comparison ConcatPhyl.xml @ 0:6d930f037fea draft

planemo upload for repository https://github.com/abims-sbr/adaptsearch commit 38545eb765e0df7fcc6b8130e8e5f87cf4481122

0:6d930f037fea

<tool name="ConcatPhyl" id="concatphyl" version="1.0">

	<description>
		Concatenation and phylogeny
	</description>

	<macros>
		<import>macros.xml</import>
	</macros>

	<requirements>
		<expand macro="python_required" />
		<!-- <requirement type="package" version="1.3.1">samtools</requirement> -->
		<requirement type="package" version="8.2.9">raxml</requirement>
	</requirements>

  	<command><![CDATA[
		python $__tool_directory__/scripts/S01_concatenate.py ${zip}

		#if $format.format_run == "nucleic" :
			nucleic $format.zip_nuc
		#elif $format.format_run == "proteic" :
			proteic $format.zip_aa
		#end if
		> ${output};

		raxmlHPC 
		#if $format.format_run == "nucleic" :			
			-n "galaxy_run"
			##-q "./05_partitions_gene_NUC"
			-s "./03_Concatenation_nuc.phy"
			## (-m)
			-m $format.base_model
		#elif $format.format_run == "proteic" :
			-n "galaxy_run"
			##-q "./06_partitions_gene_AA"
 			-s "./02_Concatenation_aa.phy"
			## (-m)
			-m $format.base_model$format.aa_search_matrix
		#end if

		## --- Optional parameters ---

		##if $raxml_options.options == "yes" :

			## (-p)
			#if $random_seed:
	    		-p $random_seed
			#else
	    		-p 1234567890
			#end if

			## (-N/#)
	   	 	#if $number_of_runs:
	        		-N $number_of_runs
	   		#end if
			#if $number_of_runs_bootstop:
	    		-# $number_of_runs_bootstop
			#end if

			## (-f)
			#if $search_algorithm:
				-f $search_algorithm
			#end if

			## (-x)
			#if $rapid_bootstrap_random_seed:
			-x $rapid_bootstrap_random_seed
			#end if
		##else :

	 	##-N 100 -f a -x 12345

		##end if				
		>> ${output};
	]]>
  	</command>

 	<inputs>

		<param name="zip" type="data" format="no_unzip.zip,zip" label="Choose your ZIP file" help="Contains the files filter after the tool oase" />
		<conditional name="format">
			<param name="format_run" type="select" label="Which format do you want to use for this tool (concatenation and RAxML run) ? ">
				<option value="nucleic">Nucleic format</option>
				<option value="proteic">Proteic format</option>
			</param>

			<when value="nucleic">
				<param name="zip_nuc" type="data" format="no_unzip.zip,zip" label="Choose your ZIP file" help="It must contain the aligned files without indels in NUCLEIC format" />
				<!-- ## Nucleotide substitution models -->
		    	<param name="base_model" type="select" label="Substitution Model">
		        	<option value="GTRCAT">GTRCAT</option> 
		        	<option value="GTRCATI">GTRCATI</option> 
		        	<option value="GTRGAMMA" selected="true">GTRGAMMA</option>
		        	<option value="GTRGAMMAI">GTRGAMMAI</option>
		   		</param>
			</when>

			<when value="proteic">
				<param name="zip_aa" type="data" format="no_unzip.zip,zip" label="Choose your ZIP file" help="It must contain the aligned files without indels in PROTEIC format" />
				<!-- ## Aminoacid substitution models -->
				<!--<param name="aa_model_empirical_base_frequencies" type="boolean" checked="no" truevalue="F" falsevalue="X" display="checkboxes" label="Use empirical base frequencies in AA models." /> -->
		    	<param name="base_model" type="select" label="Substitution Model (-m)">
					<option value="PROTCAT" selected="true">PROTCAT</option>
					<option value="PROTCATI">PROTCATI</option>
					<option value="PROTGAMMA">PROTGAMMA</option>
			    	<option value="PROTGAMMAI">PROTGAMMAI</option>
		    	</param>
		    	<param name="aa_search_matrix" type="select" label="Matrix">
					<option value="DAYHOFF" selected="true">DAYHOFF</option>
					<option value="JTT">JTT</option>
					<option value="WAG">WAG</option>
					<option value="BLOSUM62">BLOSUM62</option>
			    </param>	
			</when>
		</conditional>

