# HG changeset patch
# User abims-sbr
# Date 1492076867 14400
# Node ID aba551b2b79e09e686df36009145ecd046f4c724
planemo upload for repository https://github.com/abims-sbr/adaptsearch commit 38545eb765e0df7fcc6b8130e8e5f87cf4481122
diff -r 000000000000 -r aba551b2b79e BlastAlign.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/BlastAlign.xml Thu Apr 13 05:47:47 2017 -0400
@@ -0,0 +1,440 @@
+
+
+
+
+
+ Align the nucleic acid sequences
+
+
+
+ macros.xml
+
+
+
+
+ perl
+ blast-legacy
+ blastalign
+
+
+
+
+
+
+
+ ${outfile};
+ #if $fasta_out.value == True :
+ python $__tool_directory__/scripts/S02_phylip2fasta.py out.phy out.fasta >>${outfile};
+ #end if
+ #end if
+
+ #if $files.type == "many" :
+ python $__tool_directory__/scripts/S01_prepare_BlastAlign_runs.py ${files.many_files}
+ #if $fasta_out.value == True :
+ oui
+ #else :
+ non
+ #end if
+ #if $files.options.option == "yes" :
+ #if $files.options.options_m.m == True :
+ ${files.options.options_m.proportion}
+ #else :
+ 95
+ #end if
+ #if $files.options.options_n == True :
+ T
+ #else :
+ F
+ #end if
+ #elif $files.options.option == "no" :
+ 95 F
+ #end if
+ >${outfile};
+ #end if
+ ]]>
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+ files['type'] == "one"
+
+
+ files['type'] == "one"
+
+
+ ((files['type'] == "one" and fasta_out == True))
+
+
+ files['type'] == "many"
+
+
+ files['type'] == "many"
+
+
+ ((files['type'] == "many" and fasta_out == True))
+
+
+
+ files_failed == True
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+============
+What it does
+============
+
+| This tool takes **nucleic sequences in fasta format** or **zip file containing fasta files** and returns a multiple alignement (in Nexus and Phylip formats) using BLAST+
+|
+| The script in perl was written by **Robert Belshaw** and **Aris Katzourakis**.
+| The script in python was written by **Eric Fontanillas**.
+| The wrapper was written by **Julie Baffard**.
+
+--------
+
+==========
+Parameters
+==========
+
+The choice of several parameters for the blast is possible.
+
+**-m [maximum proportion of gaps allowed in any one sequence in the final alignement]**
+ | integer (between 0 and 100)
+ | By default : 95%, i.e. only removes sequences with extremely short matches.
+ | We find 50 the most useful.
+ |
+
+**-r [name of reference sequence]**
+ | text
+ | Default is searching for best candidate.
+ | If entered, the sequence will be extracted, written to a separate file, and blasted against the original input file.
+ |
+
+**-x [name of comma-separated sequences to be excluded from this analysis]**
+ | text
+ |
+
+**-n**
+ | If it's checked : retain original names in output files.
+ | If isn't checked : to output the 15 character name abbreviations (stripped of potentially problematic characters) that is used in the tool.
+ |
+
+**-s [number of sequences to be used in initial search for reference sequence]**
+ | integer (between 0 and total number of sequences)
+ | Default is finding the reference sequence by blasting all sequences against all sequences, only randomly subsampling when it thinks the blast output file might be too large.
+
+.. class:: infomark
+
+m and n are the only parameters which can used for the 2 options (one file and many files).
+
+--------
+
+=======
+Outputs
+=======
+
+This tool, produces the following files :
+
+**Alignment**
+ | is the output with important informations.
+ | when the alignment failed with BlastAlign, the name of the file is writting down this output.
+ |
+
+**Alignement_file_failed**
+ | is the output containing the files failed during the run of BlastAlign.
+ |
+
+**Alignment_{inputfile}_phylip**
+ | is the output with the aligned sequences in Phylip format when you choose "one file" option.
+ |
+
+**Alignment_{inputfile}_nexus**
+ | is the output with the aligned sequences in Nexus format when you choose "one file" option.
+ |
+
+**Alignment_{input_file}_fasta**
+ | is the output with the aligned sequences in Fasta format when you choose "one file" and "fasta forme" options
+ |
+
+**Alignment_locus_phylip**
+ | is the output with the aligned sequences in Phylip format when you choose "many files" option.
