Mercurial > repos > artbio > mircounts
diff mircounts.xml.back @ 0:10f0e4c00b13 draft
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/mircounts commit 3a6181bd181729f642b75c4e689f063fc2821cf1
| author | artbio |
|---|---|
| date | Tue, 18 Jul 2017 06:30:40 -0400 |
| parents | |
| children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/mircounts.xml.back Tue Jul 18 06:30:40 2017 -0400 @@ -0,0 +1,198 @@ +<tool id="miRCounts" name="miRCounts" version="0.1"> + <description> Counts miRNA alignments from small RNA sequence data</description> + <requirements> + <requirement type="package" version="1.2">bowtie</requirement> + <requirement type="package" version="1.4.1">samtools</requirement> + <requirement type="package" version="0.11.2.1=py27_0">pysam</requirement> + </requirements> + <command detect_errors="exit_code"><![CDATA[ + ## To be refactored with guidelines in https://github.com/ARTbio/tools-artbio/issues/140 + wget ftp://mirbase.org/pub/mirbase/CURRENT/genomes/${genomeKey}.gff3 && ## download gff3 specified by the variable genomeKey + python '$__tool_directory__'/mature_mir_gff_translation.py --input ${genomeKey}.gff3 --output $gff3 && ## transcode the mature miR genome coordinates into coordinates relative to the corresponding "miRNA_primary_transcript". + wget ftp://mirbase.org/pub/mirbase/CURRENT/hairpin.fa.gz && + sh '$__tool_directory__'/format_fasta_hairpins.sh $genomeKey && + #if $cutadapt.cutoption == "yes": + python '$__tool_directory__'/yac.py --input $cutadapt.input + --output clipped_input.fastq + --output_format fastq + --adapter_to_clip $cutadapt.clip_source.clip_sequence + --min $cutadapt.min + --max $cutadapt.max + --Nmode $cutadapt.Nmode && + #else + ln -f -s '$cutadapt.clipped_input' clipped_input.fastq && + #end if + bowtie-build hairpin.fa hairpin && + bowtie -v $v -M 1 --best --strata --norc -p \${GALAXY_SLOTS:-4} --sam hairpin -q clipped_input.fastq 2>/dev/null | samtools sort -O bam -o '$output' + ##samtools view -bS output.sam -o output.bam && + ##samtools sort output.bam output.sorted && + ##samtools index output.sorted && + ## mv output.sorted.bam $output + ## bowtie parse : + ## Be careful: + ## Bam: 0-based; SAM: 1-based; GFF: 1-based + ## end refactoring + ]]></command> + <inputs> + <conditional name="cutadapt"> + <param label="Remove adapter sequence before aligning" name="cutoption" type="select"> + <option value="no">no</option> + <option selected="True" value="yes">yes</option> + </param> + <when value="yes"> + <param format="fastq" label="Source file" name="input" type="data" /> + <param label="min size" name="min" size="4" type="integer" value="15" /> + <param label="max size" name="max" size="4" type="integer" value="36" /> + <param label="Accept reads containing N?" name="Nmode" type="select"> + <option selected="True" value="accept">accept</option> + <option value="reject">reject</option> + </param> + <conditional name="clip_source"> + <param help="Built-in adapters or User-provided" label="Source" name="clip_source_list" type="select"> + <option selected="True" value="prebuilt">Use a built-in adapter (select from the list below)</option> + <option value="user">Use custom sequence</option> + </param> + <when value="prebuilt"> + <param help="if your adapter is not listed, input your own sequence" label="Select Adapter to clip" name="clip_sequence" type="select"> + <option value="TCGTATGCCGTCTTCTGCTTG">Solexa TCGTATGCCGTCTTCTGCTTG</option> + <option value="ATCTCGTATGCCGTCTTCTGCTT">Illumina ATCTCGTATGCCGTCTTCTGCTT</option> + <option selected="True" value="TGGAATTCTCGGGTGCCAAG">Illumina TruSeq TGGAATTCTCGGGTGCCAAG</option> + <option value="CTGTAGGCACCATCAATCGT">IdT CTGTAGGCACCATCAATCGT</option> + </param> + </when> + <when value="user"> + <param label="Enter your Sequence" name="clip_sequence" size="35" type="text" value="GAATCC" /> + </when> + </conditional> + </when> + <when value="no"> + <param label="Select fastq files to align" name="clipped_input" type="data" format="fastq,fastqsanger" help="Note that sequences reads must be clipped from their adapter" /> + </when> + </conditional> + <param name="genomeKey" type="select" label="Choose Organism"> + <options from_data_table="miRbase_GenomeKeys"> + <column name="name" index="1"/> + <column name="value" index="0"/> + </options> + </param> + <param help="command [ bowtie -v 0,1,2,3 -M 1 --best --strata --norc ] will be used. Specify a value for -v (number of mismatches allowed)" label="Number of mismatches allowed" name="v" type="select"> + <option value="0">0</option> + <option selected="true" value="1">1</option> + <option value="2">2</option> + <option value="3">3</option> + </param> + </inputs> + <outputs> + <data format="bam" label="bam alignment" name="output" /> + <data format="gff3" label="GFF3 generated by miRCounts" name="gff3"/> + <!