Mercurial > repos > abims-sbr > concatphyl

comparison ConcatPhyl.xml @ 2:1f8d039bd241 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/abims-sbr/adaptsearch commit 44a89d5eeb82789bfc643b33c11f391281b6374b
author abims-sbr
date Wed, 27 Sep 2017 10:03:45 -0400
parents 6d930f037fea
children 0464ec48bc3a
comparison
equal deleted inserted replaced
1:f181bd945a6c 2:1f8d039bd241
1 <tool name="ConcatPhyl" id="concatphyl" version="1.0"> 1 <tool name="ConcatPhyl" id="concatphyl" version="2.0">
2 2
3 <description> 3 <description>
4 Concatenation and phylogeny 4 Concatenation and phylogeny
5 </description> 5 </description>
6 6
8 <import>macros.xml</import> 8 <import>macros.xml</import>
9 </macros> 9 </macros>
10 10
11 <requirements> 11 <requirements>
12 <expand macro="python_required" /> 12 <expand macro="python_required" />
13 <!-- <requirement type="package" version="1.3.1">samtools</requirement> -->
14 <requirement type="package" version="8.2.9">raxml</requirement> 13 <requirement type="package" version="8.2.9">raxml</requirement>
15 </requirements> 14 </requirements>
16 15
17 <command><![CDATA[ 16 <command><![CDATA[
18 python $__tool_directory__/scripts/S01_concatenate.py ${zip} 17 #set $infiles_filter_assemblies = ""
19 18 #for $input_filter_assemblie in $input_filter_assemblies
20 #if $format.format_run == "nucleic" : 19 ln -s '$input_filter_assemblie' '$input_filter_assemblie.element_identifier';
21 nucleic $format.zip_nuc 20 #set $infiles_filter_assemblies = $infiles_filter_assemblies + $input_filter_assemblie.element_identifier + ","
22 #elif $format.format_run == "proteic" : 21 #end for
23 proteic $format.zip_aa 22 #set $infiles_filter_assemblies = $infiles_filter_assemblies[:-1]
24 #end if 23
25 > ${output}; 24 #set $infiles_alignments = ""
26 25 #for $input_alignment in $input_alignments
27 raxmlHPC 26 ln -s '$input_alignment' '$input_alignment.element_identifier';
28 #if $format.format_run == "nucleic" : 27 #set $infiles_alignments = $infiles_alignments + $input_alignment.element_identifier + ","
29 -n "galaxy_run" 28 #end for
30 ##-q "./05_partitions_gene_NUC" 29 #set $infiles_alignments = $infiles_alignments[:-1]
31 -s "./03_Concatenation_nuc.phy" 30
32 ## (-m) 31 python $__tool_directory__/scripts/S01_concatenate.py
33 -m $format.base_model 32
34 #elif $format.format_run == "proteic" : 33 $infiles_filter_assemblies
35 -n "galaxy_run" 34
36 ##-q "./06_partitions_gene_AA" 35 #if $format.format_run == "nucleic" :
37 -s "./02_Concatenation_aa.phy" 36 nucleic
38 ## (-m) 37 #elif $format.format_run == "proteic" :
39 -m $format.base_model$format.aa_search_matrix 38 proteic
40 #end if 39 #end if
41 40
42 ## --- Optional parameters --- 41 $infiles_alignments
43 42 > ${output};
44 ##if $raxml_options.options == "yes" : 43
45 44 raxmlHPC -n galaxy_run
46 ## (-p) 45 #if $format.format_run == "nucleic" :
47 #if $random_seed: 46 ##-q 05_partitions_gene_NUC
48 -p $random_seed 47 -s "03_Concatenation_nuc.phy"
49 #else 48 -m $format.base_model
50 -p 1234567890 49 #elif $format.format_run == "proteic" :
51 #end if 50 ##-q 06_partitions_gene_AA
52 51 -s 02_Concatenation_aa.phy
53 ## (-N/#) 52 -m $format.base_model$format.aa_search_matrix
54 #if $number_of_runs: 53 #end if
55 -N $number_of_runs 54
56 #end if 55 -p $random_seed
57 #if $number_of_runs_bootstop: 56
58 -# $number_of_runs_bootstop 57 #if $number_of_runs !="" and $number_of_runs_bootstop =="":
59 #end if 58 -N $number_of_runs
60 59 -x $rapid_bootstrap_random_seed
61 ## (-f) 60 #elif ($number_of_runs !="" and $number_of_runs_bootstop !="") or ($number_of_runs =="" and $number_of_runs_bootstop !=""):
62 #if $search_algorithm: 61 -N $number_of_runs_bootstop
63 -f $search_algorithm 62 -x $rapid_bootstrap_random_seed
64 #end if 63 #end if
65 64
66 ## (-x) 65 -f $search_algorithm
67 #if $rapid_bootstrap_random_seed: 66
68 -x $rapid_bootstrap_random_seed 67 >> ${output};
69 #end if 68 ]]>
70 ##else :
71
72 ##-N 100 -f a -x 12345
73
74 ##end if
75 >> ${output};
76 ]]>
77 </command> 69 </command>
78 70
79 <inputs> 71 <inputs>
80 72
81 <param name="zip" type="data" format="no_unzip.zip,zip" label="Choose your ZIP file" help="Contains the files filter after the tool oase" /> 73 <param name="input_filter_assemblies" type="data" format="fasta" multiple="true" label="Files from Filter assemblies" />
74 <param name="input_alignments" type="data" format="fasta" multiple="true" label="Aligned files without indels" help="nucleic or proteic format according to the analysis you want to do below"/>
75