<!-- <conditional name="raxml_options"> -->

<!--
<param name="options" type="select" label="Raxml advanced options">
				<option value="yes">Yes</option>
				<option value="no" select="true">No</option>
</param>

-->

<!-- <when value="yes"> -->

		<param name="random_seed" type="integer" value="1234567890" size="12" label="Random seed used for the parsimony inferences" />

		<!-- ## (-N/#) -->
		<param name="number_of_runs" type="integer" size="8" value="100"
            label="Number of runs" help="Specify the number of
            alternative runs (-N|#) on distinct starting trees In combination
            with the '-b' option will invoke a multiple boostrap analysis.
            You can add the bootstopping criteria by choosing the autoMR,
            autoMRE, autoMRE_IGN, or autoFC value in a menu below instead of
            providing a number here. Bootstopping will only work in
            combination with '-x' or '-b'."
            optional="True" />
		<param name="number_of_runs_bootstop" type="select" label="Use bootstopping criteria for number of runs" optional="True">
	    	<option value="" selected="yes"></option>
	    	<option value="autoMR">autoMR</option>
	    	<option value="autoMRE">autoMRE</option>
	    	<option value="autoMRE_IGN">autoMRE_IGN</option>
	    	<option value="autoFC">autoFC</option>
		</param>

		<!-- ## (-f) -->
   		<param name="search_algorithm" type="select" label="Algorithm to execute" optional="True">
            <option value="a">Rapid bootstrap and best ML tree search (a)</option>
            <option value="A">Compute marginal ancestral states (A)</option>
            <option value="b">Draw bipartition information (b)</option>
            <option value="c">Check if the alignment can be read (c)</option>
            <option value="d" selected="true">Hill-climbing ML Search (d) (default)</option>
            <option value="e">Optimize GAMMA/GAMMAI model/branches (e)</option>
            <option value="g">Compute per-site log likelihoods for -z trees (g)</option>
            <option value="h">Compute log likelihood test for -t / -z trees (h)</option>
            <option value="j">Generate bootstrapped alignment files (j)</option>
            <option value="J">Compute SH-like support values for the -t tree (J)</option>
            <option value="m">Compare bipartitions between -t and -z trees (m)</option>
            <option value="n">Compute log likelihood score for -z trees (n)</option>
            <option value="o">Use old slower search algorithm (o)</option>
            <option value="p">Stepwise MP addition of new sequences (p)</option>
            <option value="q">Fast quartet calculator (q)</option>
            <option value="r">Compute pairwise RF distances in -z trees (r)</option>
            <option value="s">Split a multi-gene alignment (s)</option>
            <option value="S">Compute site-specific placement bias (S)</option>
            <option value="t">Randomized tree searches on a fixed starting tree (t)</option>
            <option value="T">Final optimization of a ML tree from a bootstrap (T)</option>
            <option value="u">Morphological weight calibration using ML on a -t tree (u)</option>
            <option value="v">Classify environmental sequences (v)</option>
            <option value="w">Compute ELW-test on -z trees (w)</option>
            <option value="x">Compute GAMMA model pair-wise ML distances on a tree (x)</option>
            <option value="y">Classify environmental sequences into a reference tree (y)</option>
        </param>

        <!-- ## (-q) -->
	  	<param name="multiple_model" format="txt" type="data" label="Multiple model assignment to alignment partitions" optional="True" help="Specify the file name which contains the assignment of models to alignment partitions for multiple models of substitution. For the syntax of this file please consult the manual." />

