCTCAAGCGATT
+GCTCAAGCAGCGCAATGCGGCGCTGCGCCAGGTGACACGTTACGAACAGCTACGCCCGTG
+GGATAAAGAACTGATCCCGCTGGCGGAGCAAATCAGCACCTGGCGCGCGGAGTATAGCGC
+CGGTATCGCGGCCGATATGGCCGATACCTGTAAGCAATTTCTCCCTGAGTTTTCTCTGAC
+TTTCTCTTTCCAGCGCGGCTGGGAGAAAGAGACAGAATATGCTGAGGTGCTGGAACGTAA
+TTTTGAACGCGATCGCCAGCTAACCTACACCGCGCATGGCCCGCATAAAGCGGACTTACG
+CATTCGCGCCGACGGTGCGCCGGTGGAAGATACCTTATCGCGTGGGCAGCTTAAGCTGTT
+GATGTGCGCCTTACGTCTGGCGCAAGGAGAGTTCCTCACCCGTGAAAGCGGGCGGCGGTG
+TCTCTACCTGATAGATGATTTTGCCTCTGAGCTTGATGATGAGCGTCGTGGGTTGCTTGC
+CAGCCGCTTAAAAGCGACGCAATCACAGGTCTTTGTCAGCGCGATCAGTGCTGAACACGT
+TATAGACATGTCGGACGAAAATTCGAAGATGTTTACCGTGGAAAAGGGTAAAATAACGGA
+TTAACCCAAGTATAAATGAGCGAG
+>nbis-gene-4 seq_id=NZ_CP027599.1 type=gene 5'extra=10nt 3'extra=20nt
+AGAAACGTTGATGTCGAATTCTTATGACTCCTCCAGTATCAAAGTCCTGAAAGGGCTGGA
+TGCGGTGCGTAAGCGCCCGGGTATGTATATCGGCGACACGGATGACGGCACCGGTCTGCA
+CCACATGGTATTCGAGGTGGTAGATAACGCTATCGACGAAGCGCTCGCGGGTCACTGTAA
+AGAAATTATCGTCACCATTCACGCCGACAACTCTGTCTCTGTACAGGATGACGGGCGCGG
+CATTCCGACCGGTATTCACCCGGAAGAGGGCGTATCGGCGGCGGAAGTGATCATGACCGT
+TCTGCACGCAGGCGGTAAATTCGACGATAACTCCTATAAAGTGTCCGGCGGTCTGCACGG
+CGTTGGTGTTTCGGTAGTAAACGCCCTGTCGCAAAAACTGGAGCTGGTTATCCAGCGCGA
+GGGTAAAATTCACCGTCAGATCTACGAACACGGTGTACCGCAGGCCCCGCTGGCGGTTAC
+CGGCGAGACTGAAAAAACCGGCACCATGGTGCGTTTCTGGCCTAGCCTCGAAACTTTCAC
+CAATGTGACCGAGTTCGAATATGAAATTCTGGCGAAACGTCTGCGTGAGTTGTCGTTCCT
+CAACTCCGGCGTTTCCATTCGTCTGCGCGACAAGCGCGACGGCAAAGAAGACCACTTCCA
+CTATGAAGGCGGCATCAAGGCGTTCGTTGAATATCTGAACAAGAACAAAACGCCGATCCA
+CCCGAATATCTTCTACTTCTCCACTGAAAAAGACGGTATTGGCGTCGAAGTGGCGTTGCA
+GTGGAACGATGGCTTCCAGGAAAACATCTACTGCTTTACCAACAACATTCCGCAGCGTGA
+CGGCGGTACTCACCTGGCAGGCTTCCGTGCGGCGATGACCCGTACCCTGAACGCCTACAT
+GGACAAAGAAGGCTACAGCAAAAAAGCCAAAGTTAGCGCCACCGGTGACGATGCGCGTGA
+AGGCCTGATTGCGGTCGTTTCCGTGAAAGTGCCGGACCCGAAATTCTCCTCCCAGACCAA
+AGACAAACTGGTTTCTTCTGAGGTGAAATCAGCGGTTGAACAGCAGATGAACGAACTGCT
+GGCAGAATACCTGCTGGAAAACCCAACCGACGCGAAAATCGTGGTTGGCAAAATTATCGA
+TGCTGCCCGTGCCCGTGAAGCGGCGCGTCGCGCGCGTGAAATGACCCGCCGTAAAGGTGC
+GCTCGACTTAGCGGGCCTGCCGGGCAAACTGGCAGACTGCCAGGAACGCGATCCGGCGCT
+TTCCGAACTGTACTTGGTGGAAGGGGACTCCGCGGGCGGCTCTGCGAAGCAGGGGCGTAA
+CCGCAAGAACCAGGCGATTCTGCCGCTGAAGGGTAAAATCCTCAACGTCGAGAAAGCGCG
+CTTCGATAAGATGCTCTCTTCTCAGGAAGTGGCGACGCTTATCACCGCGCTTGGCTGTGG
+TATCGGTCGTGACGAGTACAACCCGGACAAACTGCGTTATCACAGCATCATCATCATGAC
+CGATGCGGACGTCGACGGCTCGCACATTCGTACGCTGCTGTTGACCTTCTTCTATCGTCA
+GATGCCGGAAATCGTTGAACGCGGTCACGTCTACATCGCTCAGCCGCCGCTGTACAAAGT
+GAAGAAAGGCAAGCAGGAACAGTACATTAAAGACGACGAAGCGATGGATCAGTACCAGAT
+CTCTATCGCGCTGGATGGCGCAACGCTGCACACCAACGCCAGCGCACCGGCATTGGCTGG
+CGAAGCGTTAGAGAAATTGGTGTCTGAGTACAACGCGACGCAGAAAATGATCAACCGCAT
+GGAGCGTCGTTATCCGAAAGCAATGCTGAAAGAGCTTATCTATCAGCCGACGCTGACGGA
+AGCCGACCTCTCTGATGAGCAGACCGTTACCCGCTGGGTGAACGCGCTGGTCAGCGAACT
+GAACGACAAAGAACAGCACGGCAGCCAGTGGAAGTTTGATGTCCACACCAATGCCGAACA
+AAACCTGTTCGAGCCGATTGTTCGCGTGCGTACCCACGGTGTGGATACTGACTATCCGCT
+GGATCACGAGTTTATCACCGGTGGCGAATATCGTCGTATCTGCACGCTGGGTGAGAAACT
+GCGTGGCTTGCTGGAAGAAGATGCGTTTATCGAACGTGGCGAGCGTCGTCAGCCGGTAGC
+CAGCTTCGAGCAGGCGCTGGACTGGCTGGTGAAAGAGTCCCGTCGCGGCCTCTCCATCCA
+GCGTTATAAAGGTCTGGGCGAGATGAACCCGGAACAGCTGTGGGAAACCACCATGGACCC
+GGAAAGCCGTCGTATGCTGCGCGTTACCGTTAAGGATGCGATTGCCGCTGACCAGTTGTT
+CACCACGCTGATGGGCGACGCCGTTGAACCGCGCCGTGCGTTTATTGAAGAGAACGCCCT
+GAAAGCGGCGAATATCGATATTTAATGGCGCTAACCATGCGAGCG
+>nbis-gene-5 seq_id=NZ_CP027599.1 type=gene 5'extra=10nt 3'extra=20nt
+GGTGATTATCATGGGGCTTTTTGATGAAGTTGTCGGTGCCTTTCTGAAAGGCGATGCGGG
+GAAATATCAGGCTATTTTAAGTTGGGTTGAGGAGCAGGGCGGCATTCAGGTGCTGCTGGA
+AAAACTGCAAAGTGGCGGCTTAGGGGCCATTCTCTCAACCTGGCTGAGTAATCAACAGGG
+CAATCAATCGGTTAGTGGCGAGCAACTGGAATCGGCGCTCGGCACAAATGCGGTGTCCGA
+TCTTGGACAAAAACTTGGCGTGGATACCAGTACAGCTTCCAGTTTACTGGCAGAACAATT
+GCCGAAGATTATTGATGCGCTCTCACCGCAAGGTGAAGTGTCTCCACAAGCCAATAACGA
+TCTGCTTTCCGCAGGCATGGAACTGCTGAAAGGGAAACTCTTCCGCTAAGCAAATGGGGA
+GCATGCAAC
+>nbis-gene-6 seq_id=NZ_CP027599.1 type=gene 5'extra=10nt 3'extra=20nt
+TGGGGAACTCATGGCTATCAAACTCATTGCTATCGATATGGATGGCACCCTTCTGCTACC
+CGATCACACCATTTCACCCGCCGTTAAAAATGCGATTGCCGCAGCTCGCGCCCGTGGCGT
+GAATGTCGTGCTAACGACGGGTCGCCCTTATGCAGGTGTTCACAATTACCTGAAAGAGCT
+GCATATGGAACTGCCGGGCGACTACTGCATTACTTATAACGGCGCGCTGGTACAGAAGGC
+CGCTGATGGTAGCACCGTGGCGCAAACCGCTCTCAGCTATGACGACTACCGTTTCCTGGA
+AAAACTCTCTCGCGAAGTCGGTTCTCATTTCCACGCCCTGGACCGCACCACGCTGTACAC
+CGCCAACCGTGATATCAGCTACTACACGGTGCATGAATCCTTCGTTGCCACAATTCCGCT
+GGTGTTCTGCGAAGCGGAGAAAATGGACCCCAATACCCAGTTCCTGAAAGTGATGATGAT
+TGATGAACCCGCCATCCTCGACCAGGCTATCGCGCGTATTCCGCAGGAAGTGAAAGAGAA
+ATATACCGTGCTGAAAAGTGCGCCGTACTTCCTCGAAATCCTCGATAAACGCGTTAACAA
+AGGTACGGGGGTGAAATCACTGGCCGACGTGTTAGGTATTAAACCGGAAGAAATCATGGC
+GATTGGCGATCAGGAAAACGACATCGCAATGATTGAATATGCAGGCGTCGGTGTGGCGAT
+GGATAACGCTATTCCTTCGGTGAAAGAAGTGGCGAACTTTGTCACCAAATCCAACCTTGA
+AGATGGCGTGGCGTTTGCTATTGAGAAGTATGTGCTGAATTAATCAGTGGACGGGCAAAC
+AGC
+>nbis-gene-7 seq_id=NZ_CP027599.1 type=gene 3'extra=20nt 5'extra=10nt
+AGGATTAATCATGAAGTTGAATTTTAAGGGATTTTTTAAGGCTGCCGGTTTATTCCCACT
+GGCGCTGATGCTTTCAGGCTGTATCTCGTATGCTCTGGTTTCCCATACCGCAAAGGGTAG
+TTCAGGAAAGTATCAATCGCAGTCAGACACCATCACTGGGCTATCGCAGGCAAAAGATAG
+TAATGGAACAAAAGGCTATGTTTTTGTAGGGGAATCGCTGGATTACCTTATCACTGATGG
+TGCCGATGACATCGTTAAGATGCTCAATGATCCAGCACTTAACCGGCACAATATTCAGGT
+TGCCGATGACGCAAGATTTGTTTTAAATGCGGGGAAAAAGAAATTTACCGGCACAATATC
+GCTTTACTACCACTGGAATAACGAAGAAGAAAAGGCACTGGCAACGCATTATGGTTTTGC
+CTGTGGTGTTCAACACTGTACCAGGTCACTGGAAAACCTAAAAGGCACAATCCATGAGAA
+AAATAAAAACATGGATTACTCAAAGGTGATGGCGTTCTATCATCCGTTTAAAGTGCGATT
+TTATGAATACTATTCACCCAGAGGCATTCCGGATGGTGTTTCCGCAGCATTACTGCCAGT
+GACTGTTACGCTGGACATCATTACTGCACCGCTGCAATTTCTGGTTGTATATGCAGTAAA
+CCAATAATCAGTAAGCGGGCAAACGCG
+>nbis-gene-8 seq_id=NZ_CP027599.1 type=gene 5'extra=10nt 3'extra=20nt
+AGGACTCTCCATGACTCTCAATAAAACCGATCGCATTGTCATTACGCTGGGTAAACAGAT
+TGTTCACGGCAAATACGTACCTGGCTCGCCACTTCCGGCTGAGGCGGAGCTCTGTGAAGA
+GTTTGCAACCTCGCGCAACATCATCCGTGAGGTGTTCCGTTCGTTGATGGCGAAACGGCT
+GATTGAAATGAAACGTTATCGCGGCGCGTTTGTGGCACCGCGTAACCAGTGGAATTACCT
+CGACACTGACGTACTGCAATGGGTGCTGGAAAACGACTACGACCCACGGCTTATCAGTGC
+CATGAGCGAAGTGCGAAATCTGGTGGAACCGGCGATTGCCCGTTGGGCAGCAGAGCGCGC
+GACTTCCAGCGATCTGGCGCAGATTGAATCGGCGCTGAACGAGATGATTGCCAACAATCA
+GGACCGCGAAGCGTTTAACGAAGCGGATATTCGCTACCACGAGGCGGTGCTGCAGTCGGT
+ACATAACCCGGTGTTACAGCAACTTAGCATTGCGATCAGTTCGTTGCAGCGGGCGGTTTT
+TGAACGAACCTGGATGGGCGATGAGGCCAACATGCCGCAAACGCTCCAGGAACATAAGGC
+GCTGTTCGATGCAATACGGCATCAGGACGGCGATGCGGCAGAGCAGGCGGCGCTTACCAT
+GATCGCCAGCTCGACACGAAGGTTAAAGGAAATCACATGACAGCTCGCTACATCGCAATT
+>nbis-gene-9 seq_id=NZ_CP027599.1 type=gene 5'extra=10nt 3'extra=20nt
+AGGAAATCACATGACAGCTCGCTACATCGCAATTGACTGGGGATCGACCAATCTTCGCGC
+CTGGCTTTATCAGGGCGACCACTGCCTGGAGAGCAGGCAATCAGAAGCAGGCGTCACGCG
+CCTGAACGGAAAATCTCCGGCTGCGGTGTTAGCAGAAGTCACGACCGACTGGCGTGAAGA
+GAATACGCCAGTGGTAATGGCAGGAATGGTCGGCAGCAATGTCGGCTGGAAAGTTGCTCC
+GTATTTATCTGTTCCTGCCCGTTTTTCGTCTATTGGCGAACAATTAACGTCTGTTGGCGA
+CAATATCTGGATTATTCCCGGATTATGCGTCTCTCATGACGATAACCACAATGTGATGCG
+CGGCGAAGAAACACAATTGATCGGCGCGCGAACTCTGGCTCCTTCCTCTCTTTATGTTAT
+GCCCGGTACGCATTGCAAATGGGTGCAGGCCGATAGCCAGCAAATCAACGATTTTCGCAC
+CGTGATGACCGGTGAATTACATCATTTACTGTTAAATCACTCATTGATTGGCGCAGGTTT
+GCCGCCGCAGGAAAACTCTGCCGATGCCTTCGCGGCTGGCCTTGAGCGCGGCCTTAATGC
+GCCCGCCATATTGCCGCAGCTTTTTGAAGTTCGCGCCTCGCATGTGCTGGGAACACTTCC
+CCGCGAACAGGTCAGCGAATTTCTCTCTGGTTTGTTGATTGGCGCAGAGGTTGCCAGTAT
+GCGCGACTATGTGACCCATCAACACGCCATCACCCTTGTCGCCGGAACATCGCTGACCGC
+GCGCTACCAGCAAGCCTTTCAGGCGATGGGTTGCGACGTGACGGCGGTGGCGGGCGACAC
+GGCATTTCAGGCTGGTATAAGGAGCATCGCTCATGCAGTGGCAAACTAAACTTCCGCTGA
+TCGCCATTT
+>nbis-gene-10 seq_id=NZ_CP027599.1 type=gene 5'extra=10nt 3'extra=20nt
+AGCATCGCTCATGCAGTGGCAAACTAAACTTCCGCTGATCGCCATTTTGCGCGGCATTAA
+GCCCGACGAGGCGCTGGCGCATGTTGGCGCGGTGATTGACGCCGGGTTCGACGCGGTTGA
+AATCCCGCTGAATTCCCCACAATGGGAGCAAAGCATTCCCGCCATCGTTGATGCGTATGG
+CGACAAGGCGTTGATTGGCGCAGGTACGGTACTGAAACCTGAACAGGTCGATGCGCTCGC
+CAGGATGGGTTGTCAGCTCATCGTTACGCCCAATATCCATAGTGAAGTGATCCGCCGTGC
+GGTGGGCTACGGCATGACCGTCTGCCCCGGCTGCGCGACGGCGACCGAAGCCTTTACCGC
+GCTCGAAGCGGGCGCGCAGGCGCTGAAAATATTTCCGTCATCGGCTTTTGGTCCGCAATA
+CATCAAAGCGTTAAAAGCGGTATTGCCATCGGACATCGCAGTCTTTGCCGTTGGCGGCGT
+GACGCCAGAAAACCTGGCGCAGTGGATAGACGCAGGTTGTGCTGGGGCGGGCTTAGGCAG
+CGATCTCTATCGCGCCGGGCAGTCCGTAGAACGCACCGCGCAGCAGGCAGCAGCATTTGT
+TAAGGCGTATCGAGAGGCAGTGCAATGAAAATCACCAAAATTACCACG
+>nbis-gene-11 seq_id=NZ_CP027599.1 type=gene 5'extra=10nt 3'extra=20nt
+AGGCAGTGCAATGAAAATCACCAAAATTACCACGTATCGTTTACCTCCCCGCTGGATGTT
+CCTGAAAATTGAAACCGATGAAGGCGTGGTCGGTTGGGGCGAGCCCGTGATTGAAGGCCG
+CGCCCGTACGGTGGAAGCGGCAGTTCACGAGCTGGGTGACTATTTGATTGGTCAGGATCC
+TTCGCGCATCAATGACTTATGGCAAGTGATGTATCGCGCCGGATTTTATCGTGGCGGTCC
+AATCCTGATGAGCGCCATTGCCGGGATCGACCAGGCGTTATGGGATATCAAAGGCAAAGT
+GCTGAATGCGCCGGTCTGGCAACTGATGGGCGGCCTGGTTCGCGACAAAATTAAAGCCTA
+CAGTTGGGTCGGCGGCGATCGTCCGGCGGATGTTATCGACGGCATTAAAACCCTGCGCGA
+AATCGGCTTCGATACCTTCAAACTGAACGGTTGTGAAGAACTGGGGCTAATTGATAACTC
+CCGCGCGGTAGATGCGGCAGTCAACACCGTGGCACAAATTCGTGAAGCTTTTGGCAATCA
+GATTGAGTTTGGTCTTGATTTCCACGGTCGCGTCAGCGCGCCAATGGCGAAAGTGCTGAT
+TAAAGAACTGGAGCCGTATCGCCCGCTGTTTATTGAAGAGCCGGTGCTGGCGGAACAAGC
+CGAATACTACCCGAAATTGGCGGCACAAACGCATATTCCACTGGCGGCAGGTGAGCGCAT