+ |
+
+**Alignment_locus_nexus**
+ | is the output with the aligned sequences in Nexus format when you choose "many files" option.
+ |
+
+**Alignment_locus_fasta**
+ | is the output with the aligned sequences in Fasta forme when you choose "many file" and "fasta forme" options
+
+.. class:: warningmark
+
+The zip outputs have to be downloaded (and extracts the files with a file archiver software), you cannot visualize them with the "eye icon" through the interface.
+
+--------
+
+===============
+Working Example
+===============
+
+------------------------------
+The input file and its options
+------------------------------
+
+**Input file**
+
+| >Pf210_1/1_1.000_920
+| CCGGTGGCCATTTTCTGCACCTCGTGGGTTATTGAGCTGAAAGTGGTTCAGCTCACTGTCTGTTAACAGCCGTGTCGGTCTGAGGGTATCACAGTTAATATAATGAATCAAGAGAAGTTGAAGCAGCTCCAGGCCCAAGTCCGCATCGGAGGAAAGGG
+| CACAGCAAGAAGAAAGAAGAAGGTGATTCACAGAACAGCAACAACAGATGACAAGAAACTGCAAAGTACACTGAAGAAATTGGCAGTAAATAATATTCCGGGTATAGAAGAGGTTAACATGATAAAGGATGACGGGCAAGTAATACATTTTACCAATCCGA
+| AGGTGCAGGCTTCTCTTCAGTCAAACACATTTGCCATTAATGGCCAAGCCGAAACGAAACAAATCACTGACTTGCTACCCGGTATATTAAATCAGCTGGGGGCTGAAAGTTTAACAAACTTGAAGAAGCTGGCTAAATCTGTGACTGCTGGAGTTGATTC
+| TGATAACAAGCAGGATGCAGCAGATATTGATGAAGATGATGATGATGTCCCAGAACTGGTTGAAAACTTTGACGAAGCATCGAAGAATGAGGGGACGTAATTCTTCTCCCACTTTATGCCATGGTAGCATCAATCGTTTTGCTGATGATGGCGTGTTTATAC
+| CTACCACCCAGTGTAGATTTGTCCAGACCTGGCTTGTTTGACATTGCTTGTTGGATTTTGCAACAATATCATGATTAGACTGCCTGGCTTTGTGGCCTAAATACTGTATTAAAGTGTCTGTAAAAGGGAAGCAATTTTTCTATTAAGAAGTTATCCACTAGCAT
+| ATTGACAGTTTTGCATGTTTGATTTTGTTCCTCGTGCAGGTCAGAACACTGATTGTACAGTGGCTGATTACAGAAAAATTGTATTCAGAGTTAAATAAACACATTATTATCCAAA
+| >Pp_17_1/1_1.000_930
+| CCGGTGGCCATTTTCTGCACCTCGTGGGTATCTTGGGTTCGATTTGTATCAGCTCCCTATGTAAAATTAAACAAACTTATAACATAGATTGCAGCTGACAATACAATGAACCAAGAAAAATTAAAACAACTCCAAGCCCAGGTGCGCATTGGAGGCAAGGG
+| TACAGCAAGAAGAAAGAAGAAGGTCATTCATAGAACAGCAACAACAGATGATAAAAAACTGCAGAGTACATTAAAAAAACTAGCAGTAAATAATATTCCAGGTATAGAAGAGGTTAATATGATAAAAGATGATGGACAGGTAATACATTTTACCAATCCAAAA
+| GTACAGGCTTCTCTACAGTCAAACACATTTGCTATTAATGGGCAAGCTGAGACAAAACAAATCACCGAATTGTTGCCTGGTATATTAAATCAGCTGGGAGCAGAAAGTTTAACAAATCTGAAGAAACTGGCTACATCCGTGACTGGTGGAGTTGATTCTGAT
+| AACAAGCCAGAAACAGCAGAAATTGATGAAGACGATGATGATGTTCCAGATTTGGTTGAAAACTTTGACGAGGCATCCAAGAATGAAGGAACGTAATTTGTCATTGGTAGATCCTCCCATAGCCTGATTCTTGTGGCTGGCGACAGCTTGTTTATATTTTAC
+
+CCAGTGTAGATTTGTTCAAGAAGGTGTGCTGGCGTTGTTTGAATTTTGTAATAGTACCATGATTTAAATACCCGGTTAACGGCCTACCTGTTATGTAGAAATTGTAGAGAAAAAATTAAATCAATTTTGTATGAACTATAAGCAGCAGCTAATATATTTGCAGTTT
+TACATGTTTATCTGTTCATCAGCATGGGTCAGAGAATGACCGTACTTTGCTGGTGATAGAATGCTTGTATTCAAAGTTTAATAAATGGTTGTAAGCCATTTAAAAAAAAAAAAAAA
+
+**Parameters**
+
+| option : one file. It's the same for the option "many files" except that the output files are in zip format (inside : 1 file corresponding to one output of BlastAlign)
+| no option for the run Blast. So, by default it's -m 95 -n F
+
+----------------
+The output files
+----------------
+
+**BlastAlign**
+
+************************ BlastAlign ************************
+
+|
+| This program takes nucleotide sequences in fasta format and returns a multiple alignment (in Nexus and Phylip formats) using BLASTN
+|
+| Input file locus_2_sp_8.fasta has 2 sequences and is 1894 bytes
+| (maximum number of sequences that will be used to search for the reference sequence is 770)
+|
+|
+| BlastAlign finished: it has produced a multiple alignment of 2 sequences and length 720 by aligning to sequence Pf2101/11000920 (proportion of gaps in each sequence is less than 0.95)
+|
+