	 	<!-- ## (-x) -->
         <param name="rapid_bootstrap_random_seed" type="integer" value='1234567890' size="7" label="Rapid bootstrapping random seed" optional="True" help="Specify a random seed and turn on rapid bootstrapping. CAUTION: unlike in version 7.0.4 RAxML will conduct rapid BS replicates under the model of rate heterogeneity you specified via '-m' and not by default under CAT." />
<!-- </when> -->


<!-- </conditional> -->

		<param name="out" type="select" label="What format of file do you want for your output (concatenation of the sequences) ? ">
			<option value="nothing">No output</option>
			<option value="fasta">Fasta format</option>
			<option value="phylip">Phylip format</option> 
			<option value="nexus">Nexus format</option>
		</param>
          <!-- -m GTRGAMMA -N 100 -f a -x 12345 -->
		
		<param name="raxml1" type="boolean" label="Do you want the output of RAxML : best tree ? " />
		<param name="raxml3" type="boolean" label="Do you want the output of RAxML : bi-partition ? " />
		<param name="raxml4" type="boolean" label="Do you want the output of RAxML : bootstrap ? " help="Only if the option 'rapid bootsptrap' is chosen. When you don't want to choose your options, this output is accessible"/>

	</inputs>

	<outputs>
		<data name="output" format="txt" label="Phylogeny"/>

		<data name="out_fasta_aa" format="fasta" label="Phylogeny_concatenation_fasta_aa" from_work_dir="02_Concatenation_aa.fas">
			<filter>format['format_run'] == "proteic" and out == "fasta"</filter>
		</data>

		<data name="out_phylip_aa" format="phylip" label="Phylogeny_concatenation_phylip_aa" from_work_dir="02_Concatenation_aa.phy">
			<filter>format['format_run'] == "proteic" and out == "phylip"</filter>
		</data>

		<data name="out_nexus_aa" format="nexus" label="Phylogeny_concatenation_nexus_aa" from_work_dir="02_Concatenation_aa.nex">
			<filter>format['format_run'] == "proteic" and out == "nexus"</filter>
		</data>

		<data name="out_fasta_nuc" format="fasta" label="Phylogeny_concatenation_fasta_nuc" from_work_dir="03_Concatenation_nuc.fas">
			<filter>format['format_run'] == "nucleic" and out == "fasta"</filter>
		</data>

		<data name="out_phylip_nuc" format="phylip" label="Phylogeny_concatenation_phylip_nuc" from_work_dir="03_Concatenation_nuc.phy">
			<filter>format['format_run'] == "nucleic" and out == "phylip"</filter>
		</data>

		<data name="out_nexus_nuc" format="nexus" label="Phylogeny_concatenation_nexus_nuc" from_work_dir="03_Concatenation_nuc.nex">
			<filter>format['format_run'] == "nucleic" and out == "nexus"</filter>
		</data>

		<data name="out_raxml1" format="txt" label="Phylogeny_RAxML_BestTree" from_work_dir="RAxML_bestTree.galaxy_run">
			<filter>raxml1 == True</filter>
		</data>
	
		<data name="out_raxml3" format="txt" label="Phylogeny_RAxML_BiPartition" from_work_dir="RAxML_bipartitions.galaxy_run">
			<filter>raxml3 == True</filter>
		</data>
		
		<data name="out_raxml4" format="txt" label="Phylogeny_RAxML_BootStrap" from_work_dir="RAxML_bootstrap.galaxy_run">
			<filter>raxml4 == True</filter>
		</data>
	</outputs>