+GTTCTCACGTTTCGATTTTAAACGCGTGCTGGAGGCAGGCGGTATTTCGATTCTGCAACC
+GGATCTCTCCCATGCAGGCGGTATTACCGAATGCTACAAAATTGCTGGAATGGCAGAAGC
+CTATGATGTGACCCTTGCGCCGCACTGTCCGCTCGGACCGATTGCACTGGCAGCTTGCCT
+GCATATCGACTTTGTTTCCTATAACGCGGTACTTCAGGAACAAAGTATGGGCATTCATTA
+CAACAAAGGCGCGGAGTTACTCGACTTTGTGAAAAACAAAGAAGACTTCAGTATGGTTGG
+CGGCTTCTTTAAACCGTTAACGAAACCGGGCTTAGGTGTGGAAATCGACGAAGCTAAAGT
+TATTGAGTTCAGTAAAAATGCCCCGGACTGGCGTAATCCGCTCTGGCGTCATGAAGATAA
+CAGCGTAGCAGAGTGGTAATTCCTGCCACGTAAGCCCCT
diff -r 000000000000 -r cffa21bb7a92 test-data/test02_plot.pdf
Binary file test-data/test02_plot.pdf has changed
diff -r 000000000000 -r cffa21bb7a92 test-data/test03.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test03.txt Tue May 23 13:42:43 2023 +0000
@@ -0,0 +1,28 @@
+usage: /home/laptop/miniconda3/envs/mulled-v1-d5d9956f5cc87a70e05e5aa3970eaf3637ef7e96fa1e50da0f6646fabcdc59e1/bin/agat_sp_compare_two_annotations.pl --gff1 annotation1.gtf --gff2 annotation2.gtf --output temp_output
+Results of number of genes from file1 that overlap genes from file2:
+
+----------------------------------------------------------------------------------------------
+| gene@transcript@cds |
+----------------------------------------------------------------------------------------------
+| annotation1.gtf | annotation2.gtf | Number of cases |
+----------------------------------------------------------------------------------------------
+| 1 | 0 | 366 |
+| 1 | 1 | 4 |
+| 2 | 2 | 3 |
+----------------------------------------------------------------------------------------------
+Number gene in annotation1: 376
+Number gene in annotation2: 10
+
+
+----------------------------------------------------------------------------------------------
+| gene@transcript@exon |
+----------------------------------------------------------------------------------------------
+| annotation1.gtf | annotation2.gtf | Number of cases |
+----------------------------------------------------------------------------------------------
+| 1 | 0 | 3 |
+----------------------------------------------------------------------------------------------
+Number gene in annotation1: 3
+Number gene in annotation2: 0
+
+
+
diff -r 000000000000 -r cffa21bb7a92 test-data/test04.gff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test04.gff Tue May 23 13:42:43 2023 +0000
@@ -0,0 +1,54 @@
+##gff-version 3
+##gtf-version 3
+#!gff-spec-version 1.21
+#!processor NCBI annotwriter
+#!genome-build ASM301845v1
+#!genome-build-accession NCBI_Assembly:GCF_003018455.1
+#!annotation-date 05/25/2022 04:54:31
+#!annotation-source NCBI RefSeq
+##sequence-region NZ_CP027599.1 1 5942969
+##species https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=562
+NZ_CP027599.1 RefSeq gene 1052 2152 . + . ID=nbis-gene-2;Name=dnaN;gbkey=Gene;gene=dnaN;gene_biotype=protein_coding;gene_id=nbis-gene-2;locus_tag=C7A06_RS00010
+NZ_CP027599.1 RefSeq transcript 1052 2152 . + . ID=gene-C7A06_RS00010;Parent=nbis-gene-2;Name=dnaN;gbkey=Gene;gene=dnaN;gene_biotype=protein_coding;gene_id=nbis-gene-2;locus_tag=C7A06_RS00010;original_biotype=mrna;transcript_id=gene-C7A06_RS00010
+NZ_CP027599.1 Protein Homology exon 1052 2152 . + . ID=nbis-exon-2;Parent=gene-C7A06_RS00010;Dbxref=Genbank:WP_000673464.1;Name=WP_000673464.1;Ontology_term=GO:0006260,GO:0003887,GO:0009360;gbkey=CDS;gene=dnaN;gene_id=nbis-gene-2;go_component=DNA polymerase III complex|0009360||IEA;go_function=DNA-directed DNA polymerase activity|0003887||IEA;go_process=DNA replication|0006260||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1;locus_tag=C7A06_RS00010;product=DNA polymerase III subunit beta;protein_id=WP_000673464.1;transcript_id=gene-C7A06_RS00010;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 1052 2152 . + 0 ID=cds-WP_000673464.1;Parent=gene-C7A06_RS00010;Dbxref=Genbank:WP_000673464.1;Name=WP_000673464.1;Ontology_term=GO:0006260,GO:0003887,GO:0009360;gbkey=CDS;gene=dnaN;gene_id=nbis-gene-2;go_component=DNA polymerase III complex|0009360||IEA;go_function=DNA-directed DNA polymerase activity|0003887||IEA;go_process=DNA replication|0006260||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1;locus_tag=C7A06_RS00010;product=DNA polymerase III subunit beta;protein_id=WP_000673464.1;transcript_id=gene-C7A06_RS00010;transl_table=11
+NZ_CP027599.1 RefSeq gene 2152 3225 . + . ID=nbis-gene-3;Name=recF;gbkey=Gene;gene=recF;gene_biotype=protein_coding;gene_id=nbis-gene-3;locus_tag=C7A06_RS00015
+NZ_CP027599.1 RefSeq transcript 2152 3225 . + . ID=gene-C7A06_RS00015;Parent=nbis-gene-3;Name=recF;gbkey=Gene;gene=recF;gene_biotype=protein_coding;gene_id=nbis-gene-3;locus_tag=C7A06_RS00015;original_biotype=mrna;transcript_id=gene-C7A06_RS00015
+NZ_CP027599.1 Protein Homology exon 2152 3225 . + . ID=nbis-exon-3;Parent=gene-C7A06_RS00015;Dbxref=Genbank:WP_000060112.1;Name=WP_000060112.1;Ontology_term=GO:0006281,GO:0003697,GO:0005524;gbkey=CDS;gene=recF;gene_id=nbis-gene-3;go_function=single-stranded DNA binding|0003697||IEA,ATP binding|0005524||IEA;go_process=DNA repair|0006281||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1;locus_tag=C7A06_RS00015;product=DNA replication/repair protein RecF;protein_id=WP_000060112.1;transcript_id=gene-C7A06_RS00015;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 2152 3225 . + 0 ID=cds-WP_000060112.1;Parent=gene-C7A06_RS00015;Dbxref=Genbank:WP_000060112.1;Name=WP_000060112.1;Ontology_term=GO:0006281,GO:0003697,GO:0005524;gbkey=CDS;gene=recF;gene_id=nbis-gene-3;go_function=single-stranded DNA binding|0003697||IEA,ATP binding|0005524||IEA;go_process=DNA repair|0006281||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1;locus_tag=C7A06_RS00015;product=DNA replication/repair protein RecF;protein_id=WP_000060112.1;transcript_id=gene-C7A06_RS00015;transl_table=11
+NZ_CP027599.1 RefSeq gene 3254 5668 . + . ID=nbis-gene-4;Name=gyrB;gbkey=Gene;gene=gyrB;gene_biotype=protein_coding;gene_id=nbis-gene-4;locus_tag=C7A06_RS00020
+NZ_CP027599.1 RefSeq transcript 3254 5668 . + . ID=gene-C7A06_RS00020;Parent=nbis-gene-4;Name=gyrB;gbkey=Gene;gene=gyrB;gene_biotype=protein_coding;gene_id=nbis-gene-4;locus_tag=C7A06_RS00020;original_biotype=mrna;transcript_id=gene-C7A06_RS00020
+NZ_CP027599.1 Protein Homology exon 3254 5668 . + . ID=nbis-exon-4;Parent=gene-C7A06_RS00020;Dbxref=Genbank:WP_000072067.1;Name=WP_000072067.1;Ontology_term=GO:0006265,GO:0003918,GO:0009330;gbkey=CDS;gene=gyrB;gene_id=nbis-gene-4;go_component=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) complex|0009330||IEA;go_function=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) activity|0003918||IEA;go_process=DNA topological change|0006265||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1;locus_tag=C7A06_RS00020;product=DNA topoisomerase (ATP-hydrolyzing) subunit B;protein_id=WP_000072067.1;transcript_id=gene-C7A06_RS00020;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 3254 5668 . + 0 ID=cds-WP_000072067.1;Parent=gene-C7A06_RS00020;Dbxref=Genbank:WP_000072067.1;Name=WP_000072067.1;Ontology_term=GO:0006265,GO:0003918,GO:0009330;gbkey=CDS;gene=gyrB;gene_id=nbis-gene-4;go_component=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) complex|0009330||IEA;go_function=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) activity|0003918||IEA;go_process=DNA topological change|0006265||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1;locus_tag=C7A06_RS00020;product=DNA topoisomerase (ATP-hydrolyzing) subunit B;protein_id=WP_000072067.1;transcript_id=gene-C7A06_RS00020;transl_table=11
+NZ_CP027599.1 RefSeq gene 5908 6306 . + . ID=nbis-gene-5;Name=yidB;gbkey=Gene;gene=yidB;gene_biotype=protein_coding;gene_id=nbis-gene-5;locus_tag=C7A06_RS00025
+NZ_CP027599.1 RefSeq transcript 5908 6306 . + . ID=gene-C7A06_RS00025;Parent=nbis-gene-5;Name=yidB;gbkey=Gene;gene=yidB;gene_biotype=protein_coding;gene_id=nbis-gene-5;locus_tag=C7A06_RS00025;original_biotype=mrna;transcript_id=gene-C7A06_RS00025
+NZ_CP027599.1 Protein Homology exon 5908 6306 . + . ID=nbis-exon-5;Parent=gene-C7A06_RS00025;Dbxref=Genbank:WP_000522208.1;Name=WP_000522208.1;gbkey=CDS;gene=yidB;gene_id=nbis-gene-5;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418153.4;locus_tag=C7A06_RS00025;product=YidB family protein;protein_id=WP_000522208.1;transcript_id=gene-C7A06_RS00025;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 5908 6306 . + 0 ID=cds-WP_000522208.1;Parent=gene-C7A06_RS00025;Dbxref=Genbank:WP_000522208.1;Name=WP_000522208.1;gbkey=CDS;gene=yidB;gene_id=nbis-gene-5;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418153.4;locus_tag=C7A06_RS00025;product=YidB family protein;protein_id=WP_000522208.1;transcript_id=gene-C7A06_RS00025;transl_table=11
+NZ_CP027599.1 RefSeq gene 6421 7233 . + . ID=nbis-gene-6;Name=yidA;gbkey=Gene;gene=yidA;gene_biotype=protein_coding;gene_id=nbis-gene-6;locus_tag=C7A06_RS00030