+.. class:: infomark
+
+| if you choose the option "many files"
+| there will be as template output that number of file in the input zip.
+|
+|
+
+**Alignment_{inputfile}_phylip**
+
+| 2 720 S
+| Pf2101/1100 ccggtggccattttctgcacctcgtgggttattgagctgaaagtggttcagctcactgtctgttaacagccgtgtcggtctgagggtatcacagttaatataatgaatcaagagaagttgaagcagctccaggcccaagtccgcatcggaggaaagggcacagcaagaagaaagaagaaggtgattcacagaacagcaacaacagat
+
+gacaagaaactgcaaagtacactgaagaaattggcagtaaataatattccgggtatagaagaggttaacatgataaaggatgacgggcaagtaatacattttaccaatccgaaggtgcaggcttctcttcagtcaaacacatttgccattaatggccaagccgaaacgaaacaaatcactgacttgctacccggtatattaaatcagctgggggctgaaag
+tttaacaaacttgaagaagctggctaaatctgtgactgctggagttgattctgataacaagcaggatgcagcagatattgatgaagatgatgatgatgtcccagaactggttgaaaactttgacgaagcatcgaagaatgaggggacgtaattcttctcccactttatgccatggtagcatcaatcgttttgctgatgatggcgtgtttatacctaccacccagtgtaga
+tttgtccagacctggcttgtttgacattgcttgttggattttgcaacaatatcatgattaga
+
+| Pp171/11000 ccggtggccattttctgcacctcgtgggt-------------------------------------------------------------------aatacaatgaaccaagaaaaattaaaacaactccaagcccaggtgcgcattggaggcaagggtacagcaagaagaaagaagaaggtcattcatagaacagcaacaacagatgataaaaaactgcagag
+| tacattaaaaaaactagcagtaaataatattccaggtatagaagaggttaatatgataaaagatgatggacaggtaatacattttaccaatccaaaagtacaggcttctctacagtcaaacacatttgctattaatgggcaagctgagacaaaacaaatcaccgaattgttgcctggtatattaaatcagctgggagcagaaagtttaacaaatctgaagaaact
+| ggctacatccgtgactggtggagttgattctgataacaagccagaaacagcagaaattgatgaagacgatgatgatgttccagatttggttgaaaactttgacgaggcatccaagaatgaaggaacgtaatt-----------------------------------------------------------------acccagtgtagatttgt----------------------------------------------
+| -------------
+|
+
+.. class:: infomark
+
+| If you choose the option "many file"
+| Save as *Galaxy{number}-[Alignment_locus_phy].zip*
+| If you unzip the file, a number of files are extracted (depends on the number of locus) : {name_of_file}.phy
+|
+|
+
+**Alignment_{inputfile}_nexus**
+
+| #NEXUS
+
+[Aligned to seq Pf2101/1100 by BlastAlign. We have excluded sequences with more than 0.95 gaps]
+
+BEGIN DATA;
+
+| dimensions ntax=2 nchar=720;
+| format gap=- datatype=DNA;
+| matrix
+
+Pf2101/1100 ccggtggccattttctgcacctcgtgggttattgagctgaaagtggttcagctcactgtctgttaacagccgtgtcggtctgagggtatcacagttaatataatgaatcaagagaagttgaagcagctccaggcccaagtccgcatcggaggaaagggcacagcaagaagaaagaagaaggtgattcacagaacagcaacaacagat
+gacaagaaactgcaaagtacactgaagaaattggcagtaaataatattccgggtatagaagaggttaacatgataaaggatgacgggcaagtaatacattttaccaatccgaaggtgcaggcttctcttcagtcaaacacatttgccattaatggccaagccgaaacgaaacaaatcactgacttgctacccggtatattaaatcagctgggggctgaaag
+tttaacaaacttgaagaagctggctaaatctgtgactgctggagttgattctgataacaagcaggatgcagcagatattgatgaagatgatgatgatgtcccagaactggttgaaaactttgacgaagcatcgaagaatgaggggacgtaattcttctcccactttatgccatggtagcatcaatcgttttgctgatgatggcgtgtttatacctaccacccagtgtaga
+tttgtccagacctggcttgtttgacattgcttgttggattttgcaacaatatcatgattaga
+
+| Pp171/11000 ccggtggccattttctgcacctcgtgggt-------------------------------------------------------------------aatacaatgaaccaagaaaaattaaaacaactccaagcccaggtgcgcattggaggcaagggtacagcaagaagaaagaagaaggtcattcatagaacagcaacaacagatgataaaaaactgcagag
+| tacattaaaaaaactagcagtaaataatattccaggtatagaagaggttaatatgataaaagatgatggacaggtaatacattttaccaatccaaaagtacaggcttctctacagtcaaacacatttgctattaatgggcaagctgagacaaaacaaatcaccgaattgttgcctggtatattaaatcagctgggagcagaaagtttaacaaatctgaagaaac
