Mercurial > repos > artbio > mircounts
changeset 1:ed37e8c6e232 draft
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mircounts commit 356a4309668ba4b07b85013753d34358464222e8
| author | artbio |
|---|---|
| date | Tue, 18 Jul 2017 06:36:21 -0400 |
| parents | 10f0e4c00b13 |
| children | fe1ed513da99 |
| files | mircounts.xml.back tool-data/GFFs_v21.tar.gz tool-data/hairpin_v21.fa.gz tool_data_table_conf.xml.test |
| diffstat | 4 files changed, 0 insertions(+), 205 deletions(-) [+] |
line wrap: on
line diff
--- a/mircounts.xml.back Tue Jul 18 06:30:40 2017 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,198 +0,0 @@ -<tool id="miRCounts" name="miRCounts" version="0.1"> - <description> Counts miRNA alignments from small RNA sequence data</description> - <requirements> - <requirement type="package" version="1.2">bowtie</requirement> - <requirement type="package" version="1.4.1">samtools</requirement> - <requirement type="package" version="0.11.2.1=py27_0">pysam</requirement> - </requirements> - <command detect_errors="exit_code"><![CDATA[ - ## To be refactored with guidelines in https://github.com/ARTbio/tools-artbio/issues/140 - wget ftp://mirbase.org/pub/mirbase/CURRENT/genomes/${genomeKey}.gff3 && ## download gff3 specified by the variable genomeKey - python '$__tool_directory__'/mature_mir_gff_translation.py --input ${genomeKey}.gff3 --output $gff3 && ## transcode the mature miR genome coordinates into coordinates relative to the corresponding "miRNA_primary_transcript". - wget ftp://mirbase.org/pub/mirbase/CURRENT/hairpin.fa.gz && - sh '$__tool_directory__'/format_fasta_hairpins.sh $genomeKey && - #if $cutadapt.cutoption == "yes": - python '$__tool_directory__'/yac.py --input $cutadapt.input - --output clipped_input.fastq - --output_format fastq - --adapter_to_clip $cutadapt.clip_source.clip_sequence - --min $cutadapt.min - --max $cutadapt.max - --Nmode $cutadapt.Nmode && - #else - ln -f -s '$cutadapt.clipped_input' clipped_input.fastq && - #end if - bowtie-build hairpin.fa hairpin && - bowtie -v $v -M 1 --best --strata --norc -p \${GALAXY_SLOTS:-4} --sam hairpin -q clipped_input.fastq 2>/dev/null | samtools sort -O bam -o '$output' - ##samtools view -bS output.sam -o output.bam && - ##samtools sort output.bam output.sorted && - ##samtools index output.sorted && - ## mv output.sorted.bam $output - ## bowtie parse : - ## Be careful: - ## Bam: 0-based; SAM: 1-based; GFF: 1-based - ## end refactoring - ]]></command> - <inputs> - <conditional name="cutadapt"> - <param label="Remove adapter sequence before aligning" name="cutoption" type="select"> - <option value="no">no</option> - <option selected="True" value="yes">yes</option> - </param> - <when value="yes"> - <param format="fastq" label="Source file" name="input" type="data" /> - <param label="min size" name="min" size="4" type="integer" value="15" /> - <param label="max size" name="max" size="4" type="integer" value="36" /> - <param label="Accept reads containing N?" name="Nmode" type="select"> - <option selected="True" value="accept">accept</option> - <option value="reject">reject</option> - </param> - <conditional name="clip_source"> - <param help="Built-in adapters or User-provided" label="Source" name="clip_source_list" type="select"> - <option selected="True" value="prebuilt">Use a built-in adapter (select from the list below)</option> - <option value="user">Use custom sequence</option> - </param> - <when value="prebuilt"> - <param help="if your adapter is not listed, input your own sequence" label="Select Adapter to clip" name="clip_sequence" type="select"> - <option value="TCGTATGCCGTCTTCTGCTTG">Solexa TCGTATGCCGTCTTCTGCTTG</option> - <option value="ATCTCGTATGCCGTCTTCTGCTT">Illumina ATCTCGTATGCCGTCTTCTGCTT</option> - <option selected="True" value="TGGAATTCTCGGGTGCCAAG">Illumina TruSeq TGGAATTCTCGGGTGCCAAG</option> - <option value="CTGTAGGCACCATCAATCGT">IdT CTGTAGGCACCATCAATCGT</option> - </param> - </when> - <when value="user"> - <param label="Enter your Sequence" name="clip_sequence" size="35" type="text" value="GAATCC" /> - </when> - </conditional> - </when> - <when value="no"> - <param label="Select fastq files to align" name="clipped_input" type="data" format="fastq,fastqsanger" help="Note that sequences reads must be clipped from their adapter" /> - </when> - </conditional> - <param name="genomeKey" type="select" label="Choose Organism"> - <options from_data_table="miRbase_GenomeKeys"> - <column name="name" index="1"/> - <column name="value" index="0"/> - </options> - </param> - <param help="command [ bowtie -v 0,1,2,3 -M 1 --best --strata --norc ] will be used. Specify a value for -v (number of mismatches allowed)" label="Number of mismatches allowed" name="v" type="select"> - <option value="0">0</option> - <option selected="true" value="1">1</option> - <option value="2">2</option> - <option value="3">3</option> - </param> - </inputs> - <outputs> - <data format="bam" label="bam alignment" name="output" /> - <data format="gff3" label="GFF3 generated by miRCounts" name="gff3"/> - <!