	<tests>
		<test>
			<param name="zip" ftype="zip" value="from_filter_oase.zip" />
			<conditional name="format">
				<param name="format_run" value="nucleic" />
				<param name="zip_nuc" ftype="zip" value="test_05_output_CDS_Search_input_ConcatPhyl.zip" />
				<param name="base_model" value="GTRGAMMA" />
			</conditional>
			<param name="random_seed" value="1234567890" />
			<param name="number_of_runs" value="100" />
			<param name="number_of_runs_bootstop" value="" />
			<param name="search_algorithm" value="d" />
			<!-- <param name="multiple_model" value="" /> -->
			<param name="rapid_bootstrap_random_seed" value="123456789" />	
			<param name="out" value="nothing" />			
			<param name="raxml1" value="True" />
			<param name="raxml3" value="True" />
			<param name="raxml4" value="True" />			
			<output name="out_raxml4">
				<assert_contents>					
					<has_text text="(Ap,(((Pf,Ph),Pg),((Pu,Te),(Am,Th))),Ac);"/>
					<has_text text="(Ap,(Ph,(Pg,((Pf,(Pu,Te)),(Am,Th)))),Ac);"/>
					<has_text text="(Ap,(((Pu,Te),(Am,Th)),((Pf,Ph),Pg)),Ac);"/>
				</assert_contents>
			</output>				
			
		</test>
	</tests>

	<help>

============
What it does
============

| This tool takes a zip file containing nucleic fasta sequence files and searches different homologous genes from pairwise comparisons. 
| 
|
| The run RAxML was written by **Alexandros Stamatakis**.
| The script was written by **Eric Fontanillas**.
| The wrapper was written by **Julie Baffard**.

--------

==========
Parameters
==========

| The choice of the format sequences is possible : **proteic** or **nucleic**
| 

The choice of parameters for the RAxML run is possible : 

**-m** :
	| is the option for the choice of the substitution model. 
	| By default it's GTRGAMMA.
	| 

**-N** :
	| is the option for the choice of the number of run
	| by default it's 100
	| 

**rapid bootstrapping** :
	| is the option to have, in addition to the best tree search, the rapid bootstrapping
	| this translates by : -x 12345 -f a
	| by default, this option is choosen
	| 

--------

======
Inputs
======

option **Select a zip file containing the input files** :

| the input zip file must have the extension .ort.zip
| At the beginning, when you upload your input, you have to change the extension .zip to .ort.zip


--------

=======
Outputs
=======

This tool, produces the following files :

**Phylogeny** :
	| is the general output. It gives the information about the concatenation (statistics) and the RAxML run.
	| 

**Phylogeny_concatenation_fasta_aa** :
	| is the output which contains the sequences concatenated in fasta format when you choose the option proteic
	| 

**Phylogeny_concatenation_phylip_aa** :
	| is the output which contains the sequences concatenated in phylip format when you choose the option proteic
	| 

**Phylogeny_concatenation_nexus_aa** :
	| is the output which contains the sequences concatenated in nexus format when you choose the option proteic
	| 

**Phylogeny_concatenation_fasta_nuc** :
	| is the output which contains the sequences concatenated in fasta format when you choose the option nucleic
	| 

**Phylogeny_concatenation_phylip_nuc** :
	| is the output which contains the sequences concatenated in phylip format when you choose the option nucleic
	| it's this output which is used for the RAxML run
	| 

**Phylogeny_concatenation_nexus_nuc** :
	| is the output which contains the sequences concatenated in nexus format when you choose the option nucleic
	| 

**Phylogeny_RAxML_BestTree** :
	| is the output of RAxML run which contains the Best Tree found
	| 

**Phylogeny_RAxML_BiPartitionBranchLabel** :
	| is the output of RAxML run which contains the Best Tree found with supported values as branch labels
	| 

**Phylogeny_RAxML_BiPartition** :
	| is the output of RAxML run which contains the Best Tree found with supported values
	| 

**Phylogeny_RAxML_BootStrap** :
	| is the output of RAxML run which contains all the boostrapped trees
	| the number of boostraped trees depending of the option -N (number of run)
	| 

--------

===============
Working Example
===============

---------------------------
The input files and options
---------------------------

**Input files**
	| 6 files with 200 nucleic sequences each
	| a zip file containing 2 locus aligned without indel (in nucleic format)
	| 
**Parameters**
	| option : nucleic
	| no option for the RAxML run, so by default it's : -m GTRGAMMA -N 100 -f a -x 12345
	| 