82 <conditional name="format"> 76 <conditional name="format">
83 <param name="format_run" type="select" label="Which format do you want to use for this tool (concatenation and RAxML run) ? "> 77 <param name="format_run" type="select" label="Which format do you want to use for this tool (concatenation and RAxML run) ? ">
84 <option value="nucleic">Nucleic format</option> 78 <option value="nucleic">Nucleic format</option>
85 <option value="proteic">Proteic format</option> 79 <option value="proteic">Proteic format</option>
86 </param> 80 </param>
87 81
88 <when value="nucleic"> 82 <when value="nucleic">
89 <param name="zip_nuc" type="data" format="no_unzip.zip,zip" label="Choose your ZIP file" help="It must contain the aligned files without indels in NUCLEIC format" />
90 <!-- ## Nucleotide substitution models -->
91 <param name="base_model" type="select" label="Substitution Model"> 83 <param name="base_model" type="select" label="Substitution Model">
92 <option value="GTRCAT">GTRCAT</option> 84 <option value="GTRCAT">GTRCAT</option>
93 <option value="GTRCATI">GTRCATI</option> 85 <option value="GTRCATI">GTRCATI</option>
94 <option value="GTRGAMMA" selected="true">GTRGAMMA</option> 86 <option value="GTRGAMMA" selected="true">GTRGAMMA</option>
95 <option value="GTRGAMMAI">GTRGAMMAI</option> 87 <option value="GTRGAMMAI">GTRGAMMAI</option>
96 </param> 88 </param>
97 </when> 89 </when>
98 90
99 <when value="proteic"> 91 <when value="proteic">
100 <param name="zip_aa" type="data" format="no_unzip.zip,zip" label="Choose your ZIP file" help="It must contain the aligned files without indels in PROTEIC format" />
101 <!-- ## Aminoacid substitution models -->
102 <!--<param name="aa_model_empirical_base_frequencies" type="boolean" checked="no" truevalue="F" falsevalue="X" display="checkboxes" label="Use empirical base frequencies in AA models." /> -->
103 <param name="base_model" type="select" label="Substitution Model (-m)"> 92 <param name="base_model" type="select" label="Substitution Model (-m)">
104 <option value="PROTCAT" selected="true">PROTCAT</option> 93 <option value="PROTCAT" selected="true">PROTCAT</option>
105 <option value="PROTCATI">PROTCATI</option> 94 <option value="PROTCATI">PROTCATI</option>
106 <option value="PROTGAMMA">PROTGAMMA</option> 95 <option value="PROTGAMMA">PROTGAMMA</option>
107 <option value="PROTGAMMAI">PROTGAMMAI</option> 96 <option value="PROTGAMMAI">PROTGAMMAI</option>
109 <param name="aa_search_matrix" type="select" label="Matrix"> 98 <param name="aa_search_matrix" type="select" label="Matrix">
110 <option value="DAYHOFF" selected="true">DAYHOFF</option> 99 <option value="DAYHOFF" selected="true">DAYHOFF</option>
111 <option value="JTT">JTT</option> 100 <option value="JTT">JTT</option>
112 <option value="WAG">WAG</option> 101 <option value="WAG">WAG</option>
113 <option value="BLOSUM62">BLOSUM62</option> 102 <option value="BLOSUM62">BLOSUM62</option>
114 </param> 103 </param>
115 </when> 104 </when>
116 </conditional> 105 </conditional>
117
118 <!-- <conditional name="raxml_options"> -->
119
120 <!--
121 <param name="options" type="select" label="Raxml advanced options">
122 <option value="yes">Yes</option>
123 <option value="no" select="true">No</option>
124 </param>
125
126 -->
127
128 <!-- <when value="yes"> -->
129 106
130 <param name="random_seed" type="integer" value="1234567890" size="12" label="Random seed used for the parsimony inferences" /> 107 <param name="random_seed" type="integer" value="1234567890" size="12" label="Random seed used for the parsimony inferences" />
131 108
132 <!-- ## (-N/#) --> 109 <!-- ## (-N/#) -->
133 <param name="number_of_runs" type="integer" size="8" value="100" 110 <param name="number_of_runs" type="integer" size="8" value="100"
147 <option value="autoFC">autoFC</option> 124 <option value="autoFC">autoFC</option>
148 </param> 125 </param>
149 126
150 <!-- ## (-f) --> 127 <!-- ## (-f) -->
151 <param name="search_algorithm" type="select" label="Algorithm to execute" optional="True"> 128 <param name="search_algorithm" type="select" label="Algorithm to execute" optional="True">
152 <option value="a">Rapid bootstrap and best ML tree search (a)</option> 129 <option value="a" selected="true">Rapid bootstrap and best ML tree search (a)</option>
153 <option value="A">Compute marginal ancestral states (A)</option> 130 <option value="A">Compute marginal ancestral states (A)</option>
154 <option value="b">Draw bipartition information (b)</option> 131 <option value="b">Draw bipartition information (b)</option>