+NZ_CP027599.1 RefSeq transcript 6421 7233 . + . ID=gene-C7A06_RS00030;Parent=nbis-gene-6;Name=yidA;gbkey=Gene;gene=yidA;gene_biotype=protein_coding;gene_id=nbis-gene-6;locus_tag=C7A06_RS00030;original_biotype=mrna;transcript_id=gene-C7A06_RS00030
+NZ_CP027599.1 Protein Homology exon 6421 7233 . + . ID=nbis-exon-6;Parent=gene-C7A06_RS00030;Dbxref=Genbank:WP_000985541.1;Name=WP_000985541.1;Ontology_term=GO:0016787;gbkey=CDS;gene=yidA;gene_id=nbis-gene-6;go_function=hydrolase activity|0016787||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418152.1;locus_tag=C7A06_RS00030;product=sugar-phosphatase;protein_id=WP_000985541.1;transcript_id=gene-C7A06_RS00030;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 6421 7233 . + 0 ID=cds-WP_000985541.1;Parent=gene-C7A06_RS00030;Dbxref=Genbank:WP_000985541.1;Name=WP_000985541.1;Ontology_term=GO:0016787;gbkey=CDS;gene=yidA;gene_id=nbis-gene-6;go_function=hydrolase activity|0016787||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418152.1;locus_tag=C7A06_RS00030;product=sugar-phosphatase;protein_id=WP_000985541.1;transcript_id=gene-C7A06_RS00030;transl_table=11
+NZ_CP027599.1 RefSeq gene 7279 7935 . - . ID=nbis-gene-7;Name=C7A06_RS00035;gbkey=Gene;gene_biotype=protein_coding;gene_id=nbis-gene-7;locus_tag=C7A06_RS00035
+NZ_CP027599.1 RefSeq transcript 7279 7935 . - . ID=gene-C7A06_RS00035;Parent=nbis-gene-7;Name=C7A06_RS00035;gbkey=Gene;gene_biotype=protein_coding;gene_id=nbis-gene-7;locus_tag=C7A06_RS00035;original_biotype=mrna;transcript_id=gene-C7A06_RS00035
+NZ_CP027599.1 Protein Homology exon 7279 7935 . - . ID=nbis-exon-7;Parent=gene-C7A06_RS00035;Dbxref=Genbank:WP_000772931.1;Name=WP_000772931.1;gbkey=CDS;gene_id=nbis-gene-7;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709504.1;locus_tag=C7A06_RS00035;product=hypothetical protein;protein_id=WP_000772931.1;transcript_id=gene-C7A06_RS00035;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 7279 7935 . - 0 ID=cds-WP_000772931.1;Parent=gene-C7A06_RS00035;Dbxref=Genbank:WP_000772931.1;Name=WP_000772931.1;gbkey=CDS;gene_id=nbis-gene-7;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709504.1;locus_tag=C7A06_RS00035;product=hypothetical protein;protein_id=WP_000772931.1;transcript_id=gene-C7A06_RS00035;transl_table=11
+NZ_CP027599.1 RefSeq gene 8213 8902 . + . ID=nbis-gene-8;Name=dgoR;gbkey=Gene;gene=dgoR;gene_biotype=protein_coding;gene_id=nbis-gene-8;locus_tag=C7A06_RS00040
+NZ_CP027599.1 RefSeq transcript 8213 8902 . + . ID=gene-C7A06_RS00040;Parent=nbis-gene-8;Name=dgoR;gbkey=Gene;gene=dgoR;gene_biotype=protein_coding;gene_id=nbis-gene-8;locus_tag=C7A06_RS00040;original_biotype=mrna;transcript_id=gene-C7A06_RS00040
+NZ_CP027599.1 Protein Homology exon 8213 8902 . + . ID=nbis-exon-8;Parent=gene-C7A06_RS00040;Dbxref=Genbank:WP_000174305.1;Name=WP_000174305.1;gbkey=CDS;gene=dgoR;gene_id=nbis-gene-8;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709505.1;locus_tag=C7A06_RS00040;product=D-galactonate utilization transcriptional regulator DgoR;protein_id=WP_000174305.1;transcript_id=gene-C7A06_RS00040;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 8213 8902 . + 0 ID=cds-WP_000174305.1;Parent=gene-C7A06_RS00040;Dbxref=Genbank:WP_000174305.1;Name=WP_000174305.1;gbkey=CDS;gene=dgoR;gene_id=nbis-gene-8;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709505.1;locus_tag=C7A06_RS00040;product=D-galactonate utilization transcriptional regulator DgoR;protein_id=WP_000174305.1;transcript_id=gene-C7A06_RS00040;transl_table=11
+NZ_CP027599.1 RefSeq gene 8899 9777 . + . ID=nbis-gene-9;Name=dgoK;gbkey=Gene;gene=dgoK;gene_biotype=protein_coding;gene_id=nbis-gene-9;locus_tag=C7A06_RS00045
+NZ_CP027599.1 RefSeq transcript 8899 9777 . + . ID=gene-C7A06_RS00045;Parent=nbis-gene-9;Name=dgoK;gbkey=Gene;gene=dgoK;gene_biotype=protein_coding;gene_id=nbis-gene-9;locus_tag=C7A06_RS00045;original_biotype=mrna;transcript_id=gene-C7A06_RS00045
+NZ_CP027599.1 Protein Homology exon 8899 9777 . + . ID=nbis-exon-9;Parent=gene-C7A06_RS00045;Dbxref=Genbank:WP_000127112.1;Name=WP_000127112.1;gbkey=CDS;gene=dgoK;gene_id=nbis-gene-9;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709506.1;locus_tag=C7A06_RS00045;product=2-dehydro-3-deoxygalactonokinase;protein_id=WP_000127112.1;transcript_id=gene-C7A06_RS00045;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 8899 9777 . + 0 ID=cds-WP_000127112.1;Parent=gene-C7A06_RS00045;Dbxref=Genbank:WP_000127112.1;Name=WP_000127112.1;gbkey=CDS;gene=dgoK;gene_id=nbis-gene-9;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709506.1;locus_tag=C7A06_RS00045;product=2-dehydro-3-deoxygalactonokinase;protein_id=WP_000127112.1;transcript_id=gene-C7A06_RS00045;transl_table=11
+NZ_CP027599.1 RefSeq gene 9761 10378 . + . ID=nbis-gene-10;Name=dgoA;gbkey=Gene;gene=dgoA;gene_biotype=protein_coding;gene_id=nbis-gene-10;locus_tag=C7A06_RS00050
+NZ_CP027599.1 RefSeq transcript 9761 10378 . + . ID=gene-C7A06_RS00050;Parent=nbis-gene-10;Name=dgoA;gbkey=Gene;gene=dgoA;gene_biotype=protein_coding;gene_id=nbis-gene-10;locus_tag=C7A06_RS00050;original_biotype=mrna;transcript_id=gene-C7A06_RS00050
+NZ_CP027599.1 Protein Homology exon 9761 10378 . + . ID=nbis-exon-10;Parent=gene-C7A06_RS00050;Dbxref=Genbank:WP_001198699.1;Name=WP_001198699.1;gbkey=CDS;gene=dgoA;gene_id=nbis-gene-10;inference=COORDINATES: similar to AA sequence:RefSeq:YP_026238.1;locus_tag=C7A06_RS00050;product=2-dehydro-3-deoxy-6-phosphogalactonate aldolase;protein_id=WP_001198699.1;transcript_id=gene-C7A06_RS00050;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 9761 10378 . + 0 ID=cds-WP_001198699.1;Parent=gene-C7A06_RS00050;Dbxref=Genbank:WP_001198699.1;Name=WP_001198699.1;gbkey=CDS;gene=dgoA;gene_id=nbis-gene-10;inference=COORDINATES: similar to AA sequence:RefSeq:YP_026238.1;locus_tag=C7A06_RS00050;product=2-dehydro-3-deoxy-6-phosphogalactonate aldolase;protein_id=WP_001198699.1;transcript_id=gene-C7A06_RS00050;transl_table=11
+NZ_CP027599.1 RefSeq gene 10375 11523 . + . ID=nbis-gene-11;Name=dgoD;gbkey=Gene;gene=dgoD;gene_biotype=protein_coding;gene_id=nbis-gene-11;locus_tag=C7A06_RS00055
+NZ_CP027599.1 RefSeq transcript 10375 11523 . + . ID=gene-C7A06_RS00055;Parent=nbis-gene-11;Name=dgoD;gbkey=Gene;gene=dgoD;gene_biotype=protein_coding;gene_id=nbis-gene-11;locus_tag=C7A06_RS00055;original_biotype=mrna;transcript_id=gene-C7A06_RS00055
+NZ_CP027599.1 Protein Homology exon 10375 11523 . + . ID=nbis-exon-11;Parent=gene-C7A06_RS00055;Dbxref=Genbank:WP_000705001.1;Name=WP_000705001.1;Ontology_term=GO:0009063,GO:0008869;gbkey=CDS;gene=dgoD;gene_id=nbis-gene-11;go_function=galactonate dehydratase activity|0008869||IEA;go_process=cellular amino acid catabolic process|0009063||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1;locus_tag=C7A06_RS00055;product=galactonate dehydratase;protein_id=WP_000705001.1;transcript_id=gene-C7A06_RS00055;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 10375 11523 . + 0 ID=cds-WP_000705001.1;Parent=gene-C7A06_RS00055;Dbxref=Genbank:WP_000705001.1;Name=WP_000705001.1;Ontology_term=GO:0009063,GO:0008869;gbkey=CDS;gene=dgoD;gene_id=nbis-gene-11;go_function=galactonate dehydratase activity|0008869||IEA;go_process=cellular amino acid catabolic process|0009063||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1;locus_tag=C7A06_RS00055;product=galactonate dehydratase;protein_id=WP_000705001.1;transcript_id=gene-C7A06_RS00055;transl_table=11
+NZ_CP027599.1 RefSeq gene 11598 12935 . + . ID=nbis-gene-12;Name=dgoT;gbkey=Gene;gene=dgoT;gene_biotype=protein_coding;gene_id=nbis-gene-12;locus_tag=C7A06_RS00060
+NZ_CP027599.1 RefSeq transcript 11598 12935 . + . ID=gene-C7A06_RS00060;Parent=nbis-gene-12;Name=dgoT;gbkey=Gene;gene=dgoT;gene_biotype=protein_coding;gene_id=nbis-gene-12;locus_tag=C7A06_RS00060;original_biotype=mrna;transcript_id=gene-C7A06_RS00060
+NZ_CP027599.1 Protein Homology exon 11598 12935 . + . ID=nbis-exon-12;Parent=gene-C7A06_RS00060;Dbxref=Genbank:WP_000253455.1;Name=WP_000253455.1;gbkey=CDS;gene=dgoT;gene_id=nbis-gene-12;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709507.1;locus_tag=C7A06_RS00060;product=MFS transporter;protein_id=WP_000253455.1;transcript_id=gene-C7A06_RS00060;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 11598 12935 . + 0 ID=cds-WP_000253455.1;Parent=gene-C7A06_RS00060;Dbxref=Genbank:WP_000253455.1;Name=WP_000253455.1;gbkey=CDS;gene=dgoT;gene_id=nbis-gene-12;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709507.1;locus_tag=C7A06_RS00060;product=MFS transporter;protein_id=WP_000253455.1;transcript_id=gene-C7A06_RS00060;transl_table=11
diff -r 000000000000 -r cffa21bb7a92 test-data/test05.gtf
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test05.gtf Tue May 23 13:42:43 2023 +0000
@@ -0,0 +1,32 @@
+##gtf-version 2
+##gtf-version 3
+#!gff-spec-version 1.21
+#!processor NCBI annotwriter
+#!genome-build ASM301845v1
+#!genome-build-accession NCBI_Assembly:GCF_003018455.1
+#!annotation-date 05/25/2022 04:54:31
+#!annotation-source NCBI RefSeq