----------------
The output files
----------------

**Phylogeny** :

| ******************** CONCATENATION ********************
| 
| Process nucleotides concatenation:
| Number of taxa aligned = 6
| Number of loci concatenated = 2
| 
| Total length of the concatenated sequences [All codon positions] = 504
| Total length of the concatenated sequences [Codon positions 1 and 2] = 336
| Total length of the concatenated sequences [Codon position 3] = 168
| 
| 
| 
| ******************** RAxML RUN ********************
| 

the informations of the RAxML run

| 
 
**Phylogeny_concatenation_fasta_nuc** :

| &gt;Ps

cgcagttcctcggtgaggcgttgtagttcggcgttcagacggtcagctctctcctcggctgccctgcgagcattcagtgcctcatccatgtcagcttgcatggcggcaatgtctccctccatacggcgcttatctccagtcaaagtggtcacggtgatgttcagctcgttaacacgggatacagcatcgtgcagttcgttttcggcattcttacgagctctctcagatgtctcca
gaagagatcgaacgtcctccagctccgtttgtagagcgatcctcttcctctcgagtacggtaaccgccgaacgggcttcctcagcactacggcgctcctcctcaatggcaatctccagctccttgaccttggcactgagtcccttgttggccttagatagttcgttgtttgccctcaatgtctcgaccataatccttaacaacaacacactacagccaacaaccttccttgctt
taccctctttgtctatcttgcataatccagcccat

| Ac

cgcagttcctcggtgacgcggtgcagctcggcggcgaggcggtctgccctctcctcggccgccctgcgggcgttcagggcctcgtccagatcggcctgcatggcggcgatgtcgccctccatgcggcgcttgtcgccagtcagcgtcgtcaccgtgatgttcagctcgttgacgcgagccgtggcgtcgtgcaactcgttctcggcattcttacgagctcgttcggc
ggtctccagtagagatctaacatcctccagctctgtttgcaatgcaatcctcttcctctcgagtacagttacagcggaacgggcttcctcagcactgcggtgctcctcctcaatggcaatttccagctccttgaccttggcactaagtcccttgttggccttggacagctcgttgttggctctaagtgtctccacc---------------------------------------------------------
------------------------

| &gt;Pp
| ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
| ------------------------------------------------------------------------------------------------ataatccttgacgaccacacactgcatccaacaacttttctggccttgccttccttgtctattttacacaaaccagcccat

| &gt;Ap

cgcagctcctcggtgacgcggtgcagctcggcggcgaggcgatcggctctctcctcggctgccctgcgggcgttcagggcctcatcaaggtcggcctgcatggcggcgatgtcgccctccatgcggcgcttgtcgccggtcagagtcgtcaccgtgatgttcagctcgttgacgcgagccgtggcgtcgtgtagctcgttctcggcattcttacgagctcgttcggc
ggtctccagtagggatctaacatcctccagctccgtttgcaatgcaatcctcttcctctcgagtacagttacagcggaacgggcttcctcagcactgcggcgctcctcctcaatggcaatttccagctccttgaccttcgcactaagtcccttgttggccttggacagttcgttgttggctctaagtgtctccactataatccttaacaacaacacactgcaaccaacaacctt
ccgggccttgccttccttgtctatcttgcaaagaccagcccat

| &gt;Pf

ctgagctcctcggtgaggcgctggagctcggagttcaggcggtcggctcgttcctcggcggcgcggcgagcgttcagcgcctcgtccatgtcggcctgcatggcggcgatgtccgcttccatgcggcgcttgtcgcccgtcagagtggtgaccgtgatgttcagctcgttgacacgggccacggcgtcgtgcagctcgttctcggcgttcttgcgagctctctccga
cgtctccagaagagatcggacgtcctcgagttccgtctgcagggcgatcctcttcctctcgagcacggtaacagcagaacgggcttcctcggcgctacggcgctcttcctcgatggcgatctccagttccttgacctttgcactgagtcccttgttggccttggatagttcgttgttagccctcagtgtctccaccataatccttaacaacaacacactacagccgacaac
cttccttgctttcccttctttgtcaatcttgcataatccggcccat