155 <option value="c">Check if the alignment can be read (c)</option> 132 <option value="c">Check if the alignment can be read (c)</option>
156 <option value="d" selected="true">Hill-climbing ML Search (d) (default)</option> 133 <option value="d">Hill-climbing ML Search (d) (default)</option>
157 <option value="e">Optimize GAMMA/GAMMAI model/branches (e)</option> 134 <option value="e">Optimize GAMMA/GAMMAI model/branches (e)</option>
158 <option value="g">Compute per-site log likelihoods for -z trees (g)</option> 135 <option value="g">Compute per-site log likelihoods for -z trees (g)</option>
159 <option value="h">Compute log likelihood test for -t / -z trees (h)</option> 136 <option value="h">Compute log likelihood test for -t / -z trees (h)</option>
160 <option value="j">Generate bootstrapped alignment files (j)</option> 137 <option value="j">Generate bootstrapped alignment files (j)</option>
161 <option value="J">Compute SH-like support values for the -t tree (J)</option> 138 <option value="J">Compute SH-like support values for the -t tree (J)</option>
178 155
179 <!-- ## (-q) --> 156 <!-- ## (-q) -->
180 <param name="multiple_model" format="txt" type="data" label="Multiple model assignment to alignment partitions" optional="True" help="Specify the file name which contains the assignment of models to alignment partitions for multiple models of substitution. For the syntax of this file please consult the manual." /> 157 <param name="multiple_model" format="txt" type="data" label="Multiple model assignment to alignment partitions" optional="True" help="Specify the file name which contains the assignment of models to alignment partitions for multiple models of substitution. For the syntax of this file please consult the manual." />
181 158
182 <!-- ## (-x) --> 159 <!-- ## (-x) -->
183 <param name="rapid_bootstrap_random_seed" type="integer" value='1234567890' size="7" label="Rapid bootstrapping random seed" optional="True" help="Specify a random seed and turn on rapid bootstrapping. CAUTION: unlike in version 7.0.4 RAxML will conduct rapid BS replicates under the model of rate heterogeneity you specified via '-m' and not by default under CAT." /> 160 <param name="rapid_bootstrap_random_seed" type="integer" value='12345' size="7" label="Rapid bootstrapping random seed" optional="True" help="Specify a random seed and turn on rapid bootstrapping. CAUTION: unlike in version 7.0.4 RAxML will conduct rapid BS replicates under the model of rate heterogeneity you specified via '-m' and not by default under CAT." />
184 <!-- </when> -->
185
186
187 <!-- </conditional> -->
188 161
189 <param name="out" type="select" label="What format of file do you want for your output (concatenation of the sequences) ? "> 162 <param name="out" type="select" label="What format of file do you want for your output (concatenation of the sequences) ? ">
190 <option value="nothing">No output</option> 163 <option value="nothing">No output</option>
191 <option value="fasta">Fasta format</option> 164 <option value="fasta">Fasta format</option>
192 <option value="phylip">Phylip format</option> 165 <option value="phylip">Phylip format</option>
193 <option value="nexus">Nexus format</option> 166 <option value="nexus">Nexus format</option>
194 </param> 167 </param>
195 <!-- -m GTRGAMMA -N 100 -f a -x 12345 -->
196 168
197 <param name="raxml1" type="boolean" label="Do you want the output of RAxML : best tree ? " /> 169 <param name="raxml1" type="boolean" label="Do you want the output of RAxML : best tree ? " />
198 <param name="raxml3" type="boolean" label="Do you want the output of RAxML : bi-partition ? " /> 170 <param name="raxml3" type="boolean" label="Do you want the output of RAxML : bi-partition ? " />
199 <param name="raxml4" type="boolean" label="Do you want the output of RAxML : bootstrap ? " help="Only if the option 'rapid bootsptrap' is chosen. When you don't want to choose your options, this output is accessible"/> 171 <param name="raxml4" type="boolean" label="Do you want the output of RAxML : bootstrap ? " help="Only if the option 'rapid bootsptrap' is chosen. When you don't want to choose your options, this output is accessible"/>
200 172
228 </data> 200 </data>
229 201
230 <data name="out_raxml1" format="txt" label="Phylogeny_RAxML_BestTree" from_work_dir="RAxML_bestTree.galaxy_run"> 202 <data name="out_raxml1" format="txt" label="Phylogeny_RAxML_BestTree" from_work_dir="RAxML_bestTree.galaxy_run">
231 <filter>raxml1 == True</filter> 203 <filter>raxml1 == True</filter>
232 </data> 204 </data>
233 205