+##sequence-region NZ_CP027599.1 1 5942969
+##species https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=562
+NZ_CP027599.1 Protein Homology exon 1052 2152 . + . gene_id "nbis-gene-2"; transcript_id "gene-C7A06_RS00010"; Dbxref "Genbank:WP_000673464.1"; ID "nbis-exon-2"; Name "WP_000673464.1"; Ontology_term "GO:0006260" "GO:0003887" "GO:0009360"; Parent "gene-C7A06_RS00010"; gbkey "CDS"; gene "dnaN"; go_component "DNA polymerase III complex|0009360||IEA"; go_function "DNA-directed DNA polymerase activity|0003887||IEA"; go_process "DNA replication|0006260||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1"; locus_tag "C7A06_RS00010"; product "DNA polymerase III subunit beta"; protein_id "WP_000673464.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 1052 2152 . + 0 gene_id "nbis-gene-2"; transcript_id "gene-C7A06_RS00010"; Dbxref "Genbank:WP_000673464.1"; ID "cds-WP_000673464.1"; Name "WP_000673464.1"; Ontology_term "GO:0006260" "GO:0003887" "GO:0009360"; Parent "gene-C7A06_RS00010"; gbkey "CDS"; gene "dnaN"; go_component "DNA polymerase III complex|0009360||IEA"; go_function "DNA-directed DNA polymerase activity|0003887||IEA"; go_process "DNA replication|0006260||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1"; locus_tag "C7A06_RS00010"; product "DNA polymerase III subunit beta"; protein_id "WP_000673464.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology exon 2152 3225 . + . gene_id "nbis-gene-3"; transcript_id "gene-C7A06_RS00015"; Dbxref "Genbank:WP_000060112.1"; ID "nbis-exon-3"; Name "WP_000060112.1"; Ontology_term "GO:0006281" "GO:0003697" "GO:0005524"; Parent "gene-C7A06_RS00015"; gbkey "CDS"; gene "recF"; go_function "single-stranded DNA binding|0003697||IEA" "ATP binding|0005524||IEA"; go_process "DNA repair|0006281||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1"; locus_tag "C7A06_RS00015"; product "DNA replication/repair protein RecF"; protein_id "WP_000060112.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 2152 3225 . + 0 gene_id "nbis-gene-3"; transcript_id "gene-C7A06_RS00015"; Dbxref "Genbank:WP_000060112.1"; ID "cds-WP_000060112.1"; Name "WP_000060112.1"; Ontology_term "GO:0006281" "GO:0003697" "GO:0005524"; Parent "gene-C7A06_RS00015"; gbkey "CDS"; gene "recF"; go_function "single-stranded DNA binding|0003697||IEA" "ATP binding|0005524||IEA"; go_process "DNA repair|0006281||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1"; locus_tag "C7A06_RS00015"; product "DNA replication/repair protein RecF"; protein_id "WP_000060112.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology exon 3254 5668 . + . gene_id "nbis-gene-4"; transcript_id "gene-C7A06_RS00020"; Dbxref "Genbank:WP_000072067.1"; ID "nbis-exon-4"; Name "WP_000072067.1"; Ontology_term "GO:0006265" "GO:0003918" "GO:0009330"; Parent "gene-C7A06_RS00020"; gbkey "CDS"; gene "gyrB"; go_component "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) complex|0009330||IEA"; go_function "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) activity|0003918||IEA"; go_process "DNA topological change|0006265||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1"; locus_tag "C7A06_RS00020"; product "DNA topoisomerase (ATP-hydrolyzing) subunit B"; protein_id "WP_000072067.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 3254 5668 . + 0 gene_id "nbis-gene-4"; transcript_id "gene-C7A06_RS00020"; Dbxref "Genbank:WP_000072067.1"; ID "cds-WP_000072067.1"; Name "WP_000072067.1"; Ontology_term "GO:0006265" "GO:0003918" "GO:0009330"; Parent "gene-C7A06_RS00020"; gbkey "CDS"; gene "gyrB"; go_component "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) complex|0009330||IEA"; go_function "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) activity|0003918||IEA"; go_process "DNA topological change|0006265||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1"; locus_tag "C7A06_RS00020"; product "DNA topoisomerase (ATP-hydrolyzing) subunit B"; protein_id "WP_000072067.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology exon 5908 6306 . + . gene_id "nbis-gene-5"; transcript_id "gene-C7A06_RS00025"; Dbxref "Genbank:WP_000522208.1"; ID "nbis-exon-5"; Name "WP_000522208.1"; Parent "gene-C7A06_RS00025"; gbkey "CDS"; gene "yidB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418153.4"; locus_tag "C7A06_RS00025"; product "YidB family protein"; protein_id "WP_000522208.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 5908 6306 . + 0 gene_id "nbis-gene-5"; transcript_id "gene-C7A06_RS00025"; Dbxref "Genbank:WP_000522208.1"; ID "cds-WP_000522208.1"; Name "WP_000522208.1"; Parent "gene-C7A06_RS00025"; gbkey "CDS"; gene "yidB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418153.4"; locus_tag "C7A06_RS00025"; product "YidB family protein"; protein_id "WP_000522208.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology exon 6421 7233 . + . gene_id "nbis-gene-6"; transcript_id "gene-C7A06_RS00030"; Dbxref "Genbank:WP_000985541.1"; ID "nbis-exon-6"; Name "WP_000985541.1"; Ontology_term "GO:0016787"; Parent "gene-C7A06_RS00030"; gbkey "CDS"; gene "yidA"; go_function "hydrolase activity|0016787||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418152.1"; locus_tag "C7A06_RS00030"; product "sugar-phosphatase"; protein_id "WP_000985541.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 6421 7233 . + 0 gene_id "nbis-gene-6"; transcript_id "gene-C7A06_RS00030"; Dbxref "Genbank:WP_000985541.1"; ID "cds-WP_000985541.1"; Name "WP_000985541.1"; Ontology_term "GO:0016787"; Parent "gene-C7A06_RS00030"; gbkey "CDS"; gene "yidA"; go_function "hydrolase activity|0016787||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418152.1"; locus_tag "C7A06_RS00030"; product "sugar-phosphatase"; protein_id "WP_000985541.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology exon 7279 7935 . - . gene_id "nbis-gene-7"; transcript_id "gene-C7A06_RS00035"; Dbxref "Genbank:WP_000772931.1"; ID "nbis-exon-7"; Name "WP_000772931.1"; Parent "gene-C7A06_RS00035"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709504.1"; locus_tag "C7A06_RS00035"; product "hypothetical protein"; protein_id "WP_000772931.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 7279 7935 . - 0 gene_id "nbis-gene-7"; transcript_id "gene-C7A06_RS00035"; Dbxref "Genbank:WP_000772931.1"; ID "cds-WP_000772931.1"; Name "WP_000772931.1"; Parent "gene-C7A06_RS00035"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709504.1"; locus_tag "C7A06_RS00035"; product "hypothetical protein"; protein_id "WP_000772931.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology exon 8213 8902 . + . gene_id "nbis-gene-8"; transcript_id "gene-C7A06_RS00040"; Dbxref "Genbank:WP_000174305.1"; ID "nbis-exon-8"; Name "WP_000174305.1"; Parent "gene-C7A06_RS00040"; gbkey "CDS"; gene "dgoR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709505.1"; locus_tag "C7A06_RS00040"; product "D-galactonate utilization transcriptional regulator DgoR"; protein_id "WP_000174305.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 8213 8902 . + 0 gene_id "nbis-gene-8"; transcript_id "gene-C7A06_RS00040"; Dbxref "Genbank:WP_000174305.1"; ID "cds-WP_000174305.1"; Name "WP_000174305.1"; Parent "gene-C7A06_RS00040"; gbkey "CDS"; gene "dgoR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709505.1"; locus_tag "C7A06_RS00040"; product "D-galactonate utilization transcriptional regulator DgoR"; protein_id "WP_000174305.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology exon 8899 9777 . + . gene_id "nbis-gene-9"; transcript_id "gene-C7A06_RS00045"; Dbxref "Genbank:WP_000127112.1"; ID "nbis-exon-9"; Name "WP_000127112.1"; Parent "gene-C7A06_RS00045"; gbkey "CDS"; gene "dgoK"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709506.1"; locus_tag "C7A06_RS00045"; product "2-dehydro-3-deoxygalactonokinase"; protein_id "WP_000127112.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 8899 9777 . + 0 gene_id "nbis-gene-9"; transcript_id "gene-C7A06_RS00045"; Dbxref "Genbank:WP_000127112.1"; ID "cds-WP_000127112.1"; Name "WP_000127112.1"; Parent "gene-C7A06_RS00045"; gbkey "CDS"; gene "dgoK"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709506.1"; locus_tag "C7A06_RS00045"; product "2-dehydro-3-deoxygalactonokinase"; protein_id "WP_000127112.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology exon 9761 10378 . + . gene_id "nbis-gene-10"; transcript_id "gene-C7A06_RS00050"; Dbxref "Genbank:WP_001198699.1"; ID "nbis-exon-10"; Name "WP_001198699.1"; Parent "gene-C7A06_RS00050"; gbkey "CDS"; gene "dgoA"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026238.1"; locus_tag "C7A06_RS00050"; product "2-dehydro-3-deoxy-6-phosphogalactonate aldolase"; protein_id "WP_001198699.