+| tggctacatccgtgactggtggagttgattctgataacaagccagaaacagcagaaattgatgaagacgatgatgatgttccagatttggttgaaaactttgacgaggcatccaagaatgaaggaacgtaatt-----------------------------------------------------------------acccagtgtagatttgt--------------------------------------------
+| -------------
+| ;
+| end;
+|
+
+.. class:: infomark
+
+| If you choose the option "many file"
+| Save as *Galaxy{number}-[Alignment_locus_nxs].zip*
+| If you unzip the file, a number of files are extracted (depends on the number of locus) : {name_of_file}.nxs
+|
+|
+
+**Alignment_{inputfile}_fasta**
+
+| >Pf2101/11000920
+
+ccggtggccattttctgcacctcgtgggttattgagctgaaagtggttcagctcactgtctgttaacagccgtgtcggtctgagggtatcacagttaatataatgaatcaagagaagttgaagcagctccaggcccaagtccgcatcggaggaaagggcacagcaagaagaaagaagaaggtgattcacagaacagcaacaacagatgacaagaaactg
+caaagtacactgaagaaattggcagtaaataatattccgggtatagaagaggttaacatgataaaggatgacgggcaagtaatacattttaccaatccgaaggtgcaggcttctcttcagtcaaacacatttgccattaatggccaagccgaaacgaaacaaatcactgacttgctacccggtatattaaatcagctgggggctgaaagtttaacaaacttgaa
+gaagctggctaaatctgtgactgctggagttgattctgataacaagcaggatgcagcagatattgatgaagatgatgatgatgtcccagaactggttgaaaactttgacgaagcatcgaagaatgaggggacgtaattcttctcccactttatgccatggtagcatcaatcgttttgctgatgatggcgtgtttatacctaccacccagtgtagatttgtccagacctggc
+ttgtttgacattgcttgttggattttgcaacaatatcatgattaga
+
+| >Pp171/11000930
+
+ccggtggccattttctgcacctcgtgggt-------------------------------------------------------------------aatacaatgaaccaagaaaaattaaaacaactccaagcccaggtgcgcattggaggcaagggtacagcaagaagaaagaagaaggtcattcatagaacagcaacaacagatgataaaaaactgcagagtacattaaaaaa
+actagcagtaaataatattccaggtatagaagaggttaatatgataaaagatgatggacaggtaatacattttaccaatccaaaagtacaggcttctctacagtcaaacacatttgctattaatgggcaagctgagacaaaacaaatcaccgaattgttgcctggtatattaaatcagctgggagcagaaagtttaacaaatctgaagaaactggctacatccg
+tgactggtggagttgattctgataacaagccagaaacagcagaaattgatgaagacgatgatgatgttccagatttggttgaaaactttgacgaggcatccaagaatgaaggaacgtaatt-----------------------------------------------------------------acccagtgtagatttgt---------------------------------------------------------
+
+.. class:: infomark
+
+| If you choose the option "many file"
+| Save as *Galaxy{number}-[Alignment_locus_fasta].zip*
+| If you unzip the file, a number of files are extracted (depends on the number of locus) : {name_of_file}.fasta
+
+
+
+
+
diff -r 000000000000 -r aba551b2b79e CHANGELOG.md
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/CHANGELOG.md Thu Apr 13 05:47:47 2017 -0400
@@ -0,0 +1,7 @@
+Changelog
+
+Version 1.0 - 13/04/2017
+
+ - Add functional test with planemo
+ - Planemo test with conda dependencies for blastalign, blast-legacy, perl, python
+ - Scripts renamed + symlinks to the directory 'scripts'
diff -r 000000000000 -r aba551b2b79e macros.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/macros.xml Thu Apr 13 05:47:47 2017 -0400
@@ -0,0 +1,16 @@
+
+
+
+ python
+
+
+
+
+ Credits : ABIMS team, Roscoff Marine Station
+ Contact support.abims@sb-roscoff.fr for any questions or concerns about the Galaxy implementation of this tool.
+ Version 1 : Scripts by Eric Fontanillas -- Galaxy integration by Julie Baffard
+ Version 2 : improvments by Victor Mataigne, Gildas le Corguillé, Misharl Monsoor
+
+
+
+
diff -r 000000000000 -r aba551b2b79e test-data/test_05.out
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test_05.out Thu Apr 13 05:47:47 2017 -0400
@@ -0,0 +1,151 @@
+
+************************ BlastAlign ************************
+
+This program takes nucleotide sequences in fasta format and returns a multiple alignment (in Nexus & Phylip formats) using BLASTN
+
+