234 <data name="out_raxml3" format="txt" label="Phylogeny_RAxML_BiPartition" from_work_dir="RAxML_bipartitions.galaxy_run"> 206 <data name="out_raxml3" format="txt" label="Phylogeny_RAxML_BiPartition" from_work_dir="RAxML_bipartitions.galaxy_run">
235 <filter>raxml3 == True</filter> 207 <filter>raxml3 == True</filter>
236 </data> 208 </data>
237 209
238 <data name="out_raxml4" format="txt" label="Phylogeny_RAxML_BootStrap" from_work_dir="RAxML_bootstrap.galaxy_run"> 210 <data name="out_raxml4" format="txt" label="Phylogeny_RAxML_BootStrap" from_work_dir="RAxML_bootstrap.galaxy_run">
239 <filter>raxml4 == True</filter> 211 <filter>raxml4 == True</filter>
240 </data> 212 </data>
241 </outputs> 213 </outputs>
242 214
243 <tests> 215 <tests>
244 <test> 216 <test>
245 <param name="zip" ftype="zip" value="from_filter_oase.zip" /> 217 <param name="input_filter_assemblies" ftype="fasta" value="input_filter_assemblies/AcAcaud_trinity.fasta,input_filter_assemblies/AmAmphi_trinity.fasta,input_filter_assemblies/ApApomp_trinity.fasta,input_filter_assemblies/PgPgras_trinity.fasta,input_filter_assemblies/PhPhess_trinity.fasta,input_filter_assemblies/ThThelep_trinity.fasta" />
246 <conditional name="format"> 218 <param name="input_alignments" ftype="fasta" value="input_from_CDS_Search/locus17_sp3_sp3.fasta,input_from_CDS_Search/locus147_sp3_sp3.fasta,input_from_CDS_Search/locus183_sp3_sp3.fasta,input_from_CDS_Search/locus334_sp3_sp3.fasta" />
219 <conditional name="format">
247 <param name="format_run" value="nucleic" /> 220 <param name="format_run" value="nucleic" />
248 <param name="zip_nuc" ftype="zip" value="test_05_output_CDS_Search_input_ConcatPhyl.zip" />
249 <param name="base_model" value="GTRGAMMA" /> 221 <param name="base_model" value="GTRGAMMA" />
250 </conditional> 222 </conditional>
251 <param name="random_seed" value="1234567890" /> 223 <param name="random_seed" value="1234567890" />
252 <param name="number_of_runs" value="100" /> 224 <param name="number_of_runs" value="100" />
253 <param name="number_of_runs_bootstop" value="" /> 225 <param name="number_of_runs_bootstop" value="" />
254 <param name="search_algorithm" value="d" /> 226 <param name="search_algorithm" value="d" />
255 <!-- <param name="multiple_model" value="" /> --> 227 <!-- <param name="multiple_model" value="" /> -->
256 <param name="rapid_bootstrap_random_seed" value="123456789" /> 228 <param name="rapid_bootstrap_random_seed" value="123456789" />
257 <param name="out" value="nothing" /> 229 <param name="out" value="nothing" />
258 <param name="raxml1" value="True" /> 230 <param name="raxml1" value="True" />
259 <param name="raxml3" value="True" /> 231 <param name="raxml3" value="True" />
260 <param name="raxml4" value="True" /> 232 <param name="raxml4" value="True" />
261 <output name="out_raxml4"> 233 <output name="out_raxml4">
262 <assert_contents> 234 <assert_contents>
263 <has_text text="(Ap,(((Pf,Ph),Pg),((Pu,Te),(Am,Th))),Ac);"/> 235 <has_text text="((Pg,(Am,Th)),(Ph,Ap),Ac);"/>
264 <has_text text="(Ap,(Ph,(Pg,((Pf,(Pu,Te)),(Am,Th)))),Ac);"/> 236 <has_text text="((Th,(Pg,Am)),(Ph,Ap),Ac);"/>
265 <has_text text="(Ap,(((Pu,Te),(Am,Th)),((Pf,Ph),Pg)),Ac);"/> 237 <has_text text="((Ph,Ap),(Am,(Pg,Th)),Ac);"/>
266 </assert_contents> 238 </assert_contents>
267 </output> 239 </output>
268
269 </test> 240 </test>
241
242 <test>
243 <param name="input_filter_assemblies" ftype="fasta" value="input_filter_assemblies/AcAcaud_trinity.fasta,input_filter_assemblies/AmAmphi_trinity.fasta,input_filter_assemblies/ApApomp_trinity.fasta,input_filter_assemblies/PgPgras_trinity.fasta,input_filter_assemblies/PhPhess_trinity.fasta,input_filter_assemblies/ThThelep_trinity.fasta" />
244 <param name="input_alignments" ftype="fasta" value="input_from_CDS_Search/locus17_sp3_sp3.fasta,input_from_CDS_Search/locus147_sp3_sp3.fasta,input_from_CDS_Search/locus183_sp3_sp3.fasta,input_from_CDS_Search/locus334_sp3_sp3.fasta" />
245 <conditional name="format">
246 <param name="format_run" value="nucleic" />
247 <param name="base_model" value="GTRGAMMA" />
248 </conditional>
249 <param name="random_seed" value="1234567890" />
250 <param name="number_of_runs" value="100" />
251 <param name="number_of_runs_bootstop" value="" />
252 <param name="search_algorithm" value="a" />
253 <param name="rapid_bootstrap_random_seed" value="1234567890" />
254 <param name="out" value="nothing" />
255 <param name="raxml1" value="True" />
256 <param name="raxml3" value="True" />
257 <param name="raxml4" value="True" />
258 <output name="out_raxml1" value="RAxML_bestTree"/>