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 9761 10378 . + 0 gene_id "nbis-gene-10"; transcript_id "gene-C7A06_RS00050"; Dbxref "Genbank:WP_001198699.1"; ID "cds-WP_001198699.1"; Name "WP_001198699.1"; Parent "gene-C7A06_RS00050"; gbkey "CDS"; gene "dgoA"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026238.1"; locus_tag "C7A06_RS00050"; product "2-dehydro-3-deoxy-6-phosphogalactonate aldolase"; protein_id "WP_001198699.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology exon 10375 11523 . + . gene_id "nbis-gene-11"; transcript_id "gene-C7A06_RS00055"; Dbxref "Genbank:WP_000705001.1"; ID "nbis-exon-11"; Name "WP_000705001.1"; Ontology_term "GO:0009063" "GO:0008869"; Parent "gene-C7A06_RS00055"; gbkey "CDS"; gene "dgoD"; go_function "galactonate dehydratase activity|0008869||IEA"; go_process "cellular amino acid catabolic process|0009063||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1"; locus_tag "C7A06_RS00055"; product "galactonate dehydratase"; protein_id "WP_000705001.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 10375 11523 . + 0 gene_id "nbis-gene-11"; transcript_id "gene-C7A06_RS00055"; Dbxref "Genbank:WP_000705001.1"; ID "cds-WP_000705001.1"; Name "WP_000705001.1"; Ontology_term "GO:0009063" "GO:0008869"; Parent "gene-C7A06_RS00055"; gbkey "CDS"; gene "dgoD"; go_function "galactonate dehydratase activity|0008869||IEA"; go_process "cellular amino acid catabolic process|0009063||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1"; locus_tag "C7A06_RS00055"; product "galactonate dehydratase"; protein_id "WP_000705001.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology exon 11598 12935 . + . gene_id "nbis-gene-12"; transcript_id "gene-C7A06_RS00060"; Dbxref "Genbank:WP_000253455.1"; ID "nbis-exon-12"; Name "WP_000253455.1"; Parent "gene-C7A06_RS00060"; gbkey "CDS"; gene "dgoT"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709507.1"; locus_tag "C7A06_RS00060"; product "MFS transporter"; protein_id "WP_000253455.1"; transl_table "11";
+NZ_CP027599.1 Protein Homology CDS 11598 12935 . + 0 gene_id "nbis-gene-12"; transcript_id "gene-C7A06_RS00060"; Dbxref "Genbank:WP_000253455.1"; ID "cds-WP_000253455.1"; Name "WP_000253455.1"; Parent "gene-C7A06_RS00060"; gbkey "CDS"; gene "dgoT"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709507.1"; locus_tag "C7A06_RS00060"; product "MFS transporter"; protein_id "WP_000253455.1"; transl_table "11";
diff -r 000000000000 -r cffa21bb7a92 test-data/test06.gff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test06.gff Tue May 23 13:42:43 2023 +0000
@@ -0,0 +1,50 @@
+##gff-version 3
+##gtf-version 3
+#!gff-spec-version 1.21
+#!processor NCBI annotwriter
+#!genome-build ASM301845v1
+#!genome-build-accession NCBI_Assembly:GCF_003018455.1
+#!annotation-date 05/25/2022 04:54:31
+#!annotation-source NCBI RefSeq
+##sequence-region NZ_CP027599.1 1 5942969
+##species https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=562
+NZ_CP027599.1 RefSeq gene 1052 2152 . + . ID=nbis-gene-2;Name=dnaN;gbkey=Gene;gene=dnaN;gene_biotype=protein_coding;gene_id=nbis-gene-2;locus_tag=C7A06_RS00010
+NZ_CP027599.1 RefSeq transcript 1052 2152 . + . ID=gene-C7A06_RS00010;Parent=nbis-gene-2;Name=dnaN;gbkey=Gene;gene=dnaN;gene_biotype=protein_coding;gene_id=nbis-gene-2;locus_tag=C7A06_RS00010;original_biotype=mrna;transcript_id=gene-C7A06_RS00010
+NZ_CP027599.1 Protein Homology exon 1052 2152 . + . ID=nbis-exon-2;Parent=gene-C7A06_RS00010;Dbxref=Genbank:WP_000673464.1;Name=WP_000673464.1;Ontology_term=GO:0006260,GO:0003887,GO:0009360;gbkey=CDS;gene=dnaN;gene_id=nbis-gene-2;go_component=DNA polymerase III complex|0009360||IEA;go_function=DNA-directed DNA polymerase activity|0003887||IEA;go_process=DNA replication|0006260||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1;locus_tag=C7A06_RS00010;product=DNA polymerase III subunit beta;protein_id=WP_000673464.1;transcript_id=gene-C7A06_RS00010;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 1052 2152 . + 0 ID=cds-WP_000673464.1;Parent=gene-C7A06_RS00010;Dbxref=Genbank:WP_000673464.1;Name=WP_000673464.1;Ontology_term=GO:0006260,GO:0003887,GO:0009360;gbkey=CDS;gene=dnaN;gene_id=nbis-gene-2;go_component=DNA polymerase III complex|0009360||IEA;go_function=DNA-directed DNA polymerase activity|0003887||IEA;go_process=DNA replication|0006260||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1;locus_tag=C7A06_RS00010;product=DNA polymerase III subunit beta;protein_id=WP_000673464.1;transcript_id=gene-C7A06_RS00010;transl_table=11
+NZ_CP027599.1 RefSeq gene 2152 3225 . + . ID=nbis-gene-3;Name=recF;gbkey=Gene;gene=recF;gene_biotype=protein_coding;gene_id=nbis-gene-3;locus_tag=C7A06_RS00015
+NZ_CP027599.1 RefSeq transcript 2152 3225 . + . ID=gene-C7A06_RS00015;Parent=nbis-gene-3;Name=recF;gbkey=Gene;gene=recF;gene_biotype=protein_coding;gene_id=nbis-gene-3;locus_tag=C7A06_RS00015;original_biotype=mrna;transcript_id=gene-C7A06_RS00015
+NZ_CP027599.1 Protein Homology exon 2152 3225 . + . ID=nbis-exon-3;Parent=gene-C7A06_RS00015;Dbxref=Genbank:WP_000060112.1;Name=WP_000060112.1;Ontology_term=GO:0006281,GO:0003697,GO:0005524;gbkey=CDS;gene=recF;gene_id=nbis-gene-3;go_function=single-stranded DNA binding|0003697||IEA,ATP binding|0005524||IEA;go_process=DNA repair|0006281||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1;locus_tag=C7A06_RS00015;product=DNA replication/repair protein RecF;protein_id=WP_000060112.1;transcript_id=gene-C7A06_RS00015;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 2152 3225 . + 0 ID=cds-WP_000060112.1;Parent=gene-C7A06_RS00015;Dbxref=Genbank:WP_000060112.1;Name=WP_000060112.1;Ontology_term=GO:0006281,GO:0003697,GO:0005524;gbkey=CDS;gene=recF;gene_id=nbis-gene-3;go_function=single-stranded DNA binding|0003697||IEA,ATP binding|0005524||IEA;go_process=DNA repair|0006281||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1;locus_tag=C7A06_RS00015;product=DNA replication/repair protein RecF;protein_id=WP_000060112.1;transcript_id=gene-C7A06_RS00015;transl_table=11
+NZ_CP027599.1 RefSeq gene 3254 5668 . + . ID=nbis-gene-4;Name=gyrB;gbkey=Gene;gene=gyrB;gene_biotype=protein_coding;gene_id=nbis-gene-4;locus_tag=C7A06_RS00020
+NZ_CP027599.1 RefSeq transcript 3254 5668 . + . ID=gene-C7A06_RS00020;Parent=nbis-gene-4;Name=gyrB;gbkey=Gene;gene=gyrB;gene_biotype=protein_coding;gene_id=nbis-gene-4;locus_tag=C7A06_RS00020;original_biotype=mrna;transcript_id=gene-C7A06_RS00020
+NZ_CP027599.1 Protein Homology exon 3254 5668 . + . ID=nbis-exon-4;Parent=gene-C7A06_RS00020;Dbxref=Genbank:WP_000072067.1;Name=WP_000072067.1;Ontology_term=GO:0006265,GO:0003918,GO:0009330;gbkey=CDS;gene=gyrB;gene_id=nbis-gene-4;go_component=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) complex|0009330||IEA;go_function=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) activity|0003918||IEA;go_process=DNA topological change|0006265||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1;locus_tag=C7A06_RS00020;product=DNA topoisomerase (ATP-hydrolyzing) subunit B;protein_id=WP_000072067.1;transcript_id=gene-C7A06_RS00020;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 3254 5668 . + 0 ID=cds-WP_000072067.1;Parent=gene-C7A06_RS00020;Dbxref=Genbank:WP_000072067.1;Name=WP_000072067.1;Ontology_term=GO:0006265,GO:0003918,GO:0009330;gbkey=CDS;gene=gyrB;gene_id=nbis-gene-4;go_component=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) complex|0009330||IEA;go_function=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) activity|0003918||IEA;go_process=DNA topological change|0006265||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1;locus_tag=C7A06_RS00020;product=DNA topoisomerase (ATP-hydrolyzing) subunit B;protein_id=WP_000072067.1;transcript_id=gene-C7A06_RS00020;transl_table=11
+NZ_CP027599.1 RefSeq gene 5908 6306 . + . ID=nbis-gene-5;Name=yidB;gbkey=Gene;gene=yidB;gene_biotype=protein_coding;gene_id=nbis-gene-5;locus_tag=C7A06_RS00025
+NZ_CP027599.1 RefSeq transcript 5908 6306 . + . ID=gene-C7A06_RS00025;Parent=nbis-gene-5;Name=yidB;gbkey=Gene;gene=yidB;gene_biotype=protein_coding;gene_id=nbis-gene-5;locus_tag=C7A06_RS00025;original_biotype=mrna;transcript_id=gene-C7A06_RS00025
+NZ_CP027599.1 Protein Homology exon 5908 6306 . + . ID=nbis-exon-5;Parent=gene-C7A06_RS00025;Dbxref=Genbank:WP_000522208.1;Name=WP_000522208.1;gbkey=CDS;gene=yidB;gene_id=nbis-gene-5;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418153.4;locus_tag=C7A06_RS00025;product=YidB family protein;protein_id=WP_000522208.1;transcript_id=gene-C7A06_RS00025;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 5908 6306 . + 0 ID=cds-WP_000522208.1;Parent=gene-C7A06_RS00025;Dbxref=Genbank:WP_000522208.1;Name=WP_000522208.1;gbkey=CDS;gene=yidB;gene_id=nbis-gene-5;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418153.4;locus_tag=C7A06_RS00025;product=YidB family protein;protein_id=WP_000522208.1;transcript_id=gene-C7A06_RS00025;transl_table=11
+NZ_CP027599.1 RefSeq gene 6421 7233 . + . ID=nbis-gene-6;Name=yidA;gbkey=Gene;gene=yidA;gene_biotype=protein_coding;gene_id=nbis-gene-6;locus_tag=C7A06_RS00030