| &gt;Pg

cgcagctcctcggtgagacgctgcagttcggaattcaggcggtccgccctctcttcggcagccctgcgggcgttcagcgcctcgtccatgtcggcctgcatggcggcgatgtcgccctccatgcggcgcttgtcgccggtcagcgtggtcacggtgatgttcagctcgttgacgcgagaaacggcgtcgtgcatctcgttttcggcattcttgcgagctctctccgacg
tctcaagaagggatcgtacatcctcgagttctgtctggagggcgatcctctttctctcaagcatggtaaccgcggagcgggcttcctcgccactgcggcgttcttcctcgatggtgatctccagttccttaaccttagtactcagtcccttgttggctttggacagttcgttgttcgctcttagtgtctccactataatccttaaccacaacacactacaaccaacaacctttcttgc
cttgccttccttgtctatcttacacaagccagcccat

.. class:: infomark

| If you choose the option proteic : you obtain a file with proteic sequences
| 
| 


**Phylogeny_concatenation_phylip_nuc** :

|    6 504
| Ps

cgcagttcctcggtgaggcgttgtagttcggcgttcagacggtcagctctctcctcggctgccctgcgagcattcagtgcctcatccatgtcagcttgcatggcggcaatgtctccctccatacggcgcttatctccagtcaaagtggtcacggtgatgttcagctcgttaacacgggatacagcatcgtgcagttcgttttcggcattcttacgagctctctcagatgtctcca
gaagagatcgaacgtcctccagctccgtttgtagagcgatcctcttcctctcgagtacggtaaccgccgaacgggcttcctcagcactacggcgctcctcctcaatggcaatctccagctccttgaccttggcactgagtcccttgttggccttagatagttcgttgtttgccctcaatgtctcgaccataatccttaacaacaacacactacagccaacaaccttccttgctt
taccctctttgtctatcttgcataatccagcccat

| Ac

cgcagttcctcggtgacgcggtgcagctcggcggcgaggcggtctgccctctcctcggccgccctgcgggcgttcagggcctcgtccagatcggcctgcatggcggcgatgtcgccctccatgcggcgcttgtcgccagtcagcgtcgtcaccgtgatgttcagctcgttgacgcgagccgtggcgtcgtgcaactcgttctcggcattcttacgagctcgttcggc
ggtctccagtagagatctaacatcctccagctctgtttgcaatgcaatcctcttcctctcgagtacagttacagcggaacgggcttcctcagcactgcggtgctcctcctcaatggcaatttccagctccttgaccttggcactaagtcccttgttggccttggacagctcgttgttggctctaagtgtctccacc---------------------------------------------------------
------------------------

| Pp
| ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
| ------------------------------------------------------------------------------------------------ataatccttgacgaccacacactgcatccaacaacttttctggccttgccttccttgtctattttacacaaaccagcccat
| 
| Ap

cgcagctcctcggtgacgcggtgcagctcggcggcgaggcgatcggctctctcctcggctgccctgcgggcgttcagggcctcatcaaggtcggcctgcatggcggcgatgtcgccctccatgcggcgcttgtcgccggtcagagtcgtcaccgtgatgttcagctcgttgacgcgagccgtggcgtcgtgtagctcgttctcggcattcttacgagctcgttcggc
ggtctccagtagggatctaacatcctccagctccgtttgcaatgcaatcctcttcctctcgagtacagttacagcggaacgggcttcctcagcactgcggcgctcctcctcaatggcaatttccagctccttgaccttcgcactaagtcccttgttggccttggacagttcgttgttggctctaagtgtctccactataatccttaacaacaacacactgcaaccaacaacctt
ccgggccttgccttccttgtctatcttgcaaagaccagcccat