259 <output name="out_raxml3" value="RAxML_bipartitions"/>
260 </test>
261
262 <test>
263 <param name="input_filter_assemblies" ftype="fasta" value="input_filter_assemblies/AcAcaud_trinity.fasta,input_filter_assemblies/AmAmphi_trinity.fasta,input_filter_assemblies/ApApomp_trinity.fasta,input_filter_assemblies/PgPgras_trinity.fasta,input_filter_assemblies/PhPhess_trinity.fasta,input_filter_assemblies/ThThelep_trinity.fasta" />
264 <param name="input_alignments" ftype="fasta" value="input_from_CDS_Search/locus17_sp3_sp3.fasta,input_from_CDS_Search/locus147_sp3_sp3.fasta,input_from_CDS_Search/locus183_sp3_sp3.fasta,input_from_CDS_Search/locus334_sp3_sp3.fasta" />
265 <conditional name="format">
266 <param name="format_run" value="nucleic" />
267 <param name="base_model" value="GTRGAMMA" />
268 </conditional>
269 <param name="random_seed" value="1234567890" />
270 <param name="number_of_runs" value="100" />
271 <param name="number_of_runs_bootstop" value="autoMR" />
272 <param name="search_algorithm" value="a" />
273 <param name="rapid_bootstrap_random_seed" value="1234567890" />
274 <param name="out" value="nothing" />
275 <param name="raxml1" value="True" />
276 <param name="raxml3" value="True" />
277 <param name="raxml4" value="True" />
278 <output name="out_raxml1" value="RAxML_bestTree_test3"/>
279 <output name="out_raxml3" value="RAxML_bipartitions_test3"/>
280 </test>
270 </tests> 281 </tests>
271 282
272 <help> 283 <help>
284
285 @HELP_AUTHORS@
273 286
274 ============ 287 ============
275 What it does 288 What it does
276 ============ 289 ============
277 290
278 | This tool takes a zip file containing nucleic fasta sequence files and searches different homologous genes from pairwise comparisons. 291 | This tool takes a 'dataset collection list' containing nucleic fasta sequence files and searches different homologous genes from pairwise comparisons.
279 |
280 |
281 | The run RAxML was written by **Alexandros Stamatakis**.
282 | The script was written by **Eric Fontanillas**.
283 | The wrapper was written by **Julie Baffard**.
284 292
285 -------- 293 --------
286 294
287 ========== 295 ==========
288 Parameters 296 Parameters
289 ========== 297 ==========
290 298
291 | The choice of the format sequences is possible : **proteic** or **nucleic** 299 | The choice of the format sequences is possible : **proteic** or **nucleic**
292 | 300 |
293 301
294 The choice of parameters for the RAxML run is possible : 302 The choice of parameters for the RAxML run is possible :
295 303
296 **-m** : 304 **-m** :
297 | is the option for the choice of the substitution model. 305 | is the option for the choice of the substitution model.
298 | By default it's GTRGAMMA. 306 | By default it's GTRGAMMA.
299 | 307 |
300 308
301 **-N** : 309 **-N** :
302 | is the option for the choice of the number of run 310 | is the option for the choice of the number of run
303 | by default it's 100 311 | by default it's 100
304 | 312 |
305 313
306 **rapid bootstrapping** : 314 **rapid bootstrapping** :
307 | is the option to have, in addition to the best tree search, the rapid bootstrapping 315 | is the option to have, in addition to the best tree search, the rapid bootstrapping
308 | this translates by : -x 12345 -f a 316 | this translates by : -x 12345 -f a
309 | by default, this option is choosen 317 | by default, this option is choosen
310 | 318 |
311 319
320 .. class:: warningmark
321 | RAxML has some incompatible parameters.
322 | The search algorithm compatible with boostrapping and giving a besttree file is the one set by default:
323 | -f a
324
325 | The search algorithm compatible with boostrapping and NOT giving a besttree file are:
326 | -f d
327 | -f o
328 | -f t
312 -------- 329 --------
313 330
314 ====== 331 ======
315 Inputs 332 Inputs
316 ====== 333 ======
317 334
318 option **Select a zip file containing the input files** :
319
320 | the input zip file must have the extension .ort.zip
321 | At the beginning, when you upload your input, you have to change the extension .zip to .ort.zip
322
323
324 -------- 335 --------
325 336
326 ======= 337 =======
327 Outputs 338 Outputs
328 ======= 339 =======
329 340
330 This tool, produces the following files : 341 This tool, produces the following files :
331 342
332 **Phylogeny** : 343 **Phylogeny** :
333 | is the general output. It gives the information about the concatenation (statistics) and the RAxML run. 344 | is the general output. It gives the information about the concatenation (statistics) and the RAxML run.