+NZ_CP027599.1 RefSeq transcript 6421 7233 . + . ID=gene-C7A06_RS00030;Parent=nbis-gene-6;Name=yidA;gbkey=Gene;gene=yidA;gene_biotype=protein_coding;gene_id=nbis-gene-6;locus_tag=C7A06_RS00030;original_biotype=mrna;transcript_id=gene-C7A06_RS00030
+NZ_CP027599.1 Protein Homology exon 6421 7233 . + . ID=nbis-exon-6;Parent=gene-C7A06_RS00030;Dbxref=Genbank:WP_000985541.1;Name=WP_000985541.1;Ontology_term=GO:0016787;gbkey=CDS;gene=yidA;gene_id=nbis-gene-6;go_function=hydrolase activity|0016787||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418152.1;locus_tag=C7A06_RS00030;product=sugar-phosphatase;protein_id=WP_000985541.1;transcript_id=gene-C7A06_RS00030;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 6421 7233 . + 0 ID=cds-WP_000985541.1;Parent=gene-C7A06_RS00030;Dbxref=Genbank:WP_000985541.1;Name=WP_000985541.1;Ontology_term=GO:0016787;gbkey=CDS;gene=yidA;gene_id=nbis-gene-6;go_function=hydrolase activity|0016787||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418152.1;locus_tag=C7A06_RS00030;product=sugar-phosphatase;protein_id=WP_000985541.1;transcript_id=gene-C7A06_RS00030;transl_table=11
+NZ_CP027599.1 RefSeq gene 7279 7935 . - . ID=nbis-gene-7;Name=C7A06_RS00035;gbkey=Gene;gene_biotype=protein_coding;gene_id=nbis-gene-7;locus_tag=C7A06_RS00035
+NZ_CP027599.1 RefSeq transcript 7279 7935 . - . ID=gene-C7A06_RS00035;Parent=nbis-gene-7;Name=C7A06_RS00035;gbkey=Gene;gene_biotype=protein_coding;gene_id=nbis-gene-7;locus_tag=C7A06_RS00035;original_biotype=mrna;transcript_id=gene-C7A06_RS00035
+NZ_CP027599.1 Protein Homology exon 7279 7935 . - . ID=nbis-exon-7;Parent=gene-C7A06_RS00035;Dbxref=Genbank:WP_000772931.1;Name=WP_000772931.1;gbkey=CDS;gene_id=nbis-gene-7;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709504.1;locus_tag=C7A06_RS00035;product=hypothetical protein;protein_id=WP_000772931.1;transcript_id=gene-C7A06_RS00035;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 7279 7935 . - 0 ID=cds-WP_000772931.1;Parent=gene-C7A06_RS00035;Dbxref=Genbank:WP_000772931.1;Name=WP_000772931.1;gbkey=CDS;gene_id=nbis-gene-7;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709504.1;locus_tag=C7A06_RS00035;product=hypothetical protein;protein_id=WP_000772931.1;transcript_id=gene-C7A06_RS00035;transl_table=11
+NZ_CP027599.1 RefSeq gene 8213 8902 . + . ID=nbis-gene-8;Name=dgoR;gbkey=Gene;gene=dgoR;gene_biotype=protein_coding;gene_id=nbis-gene-8;locus_tag=C7A06_RS00040
+NZ_CP027599.1 RefSeq transcript 8213 8902 . + . ID=gene-C7A06_RS00040;Parent=nbis-gene-8;Name=dgoR;gbkey=Gene;gene=dgoR;gene_biotype=protein_coding;gene_id=nbis-gene-8;locus_tag=C7A06_RS00040;original_biotype=mrna;transcript_id=gene-C7A06_RS00040
+NZ_CP027599.1 Protein Homology exon 8213 8902 . + . ID=nbis-exon-8;Parent=gene-C7A06_RS00040;Dbxref=Genbank:WP_000174305.1;Name=WP_000174305.1;gbkey=CDS;gene=dgoR;gene_id=nbis-gene-8;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709505.1;locus_tag=C7A06_RS00040;product=D-galactonate utilization transcriptional regulator DgoR;protein_id=WP_000174305.1;transcript_id=gene-C7A06_RS00040;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 8213 8902 . + 0 ID=cds-WP_000174305.1;Parent=gene-C7A06_RS00040;Dbxref=Genbank:WP_000174305.1;Name=WP_000174305.1;gbkey=CDS;gene=dgoR;gene_id=nbis-gene-8;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709505.1;locus_tag=C7A06_RS00040;product=D-galactonate utilization transcriptional regulator DgoR;protein_id=WP_000174305.1;transcript_id=gene-C7A06_RS00040;transl_table=11
+NZ_CP027599.1 RefSeq gene 8899 9777 . + . ID=nbis-gene-9;Name=dgoK;gbkey=Gene;gene=dgoK;gene_biotype=protein_coding;gene_id=nbis-gene-9;locus_tag=C7A06_RS00045
+NZ_CP027599.1 RefSeq transcript 8899 9777 . + . ID=gene-C7A06_RS00045;Parent=nbis-gene-9;Name=dgoK;gbkey=Gene;gene=dgoK;gene_biotype=protein_coding;gene_id=nbis-gene-9;locus_tag=C7A06_RS00045;original_biotype=mrna;transcript_id=gene-C7A06_RS00045
+NZ_CP027599.1 Protein Homology exon 8899 9777 . + . ID=nbis-exon-9;Parent=gene-C7A06_RS00045;Dbxref=Genbank:WP_000127112.1;Name=WP_000127112.1;gbkey=CDS;gene=dgoK;gene_id=nbis-gene-9;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709506.1;locus_tag=C7A06_RS00045;product=2-dehydro-3-deoxygalactonokinase;protein_id=WP_000127112.1;transcript_id=gene-C7A06_RS00045;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 8899 9777 . + 0 ID=cds-WP_000127112.1;Parent=gene-C7A06_RS00045;Dbxref=Genbank:WP_000127112.1;Name=WP_000127112.1;gbkey=CDS;gene=dgoK;gene_id=nbis-gene-9;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709506.1;locus_tag=C7A06_RS00045;product=2-dehydro-3-deoxygalactonokinase;protein_id=WP_000127112.1;transcript_id=gene-C7A06_RS00045;transl_table=11
+NZ_CP027599.1 RefSeq gene 9761 10378 . + . ID=nbis-gene-10;Name=dgoA;gbkey=Gene;gene=dgoA;gene_biotype=protein_coding;gene_id=nbis-gene-10;locus_tag=C7A06_RS00050
+NZ_CP027599.1 RefSeq transcript 9761 10378 . + . ID=gene-C7A06_RS00050;Parent=nbis-gene-10;Name=dgoA;gbkey=Gene;gene=dgoA;gene_biotype=protein_coding;gene_id=nbis-gene-10;locus_tag=C7A06_RS00050;original_biotype=mrna;transcript_id=gene-C7A06_RS00050
+NZ_CP027599.1 Protein Homology exon 9761 10378 . + . ID=nbis-exon-10;Parent=gene-C7A06_RS00050;Dbxref=Genbank:WP_001198699.1;Name=WP_001198699.1;gbkey=CDS;gene=dgoA;gene_id=nbis-gene-10;inference=COORDINATES: similar to AA sequence:RefSeq:YP_026238.1;locus_tag=C7A06_RS00050;product=2-dehydro-3-deoxy-6-phosphogalactonate aldolase;protein_id=WP_001198699.1;transcript_id=gene-C7A06_RS00050;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 9761 10378 . + 0 ID=cds-WP_001198699.1;Parent=gene-C7A06_RS00050;Dbxref=Genbank:WP_001198699.1;Name=WP_001198699.1;gbkey=CDS;gene=dgoA;gene_id=nbis-gene-10;inference=COORDINATES: similar to AA sequence:RefSeq:YP_026238.1;locus_tag=C7A06_RS00050;product=2-dehydro-3-deoxy-6-phosphogalactonate aldolase;protein_id=WP_001198699.1;transcript_id=gene-C7A06_RS00050;transl_table=11
+NZ_CP027599.1 RefSeq gene 10375 11523 . + . ID=nbis-gene-11;Name=dgoD;gbkey=Gene;gene=dgoD;gene_biotype=protein_coding;gene_id=nbis-gene-11;locus_tag=C7A06_RS00055
+NZ_CP027599.1 RefSeq transcript 10375 11523 . + . ID=gene-C7A06_RS00055;Parent=nbis-gene-11;Name=dgoD;gbkey=Gene;gene=dgoD;gene_biotype=protein_coding;gene_id=nbis-gene-11;locus_tag=C7A06_RS00055;original_biotype=mrna;transcript_id=gene-C7A06_RS00055
+NZ_CP027599.1 Protein Homology exon 10375 11523 . + . ID=nbis-exon-11;Parent=gene-C7A06_RS00055;Dbxref=Genbank:WP_000705001.1;Name=WP_000705001.1;Ontology_term=GO:0009063,GO:0008869;gbkey=CDS;gene=dgoD;gene_id=nbis-gene-11;go_function=galactonate dehydratase activity|0008869||IEA;go_process=cellular amino acid catabolic process|0009063||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1;locus_tag=C7A06_RS00055;product=galactonate dehydratase;protein_id=WP_000705001.1;transcript_id=gene-C7A06_RS00055;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 10375 11523 . + 0 ID=cds-WP_000705001.1;Parent=gene-C7A06_RS00055;Dbxref=Genbank:WP_000705001.1;Name=WP_000705001.1;Ontology_term=GO:0009063,GO:0008869;gbkey=CDS;gene=dgoD;gene_id=nbis-gene-11;go_function=galactonate dehydratase activity|0008869||IEA;go_process=cellular amino acid catabolic process|0009063||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1;locus_tag=C7A06_RS00055;product=galactonate dehydratase;protein_id=WP_000705001.1;transcript_id=gene-C7A06_RS00055;transl_table=11
diff -r 000000000000 -r cffa21bb7a92 test-data/test07.tabular
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test07.tabular Tue May 23 13:42:43 2023 +0000
@@ -0,0 +1,41 @@
+##gff-version 3
+NZ_CP027599.1 RefSeq gene 1052 2152 . + .
+NZ_CP027599.1 RefSeq transcript 1052 2152 . + .
+NZ_CP027599.1 Protein Homology exon 1052 2152 . + .
+NZ_CP027599.1 Protein Homology CDS 1052 2152 . + 0
+NZ_CP027599.1 RefSeq gene 2152 3225 . + .
+NZ_CP027599.1 RefSeq transcript 2152 3225 . + .
+NZ_CP027599.1 Protein Homology exon 2152 3225 . + .
+NZ_CP027599.1 Protein Homology CDS 2152 3225 . + 0
+NZ_CP027599.1 RefSeq gene 3254 5668 . + .
+NZ_CP027599.1 RefSeq transcript 3254 5668 . + .
+NZ_CP027599.1 Protein Homology exon 3254 5668 . + .
+NZ_CP027599.1 Protein Homology CDS 3254 5668 . + 0
+NZ_CP027599.1 RefSeq gene 5908 6306 . + .
+NZ_CP027599.1 RefSeq transcript 5908 6306 . + .
+NZ_CP027599.1 Protein Homology exon 5908 6306 . + .
+NZ_CP027599.1 Protein Homology CDS 5908 6306 . + 0
+NZ_CP027599.1 RefSeq gene 6421 7233 . + .
+NZ_CP027599.1 RefSeq transcript 6421 7233 . + .
+NZ_CP027599.1 Protein Homology exon 6421 7233 . + .
+NZ_CP027599.1 Protein Homology CDS 6421 7233 . + 0
+NZ_CP027599.1 RefSeq gene 7279 7935 . - .
+NZ_CP027599.1 RefSeq transcript 7279 7935 . - .
+NZ_CP027599.1 Protein Homology exon 7279 7935 . - .
+NZ_CP027599.1 Protein Homology CDS 7279 7935 . - 0
+NZ_CP027599.1 RefSeq gene 8213 8902 . + .
+NZ_CP027599.1 RefSeq transcript 8213 8902 . + .
+NZ_CP027599.1 Protein Homology exon 8213 8902 . + .
