Mercurial > repos > abims-sbr > blastalign
diff BlastAlign.xml @ 0:aba551b2b79e draft
planemo upload for repository https://github.com/abims-sbr/adaptsearch commit 38545eb765e0df7fcc6b8130e8e5f87cf4481122
author | abims-sbr |
---|---|
date | Thu, 13 Apr 2017 05:47:47 -0400 |
parents | |
children | 92615a423389 |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/BlastAlign.xml Thu Apr 13 05:47:47 2017 -0400 @@ -0,0 +1,440 @@ +<?xml version="1.0"?> + +<tool name="BlastAlign" id="blastalign" version="1.0"> + + <description> + Align the nucleic acid sequences + </description> + + <macros> + <import>macros.xml</import> + </macros> + + <requirements> + <expand macro="python_required" /> + <requirement type="package" version="5.22.0">perl</requirement> + <requirement type="package" >blast-legacy</requirement> + <requirement type="package" version="1.4">blastalign</requirement> + </requirements> + + <stdio> + <exit_code range="1:" level="fatal" /> + </stdio> + + <command> + <![CDATA[ + ln -s $__tool_directory__/scripts/S02_phylip2fasta.py . + && + #if $files.type == "one" : + BlastAlign -i ${files.one_file} -o out + #if $files.options.option == "yes" : + #if $files.options.options_m.m == True : + -m ${files.options.options_m.proportion} + #else : + -m 95 + #end if + #if $files.options.options_r.r == True : + -r ${files.options.options_r.reference} + #end if + #if $files.options.options_x.x == True : + -x ${files.options.options_x.exclusion} + #end if + #if $files.options.options_n == True : + -n T + #else : + -n F + #end if + #if $files.options.options_s.s == True : + -s ${files.options.options_s.initialisation} + #end if + #elif $files.options.option == "no" : + -m 95 -n F + #end if + >${outfile}; + #if $fasta_out.value == True : + python $__tool_directory__/scripts/S02_phylip2fasta.py out.phy out.fasta >>${outfile}; + #end if + #end if + + #if $files.type == "many" : + python $__tool_directory__/scripts/S01_prepare_BlastAlign_runs.py ${files.many_files} + #if $fasta_out.value == True : + oui + #else : + non + #end if + #if $files.options.option == "yes" : + #if $files.options.options_m.m == True : + ${files.options.options_m.proportion} + #else : + 95 + #end if + #if $files.options.options_n == True : + T + #else : + F + #end if + #elif $files.options.option == "no" : + 95 F + #end if + >${outfile}; + #end if + ]]> + </command> + <inputs> + <conditional name="files"> + <param name="type" type="select" label="How many files do you want to align ? "> + <option value="one">Only one file</option> + <option value="many">Many files in zip format</option> + </param> + + <when value="one"> + <param name="one_file" type="data" format="fasta" label="Choose your file" help="Only a fasta file with nucleotides sequences" /> + + <conditional name="options"> + <param name="option" type="select" label="Blast advanced options "> + <option value="no">No</option> + <option value="yes">Yes</option> + </param> + <when value="yes"> + <conditional name="options_m"> + <param name="m" type="boolean" checked="False" label="Proportion of gaps allowed in any one sequence in the final alignement " /> + <when value="true"> + <param name="proportion" type="integer" value="50" min="0" max="100" label="Maximum proportion " help="By default it's 95%" /> + </when> + <when value="false" > + </when> + </conditional> + + <conditional name="options_r"> + <param name="r" type="boolean" label="Choose the reference sequence " /> + <when value="true" > + <param name="reference" type="text" area="True" size="1x20" label="Name " /> + </when> + <when value="false" > + </when> + </conditional> + + <conditional name="options_x"> + <param