+Will exclude sequences where gaps make up more than 95% of the sequence in the final alignment
+
+Input file ./locus1_sp2.fasta has 2 sequences and is 360 bytes
+(maximum number of sequences that will be used to search for the reference sequence is 1767)
+
+
+BlastAlign finished: it has produced a multiple alignment of 2 sequences and length 160 by aligning to sequence Am31/11000160 (percentage of gaps in each sequence is less than 95%)
+
+
+************************ BlastAlign ************************
+
+This program takes nucleotide sequences in fasta format and returns a multiple alignment (in Nexus & Phylip formats) using BLASTN
+
+
+Will exclude sequences where gaps make up more than 95% of the sequence in the final alignment
+
+Input file ./locus2_sp2.fasta has 2 sequences and is 360 bytes
+(maximum number of sequences that will be used to search for the reference sequence is 1767)
+
+
+BlastAlign finished: it has produced a multiple alignment of 2 sequences and length 160 by aligning to sequence Am21/11000160 (percentage of gaps in each sequence is less than 95%)
+
+
+************************ BlastAlign ************************
+
+This program takes nucleotide sequences in fasta format and returns a multiple alignment (in Nexus & Phylip formats) using BLASTN
+
+
+Will exclude sequences where gaps make up more than 95% of the sequence in the final alignment
+
+Input file ./locus3_sp2.fasta has 2 sequences and is 625 bytes
+(maximum number of sequences that will be used to search for the reference sequence is 1341)
+
+
+BlastAlign finished: it has produced a multiple alignment of 2 sequences and length 240 by aligning to sequence Ac231/11000366 (percentage of gaps in each sequence is less than 95%)
+
+
+************************ BlastAlign ************************
+
+This program takes nucleotide sequences in fasta format and returns a multiple alignment (in Nexus & Phylip formats) using BLASTN
+
+
+Will exclude sequences where gaps make up more than 95% of the sequence in the final alignment
+
+Input file ./locus4_sp2.fasta has 2 sequences and is 360 bytes
+(maximum number of sequences that will be used to search for the reference sequence is 1767)
+
+
+BlastAlign finished: it has produced a multiple alignment of 2 sequences and length 160 by aligning to sequence Pf81/11000160 (percentage of gaps in each sequence is less than 95%)
+
+
+************************ BlastAlign ************************
+
+This program takes nucleotide sequences in fasta format and returns a multiple alignment (in Nexus & Phylip formats) using BLASTN
+
+
+Will exclude sequences where gaps make up more than 95% of the sequence in the final alignment
+
+Input file ./locus5_sp2.fasta has 2 sequences and is 360 bytes
+(maximum number of sequences that will be used to search for the reference sequence is 1767)
+
+
+BlastAlign finished: it has produced a multiple alignment of 2 sequences and length 160 by aligning to sequence Pf91/11000160 (percentage of gaps in each sequence is less than 95%)
+
+
+************************ BlastAlign ************************
+
+This program takes nucleotide sequences in fasta format and returns a multiple alignment (in Nexus & Phylip formats) using BLASTN
+
+
+Will exclude sequences where gaps make up more than 95% of the sequence in the final alignment
+
+Input file ./locus6_sp2.fasta has 2 sequences and is 360 bytes
+(maximum number of sequences that will be used to search for the reference sequence is 1767)
+
+