-- + <data format="tabular" label="Premirs Count Lists" name="output1" /> + <data format="tabular" label="Mature Mirs Count Lists" name="output2" /> + <data format="tabular" label="Lattice Dataframe" name="lattice_dataframe"> + <filter>plotting['plottingOption'] == "yes"</filter> + </data> + <data format="pdf" label="Mir coverage" name="latticePDF"> + <filter>plotting['plottingOption'] == "yes"</filter> + </data> + --> + </outputs> + <tests> + <test> + <param name="cutoption" value="yes" /> + <param name="min" value="15"/> + <param name="max" value="25"/> + <param name="Nmode" value="reject"/> + <param name="clip_sequence" value="TCGTATGCCGTCTTCTGCTTG"/> + <param name="v" value="0"/> + <param name="genomeKey" value="dme"/> + <param name="input" value="input.unclipped.fastqsanger" ftype="fastqsanger"/> + <output name="output" file="unclipped.out.bam" ftype="bam"/> + <output name="gff3" file="translated_dme.gff3" ftype="gff3"/> + </test> + <test> + <param name="cutoption" value="no" /> + <param name="v" value="1"/> + <param name="genomeKey" value="dme"/> + <param name="clipped_input" value="input.clipped.fastqsanger" ftype="fastqsanger"/> + <output name="output" file="clipped.out.bam" ftype="bam"/> + <output name="gff3" file="translated_dme.gff3" ftype="gff3"/> + </test> + </tests> + <!-- + <configfiles> + <configfile name="plotCode"> + #if $plotting.plottingOption == "yes": + graph_type = "${plotting.display}" ## "relative" or "absolute" + ## Setup R error handling to go to stderr + options( show.error.messages=F, + error = function () { cat( geterrmessage(), file=stderr() ); q( "no", 1, F ) } ) + library(lattice) + coverage = read.delim("${lattice_dataframe}", header=T) + Numb_of_biosamples = length(levels(coverage\$sample)) + if (graph_type=="relative") { + graph = xyplot(countsNorm~offsetNorm | mir, data=coverage, groups=polarity, col=c("red", "blue"), type="l", lwd=1, + scales=list(x=list(cex=.5), y=list(cex=.5)), par.strip.text=list(cex=.5), strip=strip.custom(which.given=1, bg="lightblue"), layout=c(Numb_of_biosamples,15), as.table=TRUE, main="miRNA coverage maps") + } else { + graph = xyplot(counts~offset | mir, data=coverage, groups=polarity, col=c("red", "blue"), type="l", lwd=1, + scales=list(x=list(cex=.5), y=list(cex=.5)), par.strip.text=list(cex=.5), strip=strip.custom(which.given=1, bg="lightblue"), layout=c(Numb_of_biosamples,15), as.table=TRUE, main="miRNA coverage maps") + } + ## pdf output + pdf(file="${latticePDF}", paper="special", height=11.69, width=8.2677) + plot(graph, newpage = T) + dev.off() + #end if + </configfile> + </configfiles> + --> + <help> + +**What it does** + +This tool uses a species-specific GFF3 file from mirBase_ to guide the parsing of an alignment file produced with the sRbowtie tool. + +.. _mirBase: ftp://mirbase.org/pub/mirbase/CURRENT/genomes/ + +------ + +.. class:: warningmark + +the Guide GFF3 file must be in the following format: + +2L . miRNA_primary_transcript 243035 243141 . - . ID=MI0005821;Alias=MI0005821;Name=dme-mir-965 + +2L . miRNA 243055 243076 . - . ID=MIMAT0005480;Alias=MIMAT0005480;Name=dme-miR-965-3p;Derives_from=MI0005821 + +2L . miRNA 243096 243118 . - . ID=MIMAT0020861;Alias=MIMAT0020861;Name=dme-miR-965-5p;Derives_from=MI0005821 + +2L . miRNA_primary_transcript 857542 857632 . + . ID=MI0005813;Alias=MI0005813;Name=dme-mir-375 + +2L . miRNA 857596 857617 . + . ID=MIMAT0005472;Alias=MIMAT0005472;Name=dme-miR-375-3p;Derives_from=MI0005813 + +2L . miRNA 857556 857579 . + . ID=MIMAT0020853;Alias=MIMAT0020853;Name=dme-miR-375-5p;Derives_from=MI0005813 + +2L . miRNA_primary_transcript 1831685 1831799 . - . ID=MI0011290;Alias=MI0011290;Name=dme-mir-2280 + +With name for mature miRNA (3rd column = miRNA) containing either the -3p or -5p string in the attribute Name (Name=dme-miR-965-3p, for instance) + +------ + +**Input formats** + +1. One or sereral alignment files generated with sRbowtie tool and **renamed** according to the name of the biosample (avoid spaces in biosample labels) + +.. class:: warningmark + +Alignment datasets generated with sRbowtie must be renamed according to a biosample name + +2. A GFF3 file retrieved from mirBase_ + +------ + +**Outputs** + +Two count list files for counts of reads aligned to pre-mir or mature miRNA + +A pdf of pre-mir coverages. Red coverages indicate that the mir gene is in the genomic up strand, blue coverages indicate that the mir gene is in the genomic down strand. + + </help> +</tool>