-- - <data format="tabular" label="Premirs Count Lists" name="output1" /> - <data format="tabular" label="Mature Mirs Count Lists" name="output2" /> - <data format="tabular" label="Lattice Dataframe" name="lattice_dataframe"> - <filter>plotting['plottingOption'] == "yes"</filter> - </data> - <data format="pdf" label="Mir coverage" name="latticePDF"> - <filter>plotting['plottingOption'] == "yes"</filter> - </data> - --> - </outputs> - <tests> - <test> - <param name="cutoption" value="yes" /> - <param name="min" value="15"/> - <param name="max" value="25"/> - <param name="Nmode" value="reject"/> - <param name="clip_sequence" value="TCGTATGCCGTCTTCTGCTTG"/> - <param name="v" value="0"/> - <param name="genomeKey" value="dme"/> - <param name="input" value="input.unclipped.fastqsanger" ftype="fastqsanger"/> - <output name="output" file="unclipped.out.bam" ftype="bam"/> - <output name="gff3" file="translated_dme.gff3" ftype="gff3"/> - </test> - <test> - <param name="cutoption" value="no" /> - <param name="v" value="1"/> - <param name="genomeKey" value="dme"/> - <param name="clipped_input" value="input.clipped.fastqsanger" ftype="fastqsanger"/> - <output name="output" file="clipped.out.bam" ftype="bam"/> - <output name="gff3" file="translated_dme.gff3" ftype="gff3"/> - </test> - </tests> - <!-- - <configfiles> - <configfile name="plotCode"> - #if $plotting.plottingOption == "yes": - graph_type = "${plotting.display}" ## "relative" or "absolute" - ## Setup R error handling to go to stderr - options( show.error.messages=F, - error = function () { cat( geterrmessage(), file=stderr() ); q( "no", 1, F ) } ) - library(lattice) - coverage = read.delim("${lattice_dataframe}", header=T) - Numb_of_biosamples = length(levels(coverage\$sample)) - if (graph_type=="relative") { - graph = xyplot(countsNorm~offsetNorm | mir, data=coverage, groups=polarity, col=c("red", "blue"), type="l", lwd=1, - scales=list(x=list(cex=.5), y=list(cex=.5)), par.strip.text=list(cex=.5), strip=strip.custom(which.given=1, bg="lightblue"), layout=c(Numb_of_biosamples,15), as.table=TRUE, main="miRNA coverage maps") - } else { - graph = xyplot(counts~offset | mir, data=coverage, groups=polarity, col=c("red", "blue"), type="l", lwd=1, - scales=list(x=list(cex=.5), y=list(cex=.5)), par.strip.text=list(cex=.5), strip=strip.custom(which.given=1, bg="lightblue"), layout=c(Numb_of_biosamples,15), as.table=TRUE, main="miRNA coverage maps") - } - ## pdf output - pdf(file="${latticePDF}", paper="special", height=11.69, width=8.2677) - plot(graph, newpage = T) - dev.off() - #end if - </configfile> - </configfiles> - --> - <help> - -**What it does** - -This tool uses a species-specific GFF3 file from mirBase_ to guide the parsing of an alignment file produced with the sRbowtie tool. - -.. _mirBase: ftp://mirbase.org/pub/mirbase/CURRENT/genomes/ - ------- - -.. class:: warningmark - -the Guide GFF3 file must be in the following format: - -2L . miRNA_primary_transcript 243035 243141 . - . ID=MI0005821;Alias=MI0005821;Name=dme-mir-965 - -2L . miRNA 243055 243076 . - . ID=MIMAT0005480;Alias=MIMAT0005480;Name=dme-miR-965-3p;Derives_from=MI0005821 - -2L . miRNA 243096 243118 . - . ID=MIMAT0020861;Alias=MIMAT0020861;Name=dme-miR-965-5p;Derives_from=MI0005821 - -2L . miRNA_primary_transcript 857542 857632 . + . ID=MI0005813;Alias=MI0005813;Name=dme-mir-375 - -2L . miRNA 857596 857617 . + . ID=MIMAT0005472;Alias=MIMAT0005472;Name=dme-miR-375-3p;Derives_from=MI0005813 - -2L . miRNA 857556 857579 . + . ID=MIMAT0020853;Alias=MIMAT0020853;Name=dme-miR-375-5p;Derives_from=MI0005813 - -2L . miRNA_primary_transcript 1831685 1831799 . - . ID=MI0011290;Alias=MI0011290;Name=dme-mir-2280 - -With name for mature miRNA (3rd column = miRNA) containing either the -3p or -5p string in the attribute Name (Name=dme-miR-965-3p, for instance) - ------- - -**Input formats** - -1. One or sereral alignment files generated with sRbowtie tool and **renamed** according to the name of the biosample (avoid spaces in biosample labels) - -.. class:: warningmark - -Alignment datasets generated with sRbowtie must be renamed according to a biosample name - -2. A GFF3 file retrieved from mirBase_ - ------- - -**Outputs** - -Two count list files for counts of reads aligned to pre-mir or mature miRNA - -A pdf of pre-mir coverages. Red coverages indicate that the mir gene is in the genomic up strand, blue coverages indicate that the mir gene is in the genomic down strand. - - </help> -</tool>
--- a/tool_data_table_conf.xml.test Tue Jul 18 06:30:40 2017 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,7 +0,0 @@ -<tables> - <!-- miRBase GenomeKeys --> - <table name="miRbase_GenomeKeys" comment_char="#"> - <columns>value, name</columns> - <file path="${__HERE__}/test-data/mirbase_genomeKeys.loc" /> - </table> -</tables>