# HG changeset patch # User bernhardlutz # Date 1388261715 18000 # Node ID 414f51a0b5b5fe1b6a4e5a222d9e99d6c57d0f0d # Parent 51e200ccf18eafac04b3124c670862cd0c747284 Deleted selected files diff -r 51e200ccf18e -r 414f51a0b5b5 create_html.py --- a/create_html.py Sat Dec 28 15:09:10 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,26 +0,0 @@ -#!/usr/bin/env python - -import os -import sys -import zipfile - - -os.chdir(sys.argv[2]) -o = open( 'results.html', 'w+' ) - - -o.write('

ExpaRNA Result

' ) - -for filename in os.listdir( sys.argv[2] ): - if os.path.isfile( os.path.join( sys.argv[2], filename) ) and False ==(filename.endswith('epm') or filename.endswith('fa') or filename.endswith('aln') or filename.endswith('html')): - o.write( '

' % ( filename )) - -o.write( '' ) -o.close() - -# create zip file - -zf = zipfile.ZipFile(sys.argv[1], mode='w') -for files in os.listdir(sys.argv[2]): - zf.write(files) -zf.close() diff -r 51e200ccf18e -r 414f51a0b5b5 exparna.xml --- a/exparna.xml Sat Dec 28 15:09:10 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,59 +0,0 @@ - - - - exparna - EXPARNA_SCRIPT_PATH - - -ExpaRNA --t$emp_scoring -#if $check == "no": --n$max_used_sub -#end if --s$min_incl_sub -$locarna_input -$alignment_to_file -$list_in_file -$all_in_file -$fastafile; - mkdir $outfile.files_path; - cp ./ExpaRNA-results/* $outfile.files_path; - python \$EXPARNA_SCRIPT_PATH/create_html.py $outfile $outfile.files_path; - - - - - - - - - - - - - - - - - - - - - - - - - - - - - **What it does** - http://rna.informatik.uni-freiburg.de/ExpaRNA/Input.jsp - -ExpaRNA is a fast, motif-based comparison and alignment tool for RNA molecules. Instead of computing a full sequence-structure alignment, it computes the best arrangement of sequence-structure motifs common to two RNAs. A motif is a local (or isolated) substructure which is identical to both RNAs. ExpaRNA requires a given nested secondary structure for both RNAs. If no structure is available, RNAfold from Vienna RNA Package is used for a structure prediction. The accuracy of the algorithm is mainly controlled by the minimal size of the included sequence-structure motifs. ExpaRNA is especially useful for comparative structural RNA analysis and to speed-up complex sequence-structure alignment methods. For this purpose, the predicted common substructures by ExpaRNA are used as anchor constraints for a full structural alignment. - - **Output** - You will receive a zip file containing all output files - - diff -r 51e200ccf18e -r 414f51a0b5b5 test-data/input.fasta --- a/test-data/input.fasta Sat Dec 28 15:09:10 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,4 +0,0 @@ ->AF165050.379 -UUGGGGGCGACAUUCCACCAUAGAUAAUUCCCCUGUGAGGAAUUACUGUUUUAACGCAGAAAGCGUUUAGCCAUGGCGUUAGUAUGAGUGUCGUGCAGCUUCCAGGACCCCCCCUCCCGGGAGAGCCAUAGUGGUCUGCGGAACCGGUGAGUACACCGGAAUUGCCAGGAUGACCGGGUCCUUUCUUGGAUCAACCCGCUCAAUGCCUGGAGAUUUGGGCGUGCCCCCGCGAGACUGCUAGCCGAGUAGUGUUGGGUCGCGAAAGGCCUUGUGGUACUGCCUGAUAGGGUGCUUGCGAGUGCCCCGGGAGGUCUCGUAGACCGUGCAUCAUGAGCACAAAUCCUAAACCCCAAAGAAAAACCAAACGUAACACCAACCG ->D45172.391 -GCCAGCCCCCUGAUGGGGGCGACACUCCACCAUAGAUCACUCCCCUGUGAGGAACUACUGUCUUCACGCAGAAAGCGUCUAGCCAUGGCGUUAGUAUGAGUGUCGUGCAGCCUCCAGGACCCCCCCUCCCGGGAGAGCCAUAGUGGUCUGCGGAACCGGUGAGUACACCGGAAUUGCCAGGACGACCGGGUCCUUUCUUGGAUCAACCCGCUCAAUGCCUGGAGAUUUGGGCGUGCCCCCGCGAGACUGCUAGCCGAGUAGUGUUGGGUCGCGAAAGGCCUUGUGGUACUGCCUGAUAGGGUGCUUGCGAGUGCCCCGGGAGGUCUCGUAGACCGUGCAUCAUGAGCACAAAUCCAAAACCCCAAAGAAAAAUCAAACGUAACACCAACCG diff -r 51e200ccf18e -r 414f51a0b5b5 test-data/input.fasta~ --- a/test-data/input.fasta~ Sat Dec 28 15:09:10 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,4 +0,0 @@ ->AF165050.379 -UUGGGGGCGACAUUCCACCAUAGAUAAUUCCCCUGUGAGGAAUUACUGUUUUAACGCAGAAAGCGUUUAGCCAUGGCGUUAGUAUGAGUGUCGUGCAGCUUCCAGGACCCCCCCUCCCGGGAGAGCCAUAGUGGUCUGCGGAACCGGUGAGUACACCGGAAUUGCCAGGAUGACCGGGUCCUUUCUUGGAUCAACCCGCUCAAUGCCUGGAGAUUUGGGCGUGCCCCCGCGAGACUGCUAGCCGAGUAGUGUUGGGUCGCGAAAGGCCUUGUGGUACUGCCUGAUAGGGUGCUUGCGAGUGCCCCGGGAGGUCUCGUAGACCGUGCAUCAUGAGCACAAAUCCUAAACCCCAAAGAAAAACCAAACGUAACACCAACCG ->D45172.391 -GCCAGCCCCCUGAUGGGGGCGACACUCCACCAUAGAUCACUCCCCUGUGAGGAACUACUGUCUUCACGCAGAAAGCGUCUAGCCAUGGCGUUAGUAUGAGUGUCGUGCAGCCUCCAGGACCCCCCCUCCCGGGAGAGCCAUAGUGGUCUGCGGAACCGGUGAGUACACCGGAAUUGCCAGGACGACCGGGUCCUUUCUUGGAUCAACCCGCUCAAUGCCUGGAGAUUUGGGCGUGCCCCCGCGAGACUGCUAGCCGAGUAGUGUUGGGUCGCGAAAGGCCUUGUGGUACUGCCUGAUAGGGUGCUUGCGAGUGCCCCGGGAGGUCUCGUAGACCGUGCAUCAUGAGCACAAAUCCAAAACCCCAAAGAAAAAUCAAACGUAACACCAACCG diff -r 51e200ccf18e -r 414f51a0b5b5 tool_dependencies.xml --- a/tool_dependencies.xml Sat Dec 28 15:09:10 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,31 +0,0 @@ - - - - - - - - - http://www.bioinf.uni-freiburg.de/Software/expaRNA/exparna-1.0.tar.gz - - - - - - ./configure --prefix $INSTALL_DIR --with-RNA=$ROOT_VIENNA_RNA_DIR - - - create_html.py - $INSTALL_DIR - - - $INSTALL_DIR/bin - - - $INSTALL_DIR - - - - Compiling ExpaRNA requires a C compiler (typically gcc) - -