334 | 345 |
335 346
336 **Phylogeny_concatenation_fasta_aa** : 347 **Phylogeny_concatenation_fasta_aa** :
337 | is the output which contains the sequences concatenated in fasta format when you choose the option proteic 348 | is the output which contains the sequences concatenated in fasta format when you choose the option proteic
338 | 349 |
339 350
340 **Phylogeny_concatenation_phylip_aa** : 351 **Phylogeny_concatenation_phylip_aa** :
341 | is the output which contains the sequences concatenated in phylip format when you choose the option proteic 352 | is the output which contains the sequences concatenated in phylip format when you choose the option proteic
342 | 353 |
343 354
344 **Phylogeny_concatenation_nexus_aa** : 355 **Phylogeny_concatenation_nexus_aa** :
345 | is the output which contains the sequences concatenated in nexus format when you choose the option proteic 356 | is the output which contains the sequences concatenated in nexus format when you choose the option proteic
346 | 357 |
347 358
348 **Phylogeny_concatenation_fasta_nuc** : 359 **Phylogeny_concatenation_fasta_nuc** :
349 | is the output which contains the sequences concatenated in fasta format when you choose the option nucleic 360 | is the output which contains the sequences concatenated in fasta format when you choose the option nucleic
350 | 361 |
351 362
352 **Phylogeny_concatenation_phylip_nuc** : 363 **Phylogeny_concatenation_phylip_nuc** :
353 | is the output which contains the sequences concatenated in phylip format when you choose the option nucleic 364 | is the output which contains the sequences concatenated in phylip format when you choose the option nucleic
354 | it's this output which is used for the RAxML run 365 | it's this output which is used for the RAxML run
355 | 366 |
356 367
357 **Phylogeny_concatenation_nexus_nuc** : 368 **Phylogeny_concatenation_nexus_nuc** :
358 | is the output which contains the sequences concatenated in nexus format when you choose the option nucleic 369 | is the output which contains the sequences concatenated in nexus format when you choose the option nucleic
359 | 370 |
360 371
361 **Phylogeny_RAxML_BestTree** : 372 **Phylogeny_RAxML_BestTree** :
362 | is the output of RAxML run which contains the Best Tree found 373 | is the output of RAxML run which contains the Best Tree found
363 | 374 |
364 375
365 **Phylogeny_RAxML_BiPartitionBranchLabel** : 376 **Phylogeny_RAxML_BiPartitionBranchLabel** :
366 | is the output of RAxML run which contains the Best Tree found with supported values as branch labels 377 | is the output of RAxML run which contains the Best Tree found with supported values as branch labels
367 | 378 |
368 379
369 **Phylogeny_RAxML_BiPartition** : 380 **Phylogeny_RAxML_BiPartition** :
370 | is the output of RAxML run which contains the Best Tree found with supported values 381 | is the output of RAxML run which contains the Best Tree found with supported values
371 | 382 |
372 383
373 **Phylogeny_RAxML_BootStrap** : 384 **Phylogeny_RAxML_BootStrap** :
374 | is the output of RAxML run which contains all the boostrapped trees 385 | is the output of RAxML run which contains all the boostrapped trees
375 | the number of boostraped trees depending of the option -N (number of run) 386 | the number of boostraped trees depending of the option -N (number of run)
376 | 387 |
377 388
378 -------- 389 --------
379 390
380 =============== 391 ===============
381 Working Example 392 Working Example
385 The input files and options 396 The input files and options
386 --------------------------- 397 ---------------------------
387 398
388 **Input files** 399 **Input files**
389 | 6 files with 200 nucleic sequences each 400 | 6 files with 200 nucleic sequences each
390 | a zip file containing 2 locus aligned without indel (in nucleic format) 401 | a 'dataset collection list' containing 2 locus aligned without indel (in nucleic format)
391 | 402 |
392 **Parameters** 403 **Parameters**
393 | option : nucleic 404 | option : nucleic
394 | no option for the RAxML run, so by default it's : -m GTRGAMMA -N 100 -f a -x 12345 405 | no option for the RAxML run, so by default it's : -m GTRGAMMA -N 100 -f a -x 12345