+NZ_CP027599.1 Protein Homology CDS 8213 8902 . + 0
+NZ_CP027599.1 RefSeq gene 8899 9777 . + .
+NZ_CP027599.1 RefSeq transcript 8899 9777 . + .
+NZ_CP027599.1 Protein Homology exon 8899 9777 . + .
+NZ_CP027599.1 Protein Homology CDS 8899 9777 . + 0
+NZ_CP027599.1 RefSeq gene 9761 10378 . + .
+NZ_CP027599.1 RefSeq transcript 9761 10378 . + .
+NZ_CP027599.1 Protein Homology exon 9761 10378 . + .
+NZ_CP027599.1 Protein Homology CDS 9761 10378 . + 0
+NZ_CP027599.1 RefSeq gene 10375 11523 . + .
+NZ_CP027599.1 RefSeq transcript 10375 11523 . + .
+NZ_CP027599.1 Protein Homology exon 10375 11523 . + .
+NZ_CP027599.1 Protein Homology CDS 10375 11523 . + 0
diff -r 000000000000 -r cffa21bb7a92 test-data/test09.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test09.txt Tue May 23 13:42:43 2023 +0000
@@ -0,0 +1,80 @@
+--------------------------------------------------------------------------------
+
+Compute transcript with isoforms if any
+
+Number of gene 10
+Number of transcript 10
+Number of cds 10
+Number of exon 10
+Number of exon in cds 10
+Number gene overlapping 4
+Number of single exon gene 10
+Number of single exon transcript 10
+mean transcripts per gene 1.0
+mean cdss per transcript 1.0
+mean exons per transcript 1.0
+mean exons per cds 1.0
+Total gene length 9795
+Total transcript length 9795
+Total cds length 9795
+Total exon length 9795
+mean gene length 979
+mean transcript length 979
+mean cds length 979
+mean exon length 979
+mean cds piece length 979
+% of genome covered by gene 0.9
+% of genome covered by transcript 0.9
+% of genome covered by cds 0.9
+% of genome covered by exon 0.9
+Longest gene 2415
+Longest transcript 2415
+Longest cds 2415
+Longest exon 2415
+Longest cds piece 2415
+Shortest gene 399
+Shortest transcript 399
+Shortest cds 399
+Shortest exon 399
+Shortest cds piece 399
+
+Re-compute transcript without isoforms asked. We remove shortest isoforms if any
+
+Number of gene 10
+Number of transcript 10
+Number of cds 10
+Number of exon 10
+Number of exon in cds 10
+Number gene overlapping 4
+Number of single exon gene 10
+Number of single exon transcript 10
+mean transcripts per gene 1.0
+mean cdss per transcript 1.0
+mean exons per transcript 1.0
+mean exons per cds 1.0
+Total gene length 9795
+Total transcript length 9795
+Total cds length 9795
+Total exon length 9795
+mean gene length 979
+mean transcript length 979
+mean cds length 979
+mean exon length 979
+mean cds piece length 979
+% of genome covered by gene 0.9
+% of genome covered by transcript 0.9
+% of genome covered by cds 0.9
+% of genome covered by exon 0.9
+Longest gene 2415
+Longest transcript 2415
+Longest cds 2415
+Longest exon 2415
+Longest cds piece 2415
+Shortest gene 399
+Shortest transcript 399
+Shortest cds 399
+Shortest exon 399
+Shortest cds piece 399
+
+--------------------------------------------------------------------------------
+
diff -r 000000000000 -r cffa21bb7a92 test-data/test10.gff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test10.gff Tue May 23 13:42:43 2023 +0000
@@ -0,0 +1,51 @@
+##gff-version 3
+##gtf-version 3
+#!gff-spec-version 1.21
+#!processor NCBI annotwriter
+#!genome-build ASM301845v1
+#!genome-build-accession NCBI_Assembly:GCF_003018455.1
+#!annotation-date 05/25/2022 04:54:31
+#!annotation-source NCBI RefSeq
+##sequence-region NZ_CP027599.1 1 5942969
+##species https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=562
+NZ_CP027599.1 RefSeq gene 1052 3225 . + . ID=nbis-gene-2;Name=dnaN,recF;gbkey=Gene;gene=dnaN,recF;gene_biotype=protein_coding;gene_id=nbis-gene-2,nbis-gene-3;locus_tag=C7A06_RS00010,C7A06_RS00015
+NZ_CP027599.1 RefSeq transcript 1052 2152 . + . ID=gene-C7A06_RS00010;Parent=nbis-gene-2;Name=dnaN;gbkey=Gene;gene=dnaN;gene_biotype=protein_coding;gene_id=nbis-gene-2;locus_tag=C7A06_RS00010;original_biotype=mrna;transcript_id=gene-C7A06_RS00010
+NZ_CP027599.1 Protein Homology exon 1052 2152 . + . ID=nbis-exon-2;Parent=gene-C7A06_RS00010;Dbxref=Genbank:WP_000673464.1;Name=WP_000673464.1;Ontology_term=GO:0006260,GO:0003887,GO:0009360;gbkey=CDS;gene=dnaN;gene_id=nbis-gene-2;go_component=DNA polymerase III complex|0009360||IEA;go_function=DNA-directed DNA polymerase activity|0003887||IEA;go_process=DNA replication|0006260||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1;locus_tag=C7A06_RS00010;product=DNA polymerase III subunit beta;protein_id=WP_000673464.1;transcript_id=gene-C7A06_RS00010;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 1052 2152 . + 0 ID=cds-WP_000673464.1;Parent=gene-C7A06_RS00010;Dbxref=Genbank:WP_000673464.1;Name=WP_000673464.1;Ontology_term=GO:0006260,GO:0003887,GO:0009360;gbkey=CDS;gene=dnaN;gene_id=nbis-gene-2;go_component=DNA polymerase III complex|0009360||IEA;go_function=DNA-directed DNA polymerase activity|0003887||IEA;go_process=DNA replication|0006260||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1;locus_tag=C7A06_RS00010;product=DNA polymerase III subunit beta;protein_id=WP_000673464.1;transcript_id=gene-C7A06_RS00010;transl_table=11
+NZ_CP027599.1 RefSeq transcript 2152 3225 . + . ID=gene-C7A06_RS00015;Parent=nbis-gene-2;Name=recF;gbkey=Gene;gene=recF;gene_biotype=protein_coding;gene_id=nbis-gene-3;locus_tag=C7A06_RS00015;original_biotype=mrna;transcript_id=gene-C7A06_RS00015
+NZ_CP027599.1 Protein Homology exon 2152 3225 . + . ID=nbis-exon-3;Parent=gene-C7A06_RS00015;Dbxref=Genbank:WP_000060112.1;Name=WP_000060112.1;Ontology_term=GO:0006281,GO:0003697,GO:0005524;gbkey=CDS;gene=recF;gene_id=nbis-gene-3;go_function=single-stranded DNA binding|0003697||IEA,ATP binding|0005524||IEA;go_process=DNA repair|0006281||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1;locus_tag=C7A06_RS00015;product=DNA replication/repair protein RecF;protein_id=WP_000060112.1;transcript_id=gene-C7A06_RS00015;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 2152 3225 . + 0 ID=cds-WP_000060112.1;Parent=gene-C7A06_RS00015;Dbxref=Genbank:WP_000060112.1;Name=WP_000060112.1;Ontology_term=GO:0006281,GO:0003697,GO:0005524;gbkey=CDS;gene=recF;gene_id=nbis-gene-3;go_function=single-stranded DNA binding|0003697||IEA,ATP binding|0005524||IEA;go_process=DNA repair|0006281||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1;locus_tag=C7A06_RS00015;product=DNA replication/repair protein RecF;protein_id=WP_000060112.1;transcript_id=gene-C7A06_RS00015;transl_table=11
+NZ_CP027599.1 RefSeq gene 3254 5668 . + . ID=nbis-gene-4;Name=gyrB;gbkey=Gene;gene=gyrB;gene_biotype=protein_coding;gene_id=nbis-gene-4;locus_tag=C7A06_RS00020
+NZ_CP027599.1 RefSeq transcript 3254 5668 . + . ID=gene-C7A06_RS00020;Parent=nbis-gene-4;Name=gyrB;gbkey=Gene;gene=gyrB;gene_biotype=protein_coding;gene_id=nbis-gene-4;locus_tag=C7A06_RS00020;original_biotype=mrna;transcript_id=gene-C7A06_RS00020
+NZ_CP027599.1 Protein Homology exon 3254 5668 . + . ID=nbis-exon-4;Parent=gene-C7A06_RS00020;Dbxref=Genbank:WP_000072067.1;Name=WP_000072067.1;Ontology_term=GO:0006265,GO:0003918,GO:0009330;gbkey=CDS;gene=gyrB;gene_id=nbis-gene-4;go_component=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) complex|0009330||IEA;go_function=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) activity|0003918||IEA;go_process=DNA topological change|0006265||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1;locus_tag=C7A06_RS00020;product=DNA topoisomerase (ATP-hydrolyzing) subunit B;protein_id=WP_000072067.1;transcript_id=gene-C7A06_RS00020;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 3254 5668 . + 0 ID=cds-WP_000072067.1;Parent=gene-C7A06_RS00020;Dbxref=Genbank:WP_000072067.1;Name=WP_000072067.1;Ontology_term=GO:0006265,GO:0003918,GO:0009330;gbkey=CDS;gene=gyrB;gene_id=nbis-gene-4;go_component=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) complex|0009330||IEA;go_function=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) activity|0003918||IEA;go_process=DNA topological change|0006265||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1;locus_tag=C7A06_RS00020;product=DNA topoisomerase (ATP-hydrolyzing) subunit B;protein_id=WP_000072067.1;transcript_id=gene-C7A06_RS00020;transl_table=11
+NZ_CP027599.1 RefSeq gene 5908 6306 . + . ID=nbis-gene-5;Name=yidB;gbkey=Gene;gene=yidB;gene_biotype=protein_coding;gene_id=nbis-gene-5;locus_tag=C7A06_RS00025
+NZ_CP027599.1 RefSeq transcript 5908 6306 . + . ID=gene-C7A06_RS00025;Parent=nbis-gene-5;Name=yidB;gbkey=Gene;gene=yidB;gene_biotype=protein_coding;gene_id=nbis-gene-5;locus_tag=C7A06_RS00025;original_biotype=mrna;transcript_id=gene-C7A06_RS00025
+NZ_CP027599.1 Protein Homology exon 5908 6306 . + . ID=nbis-exon-5;Parent=gene-C7A06_RS00025;Dbxref=Genbank:WP_000522208.1;Name=WP_000522208.1;gbkey=CDS;gene=yidB;gene_id=nbis-gene-5;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418153.4;locus_tag=C7A06_RS00025;product=YidB family protein;protein_id=WP_000522208.1;transcript_id=gene-C7A06_RS00025;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 5908 6306 . + 0 ID=cds-WP_000522208.1;Parent=gene-C7A06_RS00025;Dbxref=Genbank:WP_000522208.1;Name=WP_000522208.1;gbkey=CDS;gene=yidB;gene_id=nbis-gene-5;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418153.4;locus_tag=C7A06_RS00025;product=YidB family protein;protein_id=WP_000522208.1;transcript_id=gene-C7A06_RS00025;transl_table=11
+NZ_CP027599.1 RefSeq gene 6421 7233 . + . ID=nbis-gene-6;Name=yidA;gbkey=Gene;gene=yidA;gene_biotype=protein_coding;gene_id=nbis-gene-6;locus_tag=C7A06_RS00030
+NZ_CP027599.1 RefSeq transcript 6421 7233 . + . ID=gene-C7A06_RS00030;Parent=nbis-gene-6;Name=yidA;gbkey=Gene;gene=yidA;gene_biotype=protein_coding;gene_id=nbis-gene-6;locus_tag=C7A06_RS00030;original_biotype=mrna;transcript_id=gene-C7A06_RS00030