Pf
ctgagctcctcggtgaggcgctggagctcggagttcaggcggtcggctcgttcctcggcggcgcggcgagcgttcagcgcctcgtccatgtcggcctgcatggcggcgatgtccgcttccatgcggcgcttgtcgcccgtcagagtggtgaccgtgatgttcagctcgttgacacgggccacggcgtcgtgcagctcgttctcggcgttcttgcgagctctctccga
cgtctccagaagagatcggacgtcctcgagttccgtctgcagggcgatcctcttcctctcgagcacggtaacagcagaacgggcttcctcggcgctacggcgctcttcctcgatggcgatctccagttccttgacctttgcactgagtcccttgttggccttggatagttcgttgttagccctcagtgtctccaccataatccttaacaacaacacactacagccgacaac
cttccttgctttcccttctttgtcaatcttgcataatccggcccat

Pg
cgcagctcctcggtgagacgctgcagttcggaattcaggcggtccgccctctcttcggcagccctgcgggcgttcagcgcctcgtccatgtcggcctgcatggcggcgatgtcgccctccatgcggcgcttgtcgccggtcagcgtggtcacggtgatgttcagctcgttgacgcgagaaacggcgtcgtgcatctcgttttcggcattcttgcgagctctctccgacg
tctcaagaagggatcgtacatcctcgagttctgtctggagggcgatcctctttctctcaagcatggtaaccgcggagcgggcttcctcgccactgcggcgttcttcctcgatggtgatctccagttccttaaccttagtactcagtcccttgttggctttggacagttcgttgttcgctcttagtgtctccactataatccttaaccacaacacactacaaccaacaacctttcttgc
cttgccttccttgtctatcttacacaagccagcccat

.. class:: infomark

| If you choose the option proteic : you obtain a file with proteic sequences
| 
| 

**Phylogeny_concatenation_nexus_nuc** :

#NEXUS

| Begin data;
| Dimensions ntax=6 nchar=504;
| Format datatype=dna gap=-;

Matrix

Ps      cgcagttcctcggtgaggcgttgtagttcggcgttcagacggtcagctctctcctcggctgccctgcgagcattcagtgcctcatccatgtcagcttgcatggcggcaatgtctccctccatacggcgcttatctccagtcaaagtggtcacggtgatgttcagctcgttaacacgggatacagcatcgtgcagttcgttttcggcattcttacgagctctctcagatgtct
ccagaagagatcgaacgtcctccagctccgtttgtagagcgatcctcttcctctcgagtacggtaaccgccgaacgggcttcctcagcactacggcgctcctcctcaatggcaatctccagctccttgaccttggcactgagtcccttgttggccttagatagttcgttgtttgccctcaatgtctcgaccataatccttaacaacaacacactacagccaacaaccttcct
tgctttaccctctttgtctatcttgcataatccagcccat

Ac      cgcagttcctcggtgacgcggtgcagctcggcggcgaggcggtctgccctctcctcggccgccctgcgggcgttcagggcctcgtccagatcggcctgcatggcggcgatgtcgccctccatgcggcgcttgtcgccagtcagcgtcgtcaccgtgatgttcagctcgttgacgcgagccgtggcgtcgtgcaactcgttctcggcattcttacgagctcgttc
ggcggtctccagtagagatctaacatcctccagctctgtttgcaatgcaatcctcttcctctcgagtacagttacagcggaacgggcttcctcagcactgcggtgctcctcctcaatggcaatttccagctccttgaccttggcactaagtcccttgttggccttggacagctcgttgttggctctaagtgtctccacc---------------------------------------------------
------------------------------

Pp      ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
-----------------------------------------------------------------------------------------------------ataatccttgacgaccacacactgcatccaacaacttttctggccttgccttccttgtctattttacacaaaccagcccat

Ap      cgcagctcctcggtgacgcggtgcagctcggcggcgaggcgatcggctctctcctcggctgccctgcgggcgttcagggcctcatcaaggtcggcctgcatggcggcgatgtcgccctccatgcggcgcttgtcgccggtcagagtcgtcaccgtgatgttcagctcgttgacgcgagccgtggcgtcgtgtagctcgttctcggcattcttacgagctcgttc
ggcggtctccagtagggatctaacatcctccagctccgtttgcaatgcaatcctcttcctctcgagtacagttacagcggaacgggcttcctcagcactgcggcgctcctcctcaatggcaatttccagctccttgaccttcgcactaagtcccttgttggccttggacagttcgttgttggctctaagtgtctccactataatccttaacaacaacacactgcaaccaacaa
ccttccgggccttgccttccttgtctatcttgcaaagaccagcccat