+BlastAlign finished: it has produced a multiple alignment of 2 sequences and length 160 by aligning to sequence Pf61/11000160 (percentage of gaps in each sequence is less than 95%)
+
+
+************************ BlastAlign ************************
+
+This program takes nucleotide sequences in fasta format and returns a multiple alignment (in Nexus & Phylip formats) using BLASTN
+
+
+Will exclude sequences where gaps make up more than 95% of the sequence in the final alignment
+
+Input file ./locus7_sp2.fasta has 2 sequences and is 360 bytes
+(maximum number of sequences that will be used to search for the reference sequence is 1767)
+
+
+BlastAlign finished: it has produced a multiple alignment of 2 sequences and length 160 by aligning to sequence Pf41/11000160 (percentage of gaps in each sequence is less than 95%)
+
+
+************************ BlastAlign ************************
+
+This program takes nucleotide sequences in fasta format and returns a multiple alignment (in Nexus & Phylip formats) using BLASTN
+
+
+Will exclude sequences where gaps make up more than 95% of the sequence in the final alignment
+
+Input file ./locus8_sp2.fasta has 2 sequences and is 590 bytes
+(maximum number of sequences that will be used to search for the reference sequence is 1380)
+
+
+************************ BlastAlign ************************
+
+This program takes nucleotide sequences in fasta format and returns a multiple alignment (in Nexus & Phylip formats) using BLASTN
+
+
+Will exclude sequences where gaps make up more than 95% of the sequence in the final alignment
+
+Input file ./locus9_sp2.fasta has 2 sequences and is 361 bytes
+(maximum number of sequences that will be used to search for the reference sequence is 1765)
+
+
+BlastAlign finished: it has produced a multiple alignment of 2 sequences and length 160 by aligning to sequence Pf101/11000160 (percentage of gaps in each sequence is less than 95%)
+
+
+************************ BlastAlign ************************
+
+This program takes nucleotide sequences in fasta format and returns a multiple alignment (in Nexus & Phylip formats) using BLASTN
+
+
+Will exclude sequences where gaps make up more than 95% of the sequence in the final alignment
+
+Input file ./locus10_sp2.fasta has 2 sequences and is 360 bytes
+(maximum number of sequences that will be used to search for the reference sequence is 1767)
+
+
+BlastAlign finished: it has produced a multiple alignment of 2 sequences and length 160 by aligning to sequence Pf51/11000160 (percentage of gaps in each sequence is less than 95%)
+
+
+************************ BlastAlign ************************
+
+This program takes nucleotide sequences in fasta format and returns a multiple alignment (in Nexus & Phylip formats) using BLASTN
+
+
+Will exclude sequences where gaps make up more than 95% of the sequence in the final alignment
+
+Input file ./locus1_sp3.fasta has 3 sequences and is 540 bytes
+(maximum number of sequences that will be used to search for the reference sequence is 1767)
+
+
+BlastAlign finished: it has produced a multiple alignment of 3 sequences and length 160 by aligning to sequence Pf71/11000160 (percentage of gaps in each sequence is less than 95%)
+
diff -r 000000000000 -r aba551b2b79e test-data/test_05_output_BlastAlign.zip
Binary file test-data/test_05_output_BlastAlign.zip has changed
diff -r 000000000000 -r aba551b2b79e test-data/test_4_output_POGS_input_BlastAlign.zip
Binary file test-data/test_4_output_POGS_input_BlastAlign.zip has changed