395 | 406 |
396 407
397 ---------------- 408 ----------------
398 The output files 409 The output files
399 ---------------- 410 ----------------
400 411
401 **Phylogeny** : 412 **Phylogeny** :
402 413
403 | ******************** CONCATENATION ******************** 414 | ******************** CONCATENATION ********************
404 | 415 |
405 | Process nucleotides concatenation: 416 | Process nucleotides concatenation:
406 | Number of taxa aligned = 6 417 | Number of taxa aligned = 6
407 | Number of loci concatenated = 2 418 | Number of loci concatenated = 2
408 | 419 |
409 | Total length of the concatenated sequences [All codon positions] = 504 420 | Total length of the concatenated sequences [All codon positions] = 504
410 | Total length of the concatenated sequences [Codon positions 1 and 2] = 336 421 | Total length of the concatenated sequences [Codon positions 1 and 2] = 336
411 | Total length of the concatenated sequences [Codon position 3] = 168 422 | Total length of the concatenated sequences [Codon position 3] = 168
412 | 423 |
413 | 424 |
414 |  425 | 
415 | ******************** RAxML RUN ******************** 426 | ******************** RAxML RUN ********************
416 |  427 | 
417 428
418 the informations of the RAxML run 429 the informations of the RAxML run
419 430
420 |  431 | 
421 432
422 **Phylogeny_concatenation_fasta_nuc** : 433 **Phylogeny_concatenation_fasta_nuc** :
423 434
424 | &gt;Ps 435 | &gt;Ps
425 436
426 cgcagttcctcggtgaggcgttgtagttcggcgttcagacggtcagctctctcctcggctgccctgcgagcattcagtgcctcatccatgtcagcttgcatggcggcaatgtctccctccatacggcgcttatctccagtcaaagtggtcacggtgatgttcagctcgttaacacgggatacagcatcgtgcagttcgttttcggcattcttacgagctctctcagatgtctcca 437 cgcagttcctcggtgaggcgttgtagttcggcgttcagacggtcagctctctcctcggctgccctgcgagcattcagtgcctcatccatgtcagcttgcatggcggcaatgtctccctccatacggcgcttatctccagtcaaagtggtcacggtgatgttcagctcgttaacacgggatacagcatcgtgcagttcgttttcggcattcttacgagctctctcagatgtctcca
456 cttgccttccttgtctatcttacacaagccagcccat 467 cttgccttccttgtctatcttacacaagccagcccat
457 468
458 .. class:: infomark 469 .. class:: infomark
459 470
460 | If you choose the option proteic : you obtain a file with proteic sequences 471 | If you choose the option proteic : you obtain a file with proteic sequences
461 | 472 |
462 |  473 | 
463 474
464 475
465 **Phylogeny_concatenation_phylip_nuc** : 476 **Phylogeny_concatenation_phylip_nuc** :
466 477
478 ------------------------ 489 ------------------------
479 490
480 | Pp 491 | Pp
481 | --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 492 | ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
482 | ------------------------------------------------------------------------------------------------ataatccttgacgaccacacactgcatccaacaacttttctggccttgccttccttgtctattttacacaaaccagcccat 493 | ------------------------------------------------------------------------------------------------ataatccttgacgaccacacactgcatccaacaacttttctggccttgccttccttgtctattttacacaaaccagcccat
483 | 494 |
484 | Ap 495 | Ap
485 496
486 cgcagctcctcggtgacgcggtgcagctcggcggcgaggcgatcggctctctcctcggctgccctgcgggcgttcagggcctcatcaaggtcggcctgcatggcggcgatgtcgccctccatgcggcgcttgtcgccggtcagagtcgtcaccgtgatgttcagctcgttgacgcgagccgtggcgtcgtgtagctcgttctcggcattcttacgagctcgttcggc 497 cgcagctcctcggtgacgcggtgcagctcggcggcgaggcgatcggctctctcctcggctgccctgcgggcgttcagggcctcatcaaggtcggcctgcatggcggcgatgtcgccctccatgcggcgcttgtcgccggtcagagtcgtcaccgtgatgttcagctcgttgacgcgagccgtggcgtcgtgtagctcgttctcggcattcttacgagctcgttcggc
487 ggtctccagtagggatctaacatcctccagctccgtttgcaatgcaatcctcttcctctcgagtacagttacagcggaacgggcttcctcagcactgcggcgctcctcctcaatggcaatttccagctccttgaccttcgcactaagtcccttgttggccttggacagttcgttgttggctctaagtgtctccactataatccttaacaacaacacactgcaaccaacaacctt 498 ggtctccagtagggatctaacatcctccagctccgtttgcaatgcaatcctcttcctctcgagtacagttacagcggaacgggcttcctcagcactgcggcgctcctcctcaatggcaatttccagctccttgaccttcgcactaagtcccttgttggccttggacagttcgttgttggctctaagtgtctccactataatccttaacaacaacacactgcaaccaacaacctt
488 ccgggccttgccttccttgtctatcttgcaaagaccagcccat 499 ccgggccttgccttccttgtctatcttgcaaagaccagcccat
498 cttgccttccttgtctatcttacacaagccagcccat 509 cttgccttccttgtctatcttacacaagccagcccat
499 510
500 .. class:: infomark 511 .. class:: infomark
501 512
