Mercurial > repos > abims-sbr > filter_assemblies
diff filter_assembly.xml @ 10:e418021a8c69 draft
planemo upload for repository https://github.com/abims-sbr/adaptsearch commit 3c7982d775b6f3b472f6514d791edcb43cd258a1
| author | lecorguille |
|---|---|
| date | Mon, 24 Sep 2018 03:56:11 -0400 |
| parents | 948864b6ab4b |
| children | 36084a2949bf |
line wrap: on
line diff
--- a/filter_assembly.xml Tue Jul 03 10:52:05 2018 -0400 +++ b/filter_assembly.xml Mon Sep 24 03:56:11 2018 -0400 @@ -112,14 +112,16 @@ **Input format** - (1) Sequences are in the sequential format: - >seqname1 - AAAGAGAGACCACATGTCAGTAGC -on one or several lines - - >seqname2 - AAGGCCTGACCACATGAGTTAAGC -on one or several lines - - ... +(1) Sequences are in the sequential format: - 2) The file name should begin with a two letter abbreviation of the species name (for isntance, 'Ap' if the species is Alviella pompejana). +| >seqname1 +| AAAGAGAGACCACATGTCAGTAGC -on one or several lines - +| >seqname2 +| AAGGCCTGACCACATGAGTTAAGC -on one or several lines - +| etc ... +| + +2) The file name should begin with a two letter abbreviation of the species name (for isntance, 'Ap' if the species is Alvinella pompejana). **For Velvet Oases assemblies input** @@ -127,7 +129,7 @@ **For Trinity assemblies inputs** - The headers must be as follow : >cj_gj_ij Len=j path=[j:0-j] where all the j are integers (locus number, transcript variant, length, position...) + The headers must be as follow : *>cj_gj_ij Len=j path=[j:0-j]* where all the j are integers (locus number, transcript variant, length, position...) **The tool handles the case if input files come from both assemblers (there is no need for input files to be exclusively from one or another assembler).** @@ -186,6 +188,4 @@ ]]> </help> - <expand macro="citations" /> - </tool>
