# HG changeset patch
# User lecorguille
# Date 1537775771 14400
# Node ID e418021a8c6936e1b05af36e761ee04bde6cdba7
# Parent  c0f695436d51b623342dcdb7284436457f564347
planemo upload for repository https://github.com/abims-sbr/adaptsearch commit 3c7982d775b6f3b472f6514d791edcb43cd258a1

diff -r c0f695436d51 -r e418021a8c69 filter_assembly.xml
--- a/filter_assembly.xml	Tue Jul 03 10:52:05 2018 -0400
+++ b/filter_assembly.xml	Mon Sep 24 03:56:11 2018 -0400
@@ -112,14 +112,16 @@
 
 **Input format**
 
-    (1) Sequences are in the sequential format:
-        >seqname1
-        AAAGAGAGACCACATGTCAGTAGC -on one or several lines -
-        >seqname2
-        AAGGCCTGACCACATGAGTTAAGC -on one or several lines -
-        ...
+(1) Sequences are in the sequential format:
 
-    2) The file name should begin with a two letter abbreviation of the species name (for isntance, 'Ap' if the species is Alviella pompejana).
+| >seqname1
+| AAAGAGAGACCACATGTCAGTAGC -on one or several lines -
+| >seqname2
+| AAGGCCTGACCACATGAGTTAAGC -on one or several lines -
+| etc ...
+|
+
+2) The file name should begin with a two letter abbreviation of the species name (for isntance, 'Ap' if the species is Alvinella pompejana).
 
 **For Velvet Oases assemblies input**
             
@@ -127,7 +129,7 @@
 
 **For Trinity assemblies inputs**   
             
-    The headers must be as follow : >cj_gj_ij Len=j path=[j:0-j] where all the j are integers (locus number, transcript variant, length, position...)
+    The headers must be as follow : *>cj_gj_ij Len=j path=[j:0-j]* where all the j are integers (locus number, transcript variant, length, position...)
 
 **The tool handles the case if input files come from both assemblers (there is no need for input files to be exclusively from one or another assembler).**
 
@@ -186,6 +188,4 @@
     ]]>
 	</help>
 
-    <expand macro="citations" />
-
 </tool>
diff -r c0f695436d51 -r e418021a8c69 macros.xml
--- a/macros.xml	Tue Jul 03 10:52:05 2018 -0400
+++ b/macros.xml	Mon Sep 24 03:56:11 2018 -0400
@@ -7,13 +7,14 @@
     <token name="@HELP_AUTHORS@">
 .. class:: infomark
 
-**Authors**  Eric Fontanillas creates the scripts of this pipeline.
+**Authors**  Eric Fontanillas created the version 1 of this pipeline. Victor Mataigne developped version 2.
 
 .. class:: infomark
 
-**Galaxy integration** ABiMS TEAM
+**Galaxy integration** Julie Baffard and ABiMS TEAM, Roscoff Marine Station
 
  | Contact support.abims@sb-roscoff.fr for any questions or concerns about the Galaxy implementation of this tool.
+ | Credits : Gildas le Corguillé, Misharl Monsoor
 
 ---------------------------------------------------