502 | If you choose the option proteic : you obtain a file with proteic sequences 513 | If you choose the option proteic : you obtain a file with proteic sequences
503 | 514 |
504 |  515 | 
505 516
506 **Phylogeny_concatenation_nexus_nuc** : 517 **Phylogeny_concatenation_nexus_nuc** :
507 518
508 #NEXUS 519 #NEXUS
536 acgtctcaagaagggatcgtacatcctcgagttctgtctggagggcgatcctctttctctcaagcatggtaaccgcggagcgggcttcctcgccactgcggcgttcttcctcgatggtgatctccagttccttaaccttagtactcagtcccttgttggctttggacagttcgttgttcgctcttagtgtctccactataatccttaaccacaacacactacaaccaacaacctttc 547 acgtctcaagaagggatcgtacatcctcgagttctgtctggagggcgatcctctttctctcaagcatggtaaccgcggagcgggcttcctcgccactgcggcgttcttcctcgatggtgatctccagttccttaaccttagtactcagtcccttgttggctttggacagttcgttgttcgctcttagtgtctccactataatccttaaccacaacacactacaaccaacaacctttc
537 ttgccttgccttccttgtctatcttacacaagccagcccat 548 ttgccttgccttccttgtctatcttacacaagccagcccat
538 549
539 | ; 550 | ;
540 | End; 551 | End;
541 | 552 |
542 553
543 .. class:: infomark 554 .. class:: infomark
544 555
545 | If you choose the option proteic : you obtain a file with proteic sequences 556 | If you choose the option proteic : you obtain a file with proteic sequences
546 | 557 |
547 |  558 | 
548 559
549 **Phylogeny_RAxML_BestTree** : 560 **Phylogeny_RAxML_BestTree** :
550 561
551 | ((Ac:0.02889451913999640381,Ap:0.01674414484251282934):0.17730049470177636217, 562 | ((Ac:0.02889451913999640381,Ap:0.01674414484251282934):0.17730049470177636217,
552 | ((Pp:0.23405795780876006984,Pg:0.02012322210145659623):0.14429203507314311561,Pf:0.09977363663005259231):0.04320803212100913365,Ps:0.08351583721596630983):0.0; 563 | ((Pp:0.23405795780876006984,Pg:0.02012322210145659623):0.14429203507314311561,Pf:0.09977363663005259231):0.04320803212100913365,Ps:0.08351583721596630983):0.0;
553 | 564 |
554 |  565 | 
555 566
556 567
557 **Phylogeny_RAxML_BiPartitionBranchLabel** : 568 **Phylogeny_RAxML_BiPartitionBranchLabel** :
558 569
559 | (Pg:0.02012322210145659623,(Pf:0.09977363663005259231,(Ps:0.08351583721596630983, 570 | (Pg:0.02012322210145659623,(Pf:0.09977363663005259231,(Ps:0.08351583721596630983,
560 | (Ac:0.02889451913999640381,Ap:0.01674414484251282934):0.17730049470177636217[89]):0.04320803212100913365[42]):0.14429203507314311561[70],Pp:0.23405795780876006984); 571 | (Ac:0.02889451913999640381,Ap:0.01674414484251282934):0.17730049470177636217[89]):0.04320803212100913365[42]):0.14429203507314311561[70],Pp:0.23405795780876006984);
561 | 572 |
562 | 573 |
563 574
564 575
565 **Phylogeny_RAxML_BiPartition** : 576 **Phylogeny_RAxML_BiPartition** :
566 577
567 (Pg:0.02012322210145659623,(Pf:0.09977363663005259231,(Ps:0.08351583721596630983, 578 (Pg:0.02012322210145659623,(Pf:0.09977363663005259231,(Ps:0.08351583721596630983,
568 (Ac:0.02889451913999640381,Ap:0.01674414484251282934)89:0.17730049470177636217)42:0.04320803212100913365)70:0.14429203507314311561,Pp:0.23405795780876006984); 579 (Ac:0.02889451913999640381,Ap:0.01674414484251282934)89:0.17730049470177636217)42:0.04320803212100913365)70:0.14429203507314311561,Pp:0.23405795780876006984);
569 580
570 | 581 |
571 | 582 |
572 583
573 **Phylogeny_RAxML_BootStrap** : 584 **Phylogeny_RAxML_BootStrap** :
574 585
575 | ((Ap,Ac),((Pp,Pg),Pf),Ps); 586 | ((Ap,Ac),((Pp,Pg),Pf),Ps);
576 | ((Ap,Ac),((Pp,Pg),Pf),Ps); 587 | ((Ap,Ac),((Pp,Pg),Pf),Ps);
580 | ((Ap,Ac),((Pp,Pg),Pf),Ps); 591 | ((Ap,Ac),((Pp,Pg),Pf),Ps);
581 | ((Pp,Pg),(Pf,(Ap,Ac)),Ps); 592 | ((Pp,Pg),(Pf,(Ap,Ac)),Ps);
582 593
583 ... 594 ...
584 595
596 ---------------------------------------------------
597
598 Changelog
599 ---------
600
601 **Version 2.0 - 06/07/2017**
602
603 - NEW: Replace the zip between tools by Dataset Collection
604 - Corrected bug : output files were empty due to errors in the command section (incompatible parameters set by default instead of the ones mentioned in the help)
605
606
607 **Version 1.0 - 13/04/2017**
608
609 - Add funtional test with planemo
610
611 - Planemo test with conda dependencies for raxml and python
612
613 - Scripts renamed + symlinks to the directory 'scripts'
614
585 </help> 615 </help>
586 616
587 <expand macro="citations" /> 617 <expand macro="citations" />
588 618
589 </tool> 619 </tool>