Mercurial > repos > anton > vcfprimers
diff vcfprimers.xml @ 0:db9eccfd0f26 draft
Uploaded
| author | anton |
|---|---|
| date | Tue, 27 May 2014 17:56:59 -0400 |
| parents | |
| children | 6faeef9a0a73 |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/vcfprimers.xml Tue May 27 17:56:59 2014 -0400 @@ -0,0 +1,69 @@ +<tool id="vcfprimers" name="VCFprimers:" version="0.0.1"> +<requirements> + <requirement type="package" version="586c5ae5d57a38dae6b32ea831fb1f7cfa14c9bd">vcflib</requirement> + <!-- <requirement type="package" version="0.1.18">samtools</requirement> --> +</requirements> + <description>Extract flanking sequences for each VCF record</description> + <command> + #set $reference_fasta_filename = "localref.fa" + #if str( $reference_source.reference_source_selector ) == "history": + ln -s "${reference_source.ref_file}" "${reference_fasta_filename}" && + #else: + #set $reference_fasta_filename = str( $reference_source.ref_file.fields.path ) + #end if + vcfprimers -f "${reference_fasta_filename}" -l "${primer_length}" "${input_vcf}" > "${out_file1}"</command> + <inputs> +<param name="input_vcf" type="data" format="vcf" label="VCF dataset to extract flanks" /> + <conditional name="reference_source"> + <param name="reference_source_selector" type="select" label="Choose the source for the reference genome"> + <option value="cached">Locally cached</option> + <option value="history">History</option> + </param> + <when value="cached"> + <param name="ref_file" type="select" label="Select reference genome"> + <options from_data_table="fasta_indexes"> + </options> + <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/> + </param> + </when> + <when value="history"> <!-- FIX ME!!!! --> + <param name="ref_file" type="data" format="fasta" label="Using reference file" /> + </when> + </conditional> + <param name="primer_length" type="integer" value="20" label="The length of the primer sequences on each side of the variant" help="default = 20 bp" /> + </inputs> + <outputs> + <data format="fasta" name="out_file1" /> + </outputs> + <stdio> + <exit_code range="1:" level="fatal" /> + </stdio> + <tests> + <test> + <param name="reference_source_selector" value="history" /> + <param name="input_vcf" value="vcflib-chr20-X.vcf"/> + <param name="ref_file" value="vcflib-human-reference-chr20-XY.fa" /> + <param name="primer_length" value="5" /> + <output name="out_file1" file="vcfprimers-test1.fasta"/> + </test> + </tests> + <help> + +For each VCF record, extract the flanking sequences, and write them to stdout as FASTA +records suitable for alignment. This tool is intended for use in designing validation +experiments. Primers extracted which would flank all of the alleles at multi-allelic +sites. The name of the FASTA "reads" indicates the VCF record which they apply to. +The form is >CHROM_POS_LEFT for the 3' primer and >CHROM_POS_RIGHT for the 5' primer, +for example:: + + >20_233255_LEFT + CCATTGTATATATAGACCATAATTTCTTTATCCAATCATCTGTTGATGGA + >20_233255_RIGHT + ACTCAGTTGATTCCATACCTTTGCCATCATGAATCATGTTGTAATAAACA + +---- + +Vcfprimers is a part of VCFlib toolkit developed by Erik Garrison (https://github.com/ekg/vcflib). + +</help> +</tool>