+NZ_CP027599.1 Protein Homology exon 6421 7233 . + . ID=nbis-exon-6;Parent=gene-C7A06_RS00030;Dbxref=Genbank:WP_000985541.1;Name=WP_000985541.1;Ontology_term=GO:0016787;gbkey=CDS;gene=yidA;gene_id=nbis-gene-6;go_function=hydrolase activity|0016787||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418152.1;locus_tag=C7A06_RS00030;product=sugar-phosphatase;protein_id=WP_000985541.1;transcript_id=gene-C7A06_RS00030;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 6421 7233 . + 0 ID=cds-WP_000985541.1;Parent=gene-C7A06_RS00030;Dbxref=Genbank:WP_000985541.1;Name=WP_000985541.1;Ontology_term=GO:0016787;gbkey=CDS;gene=yidA;gene_id=nbis-gene-6;go_function=hydrolase activity|0016787||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418152.1;locus_tag=C7A06_RS00030;product=sugar-phosphatase;protein_id=WP_000985541.1;transcript_id=gene-C7A06_RS00030;transl_table=11
+NZ_CP027599.1 RefSeq gene 7279 7935 . - . ID=nbis-gene-7;Name=C7A06_RS00035;gbkey=Gene;gene_biotype=protein_coding;gene_id=nbis-gene-7;locus_tag=C7A06_RS00035
+NZ_CP027599.1 RefSeq transcript 7279 7935 . - . ID=gene-C7A06_RS00035;Parent=nbis-gene-7;Name=C7A06_RS00035;gbkey=Gene;gene_biotype=protein_coding;gene_id=nbis-gene-7;locus_tag=C7A06_RS00035;original_biotype=mrna;transcript_id=gene-C7A06_RS00035
+NZ_CP027599.1 Protein Homology exon 7279 7935 . - . ID=nbis-exon-7;Parent=gene-C7A06_RS00035;Dbxref=Genbank:WP_000772931.1;Name=WP_000772931.1;gbkey=CDS;gene_id=nbis-gene-7;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709504.1;locus_tag=C7A06_RS00035;product=hypothetical protein;protein_id=WP_000772931.1;transcript_id=gene-C7A06_RS00035;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 7279 7935 . - 0 ID=cds-WP_000772931.1;Parent=gene-C7A06_RS00035;Dbxref=Genbank:WP_000772931.1;Name=WP_000772931.1;gbkey=CDS;gene_id=nbis-gene-7;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709504.1;locus_tag=C7A06_RS00035;product=hypothetical protein;protein_id=WP_000772931.1;transcript_id=gene-C7A06_RS00035;transl_table=11
+NZ_CP027599.1 RefSeq gene 8213 9777 . + . ID=nbis-gene-8;Name=dgoR,dgoK;gbkey=Gene;gene=dgoR,dgoK;gene_biotype=protein_coding;gene_id=nbis-gene-8,nbis-gene-9;locus_tag=C7A06_RS00040,C7A06_RS00045
+NZ_CP027599.1 RefSeq transcript 8213 8902 . + . ID=gene-C7A06_RS00040;Parent=nbis-gene-8;Name=dgoR;gbkey=Gene;gene=dgoR;gene_biotype=protein_coding;gene_id=nbis-gene-8;locus_tag=C7A06_RS00040;original_biotype=mrna;transcript_id=gene-C7A06_RS00040
+NZ_CP027599.1 Protein Homology exon 8213 8902 . + . ID=nbis-exon-8;Parent=gene-C7A06_RS00040;Dbxref=Genbank:WP_000174305.1;Name=WP_000174305.1;gbkey=CDS;gene=dgoR;gene_id=nbis-gene-8;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709505.1;locus_tag=C7A06_RS00040;product=D-galactonate utilization transcriptional regulator DgoR;protein_id=WP_000174305.1;transcript_id=gene-C7A06_RS00040;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 8213 8902 . + 0 ID=cds-WP_000174305.1;Parent=gene-C7A06_RS00040;Dbxref=Genbank:WP_000174305.1;Name=WP_000174305.1;gbkey=CDS;gene=dgoR;gene_id=nbis-gene-8;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709505.1;locus_tag=C7A06_RS00040;product=D-galactonate utilization transcriptional regulator DgoR;protein_id=WP_000174305.1;transcript_id=gene-C7A06_RS00040;transl_table=11
+NZ_CP027599.1 RefSeq transcript 8899 9777 . + . ID=gene-C7A06_RS00045;Parent=nbis-gene-8;Name=dgoK;gbkey=Gene;gene=dgoK;gene_biotype=protein_coding;gene_id=nbis-gene-9;locus_tag=C7A06_RS00045;original_biotype=mrna;transcript_id=gene-C7A06_RS00045
+NZ_CP027599.1 Protein Homology exon 8899 9777 . + . ID=nbis-exon-9;Parent=gene-C7A06_RS00045;Dbxref=Genbank:WP_000127112.1;Name=WP_000127112.1;gbkey=CDS;gene=dgoK;gene_id=nbis-gene-9;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709506.1;locus_tag=C7A06_RS00045;product=2-dehydro-3-deoxygalactonokinase;protein_id=WP_000127112.1;transcript_id=gene-C7A06_RS00045;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 8899 9777 . + 0 ID=cds-WP_000127112.1;Parent=gene-C7A06_RS00045;Dbxref=Genbank:WP_000127112.1;Name=WP_000127112.1;gbkey=CDS;gene=dgoK;gene_id=nbis-gene-9;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709506.1;locus_tag=C7A06_RS00045;product=2-dehydro-3-deoxygalactonokinase;protein_id=WP_000127112.1;transcript_id=gene-C7A06_RS00045;transl_table=11
+NZ_CP027599.1 RefSeq gene 9761 11523 . + . ID=nbis-gene-10;Name=dgoA,dgoD;gbkey=Gene;gene=dgoA,dgoD;gene_biotype=protein_coding;gene_id=nbis-gene-10,nbis-gene-11;locus_tag=C7A06_RS00050,C7A06_RS00055
+NZ_CP027599.1 RefSeq transcript 9761 10378 . + . ID=gene-C7A06_RS00050;Parent=nbis-gene-10;Name=dgoA;gbkey=Gene;gene=dgoA;gene_biotype=protein_coding;gene_id=nbis-gene-10;locus_tag=C7A06_RS00050;original_biotype=mrna;transcript_id=gene-C7A06_RS00050
+NZ_CP027599.1 Protein Homology exon 9761 10378 . + . ID=nbis-exon-10;Parent=gene-C7A06_RS00050;Dbxref=Genbank:WP_001198699.1;Name=WP_001198699.1;gbkey=CDS;gene=dgoA;gene_id=nbis-gene-10;inference=COORDINATES: similar to AA sequence:RefSeq:YP_026238.1;locus_tag=C7A06_RS00050;product=2-dehydro-3-deoxy-6-phosphogalactonate aldolase;protein_id=WP_001198699.1;transcript_id=gene-C7A06_RS00050;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 9761 10378 . + 0 ID=cds-WP_001198699.1;Parent=gene-C7A06_RS00050;Dbxref=Genbank:WP_001198699.1;Name=WP_001198699.1;gbkey=CDS;gene=dgoA;gene_id=nbis-gene-10;inference=COORDINATES: similar to AA sequence:RefSeq:YP_026238.1;locus_tag=C7A06_RS00050;product=2-dehydro-3-deoxy-6-phosphogalactonate aldolase;protein_id=WP_001198699.1;transcript_id=gene-C7A06_RS00050;transl_table=11
+NZ_CP027599.1 RefSeq transcript 10375 11523 . + . ID=gene-C7A06_RS00055;Parent=nbis-gene-10;Name=dgoD;gbkey=Gene;gene=dgoD;gene_biotype=protein_coding;gene_id=nbis-gene-11;locus_tag=C7A06_RS00055;original_biotype=mrna;transcript_id=gene-C7A06_RS00055
+NZ_CP027599.1 Protein Homology exon 10375 11523 . + . ID=nbis-exon-11;Parent=gene-C7A06_RS00055;Dbxref=Genbank:WP_000705001.1;Name=WP_000705001.1;Ontology_term=GO:0009063,GO:0008869;gbkey=CDS;gene=dgoD;gene_id=nbis-gene-11;go_function=galactonate dehydratase activity|0008869||IEA;go_process=cellular amino acid catabolic process|0009063||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1;locus_tag=C7A06_RS00055;product=galactonate dehydratase;protein_id=WP_000705001.1;transcript_id=gene-C7A06_RS00055;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 10375 11523 . + 0 ID=cds-WP_000705001.1;Parent=gene-C7A06_RS00055;Dbxref=Genbank:WP_000705001.1;Name=WP_000705001.1;Ontology_term=GO:0009063,GO:0008869;gbkey=CDS;gene=dgoD;gene_id=nbis-gene-11;go_function=galactonate dehydratase activity|0008869||IEA;go_process=cellular amino acid catabolic process|0009063||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1;locus_tag=C7A06_RS00055;product=galactonate dehydratase;protein_id=WP_000705001.1;transcript_id=gene-C7A06_RS00055;transl_table=11
+NZ_CP027599.1 RefSeq gene 11598 12935 . + . ID=nbis-gene-12;Name=dgoT;gbkey=Gene;gene=dgoT;gene_biotype=protein_coding;gene_id=nbis-gene-12;locus_tag=C7A06_RS00060
+NZ_CP027599.1 RefSeq transcript 11598 12935 . + . ID=gene-C7A06_RS00060;Parent=nbis-gene-12;Name=dgoT;gbkey=Gene;gene=dgoT;gene_biotype=protein_coding;gene_id=nbis-gene-12;locus_tag=C7A06_RS00060;original_biotype=mrna;transcript_id=gene-C7A06_RS00060
+NZ_CP027599.1 Protein Homology exon 11598 12935 . + . ID=nbis-exon-12;Parent=gene-C7A06_RS00060;Dbxref=Genbank:WP_000253455.1;Name=WP_000253455.1;gbkey=CDS;gene=dgoT;gene_id=nbis-gene-12;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709507.1;locus_tag=C7A06_RS00060;product=MFS transporter;protein_id=WP_000253455.1;transcript_id=gene-C7A06_RS00060;transl_table=11
+NZ_CP027599.1 Protein Homology CDS 11598 12935 . + 0 ID=cds-WP_000253455.1;Parent=gene-C7A06_RS00060;Dbxref=Genbank:WP_000253455.1;Name=WP_000253455.1;gbkey=CDS;gene=dgoT;gene_id=nbis-gene-12;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709507.1;locus_tag=C7A06_RS00060;product=MFS transporter;protein_id=WP_000253455.1;transcript_id=gene-C7A06_RS00060;transl_table=11
diff -r 000000000000 -r cffa21bb7a92 tool-data/fasta_indexes.loc.sample
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/fasta_indexes.loc.sample Tue May 23 13:42:43 2023 +0000
@@ -0,0 +1,29 @@
+#This is a sample file distributed with Galaxy that enables tools
+#to use a directory of Samtools indexed sequences data files. You will need
+#to create these data files and then create a fasta_indexes.loc file
+#similar to this one (store it in this directory) that points to
+#the directories in which those files are stored. The fasta_indexes.loc
+#file has this format (white space characters are TAB characters):
+#
+#
+#
+#So, for example, if you had hg19 Canonical indexed stored in
+#
+# /depot/data2/galaxy/hg19/sam/,
+#
+#then the fasta_indexes.loc entry would look like this:
+#
+#hg19canon hg19 Human (Homo sapiens): hg19 Canonical /depot/data2/galaxy/hg19/sam/hg19canon.fa
+#
+#and your /depot/data2/galaxy/hg19/sam/ directory
+#would contain hg19canon.fa and hg19canon.fa.fai files.
+#
+#Your fasta_indexes.loc file should include an entry per line for
+#each index set you have stored. The file in the path does actually
+#exist, but it should never be directly used. Instead, the name serves
+#as a prefix for the index file. For example:
+#
+#hg18canon hg18 Human (Homo sapiens): hg18 Canonical /depot/data2/galaxy/hg18/sam/hg18canon.fa
+#hg18full hg18 Human (Homo sapiens): hg18 Full /depot/data2/galaxy/hg18/sam/hg18full.fa
+#hg19canon hg19 Human (Homo sapiens): hg19 Canonical /depot/data2/galaxy/hg19/sam/hg19canon.fa
+#hg19full hg19 Human (Homo sapiens): hg19 Full /depot/data2/galaxy/hg19/sam/hg19full.fa
diff -r 000000000000 -r cffa21bb7a92 tool_data_table_conf.xml.sample
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml.sample Tue May 23 13:42:43 2023 +0000
@@ -0,0 +1,7 @@
+
+
+
+ value, dbkey, name, path
+
+
+
diff -r 000000000000 -r cffa21bb7a92 tool_data_table_conf.xml.test
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml.test Tue May 23 13:42:43 2023 +0000
@@ -0,0 +1,7 @@
+
+
+
+ value, dbkey, name, path
+
+
+