Pf      ctgagctcctcggtgaggcgctggagctcggagttcaggcggtcggctcgttcctcggcggcgcggcgagcgttcagcgcctcgtccatgtcggcctgcatggcggcgatgtccgcttccatgcggcgcttgtcgcccgtcagagtggtgaccgtgatgttcagctcgttgacacgggccacggcgtcgtgcagctcgttctcggcgttcttgcgagctctctcc
gacgtctccagaagagatcggacgtcctcgagttccgtctgcagggcgatcctcttcctctcgagcacggtaacagcagaacgggcttcctcggcgctacggcgctcttcctcgatggcgatctccagttccttgacctttgcactgagtcccttgttggccttggatagttcgttgttagccctcagtgtctccaccataatccttaacaacaacacactacagccgaca
accttccttgctttcccttctttgtcaatcttgcataatccggcccat

Pg      cgcagctcctcggtgagacgctgcagttcggaattcaggcggtccgccctctcttcggcagccctgcgggcgttcagcgcctcgtccatgtcggcctgcatggcggcgatgtcgccctccatgcggcgcttgtcgccggtcagcgtggtcacggtgatgttcagctcgttgacgcgagaaacggcgtcgtgcatctcgttttcggcattcttgcgagctctctccg
acgtctcaagaagggatcgtacatcctcgagttctgtctggagggcgatcctctttctctcaagcatggtaaccgcggagcgggcttcctcgccactgcggcgttcttcctcgatggtgatctccagttccttaaccttagtactcagtcccttgttggctttggacagttcgttgttcgctcttagtgtctccactataatccttaaccacaacacactacaaccaacaacctttc
ttgccttgccttccttgtctatcttacacaagccagcccat

| 	;
| End;
| 

.. class:: infomark

| If you choose the option proteic : you obtain a file with proteic sequences
| 
| 

**Phylogeny_RAxML_BestTree** :

| ((Ac:0.02889451913999640381,Ap:0.01674414484251282934):0.17730049470177636217,
| ((Pp:0.23405795780876006984,Pg:0.02012322210145659623):0.14429203507314311561,Pf:0.09977363663005259231):0.04320803212100913365,Ps:0.08351583721596630983):0.0;
| 
| 


**Phylogeny_RAxML_BiPartitionBranchLabel** :

| (Pg:0.02012322210145659623,(Pf:0.09977363663005259231,(Ps:0.08351583721596630983,
| (Ac:0.02889451913999640381,Ap:0.01674414484251282934):0.17730049470177636217[89]):0.04320803212100913365[42]):0.14429203507314311561[70],Pp:0.23405795780876006984);
| 
| 


**Phylogeny_RAxML_BiPartition** :

(Pg:0.02012322210145659623,(Pf:0.09977363663005259231,(Ps:0.08351583721596630983,
(Ac:0.02889451913999640381,Ap:0.01674414484251282934)89:0.17730049470177636217)42:0.04320803212100913365)70:0.14429203507314311561,Pp:0.23405795780876006984);

| 
| 

**Phylogeny_RAxML_BootStrap** :

| ((Ap,Ac),((Pp,Pg),Pf),Ps);
| ((Ap,Ac),((Pp,Pg),Pf),Ps);
| (Pf,((Ap,Ac),(Pp,Pg)),Ps);
| ((Ap,Ac),((Pp,Pg),Pf),Ps);
| ((Ap,Ac),((Pp,Pg),Pf),Ps);
| ((Ap,Ac),((Pp,Pg),Pf),Ps);
| ((Pp,Pg),(Pf,(Ap,Ac)),Ps);

...

	</help>

	<expand macro="citations" />

</tool>