name="x" type="boolean" label="Choose the sequences to be excluded from this analysis " /> + <when value="true"> + <param name="exclusion" type="text" area="True" size="5x25" label="name of comma-separated sequences " /> + </when> + <when value="false" > + </when> + </conditional> + + <param name="options_n" type="boolean" label="retain original names in output files "/> + + <conditional name="options_s"> + <param name="s" type="boolean" label="Choose the number of sequences to be used in initial search for reference sequence " /> + <when value="true"> + <param name="initialisation" type="integer" value="10" min="0" label="Number of sequences "/> + </when> + <when value="false" > + </when> + </conditional> + </when> + <when value="no" > + </when> + </conditional> + </when> + + <when value="many"> + <param name="many_files" type="data" format="no_unzip.zip,zip" label="Choose your ZIP file" help="Only a zip file containing fasta file with nucleotides sequences" /> + + <conditional name="options"> + <param name="option" type="select" label="Blast advanced options "> + <option value="no">No</option> + <option value="yes">Yes</option> + </param> + <when value="yes"> + <conditional name="options_m"> + <param name="m" type="boolean" label="Proportion of gaps allowed in any one sequence in the final alignement " /> + <when value="true"> + <param name="proportion" type="integer" value="50" min="0" max="100" label="Maximum proportion " help="By default it's 95%" /> + </when> + <when value="false" > + </when> + </conditional> + + <param name="options_n" type="boolean" label="retain original names in output files "/> + </when> + <when value="no" > + </when> + </conditional> + </when> + </conditional> + + <param name="fasta_out" type="boolean" checked="True" label="Do you want to convert the output phylip in fasta format ? " /> + <param name="files_failed" type="boolean" label="Do you want to have a file containing a list of files failed with BlastAlign ? " /> + </inputs> + + <outputs> + <data format="txt" name="outfile" label="Alignment" /> + <data format="phy" name="phy" from_work_dir="out.phy" label="Alignment_${files.one_file.name}_phylip"> + <filter>files['type'] == "one"</filter> + </data> + <data format="nxs" name="nxs" from_work_dir="out.nxs" label="Alignment_${files.one_file.name}_nexus"> + <filter>files['type'] == "one"</filter> + </data> + <data format="fasta" name="fasta" from_work_dir="out.fasta" label="Alignment_${files.one_file.name}_fasta"> + <filter>((files['type'] == "one" and fasta_out == True))</filter> + </data> + <data format="no_unzip.zip" name="phy_zip" from_work_dir="Alignment_locus_phy.zip" label="Alignment_locus_phylip"> + <filter>files['type'] == "many"</filter> + </data> + <data format="no_unzip.zip" name="nxs_zip" from_work_dir="Alignment_locus_nxs.zip" label="Alignment_locus_nexus"> + <filter>files['type'] == "many"</filter> + </data> + <data format="no_unzip.zip" name="fasta_zip" from_work_dir="Alignment_locus_fasta.zip" label="Alignment_locus_fasta"> + <filter>((files['type'] == "many" and fasta_out == True))</filter> + </data> + + <data format="txt" name="out_failed" from_work_dir="list_files_failed.txt" label="Alignment_files_failed"> + <filter>files_failed == True</filter> + </data> + </outputs> + + <tests> + <test> + <param name="type" value="many"/> + <param name="many_files" ftype="zip" value="test_4_output_POGS_input_BlastAlign.zip" /> + <param name="option" value="no" /> + <param name="fasta_out" value="True" /> + <param name="files_failed" value="True" /> + <output name="outfile" value="test_05.out" /> + </test> + </tests> + + <help> +============ +What it does +============ + +| This tool takes **nucleic sequences in fasta format** or **zip file containing fasta files** and returns a multiple alignement (in Nexus and Phylip formats) using BLAST+ +| +| The script in perl was written by **Robert Belshaw** and **Aris Katzourakis**. +| The script in python was written by **Eric Fontanillas**. +| The wrapper was written by **Julie Baffard**. + +-------- + +========== +Parameters +========== + +The choice of several parameters for the blast is possible. + +**-m [maximum proportion of gaps allowed in any one sequence in the final alignement]** + | integer (between 0 and 100) + | By default : 95%, i.e. only removes sequences with extremely short matches. + | We find 50 the most useful. + | + +**-r [name of reference sequence]** + | text + | Default is searching for best candidate. + | If entered, the sequence will be extracted, written to a separate file, and blasted against the original input file. + | + +**-x [name of comma-separated sequences to be excluded from this analysis]** + | text + | + +**-n** + | If it's checked : retain original names in output files. + | If isn't checked : to output the 15 character name abbreviations (stripped of potentially problematic characters) that is used in the tool. + | + +**-s [number of sequences to be used in initial search for reference sequence]** + | integer (between 0 and total number of sequences) + | Default is finding the reference sequence by blasting all sequences against all sequences, only randomly subsampling when it thinks the blast output file might be too large. + +.. class:: infomark + +m and n are the only parameters which can used for the 2 options (one file and many files). + +-------- + +======= +Outputs +======= + +This tool, produces the following files : + +**Alignment** + | is the output with important informations. + | when the alignment failed with BlastAlign, the name of the file is writting down this output. + | + +**Alignement_file_failed** + | is the output containing the files failed during the run of BlastAlign. + | + +**Alignment_{inputfile}_phylip** + | is the output with the aligned sequences in Phylip format when you choose "one file" option. + | + +**Alignment_{inputfile}_nexus** + | is the output with the aligned sequences in Nexus format when you choose "one file" option. + | + +**Alignment_{input_file}_fasta** + | is the output with the aligned sequences in Fasta format when you choose "one file" and "fasta forme" options + | + +**Alignment_locus_phylip** + | is the output with the aligned sequences in Phylip format when you choose "many files" option. + | + +**Alignment_locus_nexus** + | is the output with the aligned sequences in Nexus format when you choose "many files" option. + | + +**Alignment_locus_fasta** + | is the output with the aligned sequences in Fasta forme when you choose "many file" and "fasta forme" options + +.. class:: warningmark + +The zip outputs have to be downloaded (and extracts the files with a file archiver software), you cannot visualize them with the "eye icon" through the interface. + +-------- + +=============== +Working Example +=============== + +------------------------------ +The input file and its options +------------------------------ + +**Input file** + +| >Pf210_1/1_1.000_920 +| CCGGTGGCCATTTTCTGCACCTCGTGGGTTATTGAGCTGAAAGTGGTTCAGCTCACTGTCTGTTAACAGCCGTGTCGGTCTGAGGGTATCACAGTTAATATAATGAATCAAGAGAAGTTGAAGCAGCTCCAGGCCCAAGTCCGCATCGGAGGAAAGGG +| CACAGCAAGAAGAAAGAAGAAGGTGATTCACAGAACAGCAACAACAGATGACAAGAAACTGCAAAGTACACTGAAGAAATTGGCAGTAAATAATATTCCGGGTATAGAAGAGGTTAACATGATAAAGGATGACGGGCAAGTAATACATTTTACCAATCCGA +| AGGTGCAGGCTTCTCTTCAGTCAAACACATTTGCCATTAATGGCCAAGCCGAAACGAAACAAATCACTGACTTGCTACCCGGTATATTAAATCAGCTGGGGGCTGAAAGTTTAACAAACTTGAAGAAGCTGGCTAAATCTGTGACTGCTGGAGTTGATTC +| TGATAACAAGCAGGATGCAGCAGATATTGATGAAGATGATGATGATGTCCCAGAACTGGTTGAAAACTTTGACGAAGCATCGAAGAATGAGGGGACGTAATTCTTCTCCCACTTTATGCCATGGTAGCATCAATCGTTTTGCTGATGATGGCGTGTTTATAC +| CTACCACCCAGTGTAGATTTGTCCAGACCTGGCTTGTTTGACATTGCTTGTTGGATTTTGCAACAATATCATGATTAGACTGCCTGGCTTTGTGGCCTAAATACTGTATTAAAGTGTCTGTAAAAGGGAAGCAATTTTTCTATTAAGAAGTTATCCACTAGCAT +| ATTGACAGTTTTGCATGTTTGATTTTGTTCCTCGTGCAGGTCAGAACACTGATTGTACAGTGGCTGATTACAGAAAAATTGTATTCAGAGTTAAATAAACACATTATTATCCAAA +| >Pp_17_1/1_1.000_930 +| CCGGTGGCCATTTTCTGCACCTCGTGGGTATCTTGGGTTCGATTTGTATCAGCTCCCTATGTAAAATTAAACAAACTTATAACATAGATTGCAGCTGACAATACAATGAACCAAGAAAAATTAAAACAACTCCAAGCCCAGGTGCGCATTGGAGGCAAGGG +| TACAGCAAGAAGAAAGAAGAAGGTCATTCATAGAACAGCAACAACAGATGATAAAAAACTGCAGAGTACATTAAAAAAACTAGCAGTAAATAATATTCCAGGTATAGAAGAGGTTAATATGATAAAAGATGATGGACAGGTAATACATTTTACCAATCCAAAA +| GTACAGGCTTCTCTACAGTCAAACACATTTGCTATTAATGGGCAAGCTGAGACAAAACAAATCACCGAATTGTTGCCTGGTATATTAAATCAGCTGGGAGCAGAAAGTTTAACAAATCTGAAGAAACTGGCTACATCCGTGACTGGTGGAGTTGATTCTGAT +| AACAAGCCAGAAACAGCAGAAATTGATGAAGACGATGATGATGTTCCAGATTTGGTTGAAAACTTTGACGAGGCATCCAAGAATGAAGGAACGTAATTTGTCATTGGTAGATCCTCCCATAGCCTGATTCTTGTGGCTGGCGACAGCTTGTTTATATTTTAC + +CCAGTGTAGATTTGTTCAAGAAGGTGTGCTGGCGTTGTTTGAATTTTGTAATAGTACCATGATTTAAATACCCGGTTAACGGCCTACCTGTTATGTAGAAATTGTAGAGAAAAAATTAAATCAATTTTGTATGAACTATAAGCAGCAGCTAATATATTTGCAGTTT +TACATGTTTATCTGTTCATCAGCATGGGTCAGAGAATGACCGTACTTTGCTGGTGATAGAATGCTTGTATTCAAAGTTTAATAAATGGTTGTAAGCCATTTAAAAAAAAAAAAAAA + +**Parameters** + +| option : one file. It's the same for the option "many files" except that the output files are in zip format (inside : 1 file corresponding to one output of BlastAlign) +| no option for the run Blast. So, by default it's -m 95 -n F + +---------------- +The output files +---------------- + +**BlastAlign** + +************************ BlastAlign ************************ + +| +| This program takes nucleotide sequences in fasta format and returns a multiple alignment (in Nexus and Phylip formats) using BLASTN +| +| Input file locus_2_sp_8.fasta has 2 sequences and is 1894 bytes +| (maximum number of sequences that will be used to search for the reference sequence is 770) +| +| +| BlastAlign finished: it has produced a multiple alignment of 2 sequences and length 720 by aligning to sequence Pf2101/11000920 (proportion of gaps in each sequence is less than 0.95) +| + +.. class:: infomark + +| if you choose the option "many files" +| there will be as template output that number of file in the input zip. +| +| + +**Alignment_{inputfile}_phylip** + +| 2 720 S +| Pf2101/1100 ccggtggccattttctgcacctcgtgggttattgagctgaaagtggttcagctcactgtctgttaacagccgtgtcggtctgagggtatcacagttaatataatgaatcaagagaagttgaagcagctccaggcccaagtccgcatcggaggaaagggcacagcaagaagaaagaagaaggtgattcacagaacagcaacaacagat + +gacaagaaactgcaaagtacactgaagaaattggcagtaaataatattccgggtatagaagaggttaacatgataaaggatgacgggcaagtaatacattttaccaatccgaaggtgcaggcttctcttcagtcaaacacatttgccattaatggccaagccgaaacgaaacaaatcactgacttgctacccggtatattaaatcagctgggggctgaaag +tttaacaaacttgaagaagctggctaaatctgtgactgctggagttgattctgataacaagcaggatgcagcagatattgatgaagatgatgatgatgtcccagaactggttgaaaactttgacgaagcatcgaagaatgaggggacgtaattcttctcccactttatgccatggtagcatcaatcgttttgctgatgatggcgtgtttatacctaccacccagtgtaga +tttgtccagacctggcttgtttgacattgcttgttggattttgcaacaatatcatgattaga + +| Pp171/11000 ccggtggccattttctgcacctcgtgggt-------------------------------------------------------------------aatacaatgaaccaagaaaaattaaaacaactccaagcccaggtgcgcattggaggcaagggtacagcaagaagaaagaagaaggtcattcatagaacagcaacaacagatgataaaaaactgcagag +| tacattaaaaaaactagcagtaaataatattccaggtatagaagaggttaatatgataaaagatgatggacaggtaatacattttaccaatccaaaagtacaggcttctctacagtcaaacacatttgctattaatgggcaagctgagacaaaacaaatcaccgaattgttgcctggtatattaaatcagctgggagcagaaagtttaacaaatctgaagaaact +| ggctacatccgtgactggtggagttgattctgataacaagccagaaacagcagaaattgatgaagacgatgatgatgttccagatttggttgaaaactttgacgaggcatccaagaatgaaggaacgtaatt-----------------------------------------------------------------acccagtgtagatttgt---------------------------------------------- +| ------------- +| + +.. class:: infomark + +| If you choose the option "many file" +| Save as *Galaxy{number}-[Alignment_locus_phy].zip* +| If you unzip the file, a number of files are extracted (depends on the number of locus) : {name_of_file}.phy +| +| + +**Alignment_{inputfile}_nexus** + +| #NEXUS + +[Aligned to seq Pf2101/1100 by BlastAlign. We have excluded sequences with more than 0.95 gaps] + +BEGIN DATA; + +| dimensions ntax=2 nchar=720; +| format gap=- datatype=DNA; +| matrix + +Pf2101/1100 ccggtggccattttctgcacctcgtgggttattgagctgaaagtggttcagctcactgtctgttaacagccgtgtcggtctgagggtatcacagttaatataatgaatcaagagaagttgaagcagctccaggcccaagtccgcatcggaggaaagggcacagcaagaagaaagaagaaggtgattcacagaacagcaacaacagat +gacaagaaactgcaaagtacactgaagaaattggcagtaaataatattccgggtatagaagaggttaacatgataaaggatgacgggcaagtaatacattttaccaatccgaaggtgcaggcttctcttcagtcaaacacatttgccattaatggccaagccgaaacgaaacaaatcactgacttgctacccggtatattaaatcagctgggggctgaaag +tttaacaaacttgaagaagctggctaaatctgtgactgctggagttgattctgataacaagcaggatgcagcagatattgatgaagatgatgatgatgtcccagaactggttgaaaactttgacgaagcatcgaagaatgaggggacgtaattcttctcccactttatgccatggtagcatcaatcgttttgctgatgatggcgtgtttatacctaccacccagtgtaga +tttgtccagacctggcttgtttgacattgcttgttggattttgcaacaatatcatgattaga + +| Pp171/11000 ccggtggccattttctgcacctcgtgggt-------------------------------------------------------------------aatacaatgaaccaagaaaaattaaaacaactccaagcccaggtgcgcattggaggcaagggtacagcaagaagaaagaagaaggtcattcatagaacagcaacaacagatgataaaaaactgcagag +| tacattaaaaaaactagcagtaaataatattccaggtatagaagaggttaatatgataaaagatgatggacaggtaatacattttaccaatccaaaagtacaggcttctctacagtcaaacacatttgctattaatgggcaagctgagacaaaacaaatcaccgaattgttgcctggtatattaaatcagctgggagcagaaagtttaacaaatctgaagaaac +| tggctacatccgtgactggtggagttgattctgataacaagccagaaacagcagaaattgatgaagacgatgatgatgttccagatttggttgaaaactttgacgaggcatccaagaatgaaggaacgtaatt-----------------------------------------------------------------acccagtgtagatttgt-------------------------------------------- +| ------------- +| ; +| end; +| + +.. class:: infomark + +| If you choose the option "many file" +| Save as *Galaxy{number}-[Alignment_locus_nxs].zip* +| If you unzip the file, a number of files are extracted (depends on the number of locus) : {name_of_file}.nxs +| +| + +**Alignment_{inputfile}_fasta** + +| >Pf2101/11000920 + +ccggtggccattttctgcacctcgtgggttattgagctgaaagtggttcagctcactgtctgttaacagccgtgtcggtctgagggtatcacagttaatataatgaatcaagagaagttgaagcagctccaggcccaagtccgcatcggaggaaagggcacagcaagaagaaagaagaaggtgattcacagaacagcaacaacagatgacaagaaactg +caaagtacactgaagaaattggcagtaaataatattccgggtatagaagaggttaacatgataaaggatgacgggcaagtaatacattttaccaatccgaaggtgcaggcttctcttcagtcaaacacatttgccattaatggccaagccgaaacgaaacaaatcactgacttgctacccggtatattaaatcagctgggggctgaaagtttaacaaacttgaa +gaagctggctaaatctgtgactgctggagttgattctgataacaagcaggatgcagcagatattgatgaagatgatgatgatgtcccagaactggttgaaaactttgacgaagcatcgaagaatgaggggacgtaattcttctcccactttatgccatggtagcatcaatcgttttgctgatgatggcgtgtttatacctaccacccagtgtagatttgtccagacctggc +ttgtttgacattgcttgttggattttgcaacaatatcatgattaga + +| >Pp171/11000930 + +ccggtggccattttctgcacctcgtgggt-------------------------------------------------------------------aatacaatgaaccaagaaaaattaaaacaactccaagcccaggtgcgcattggaggcaagggtacagcaagaagaaagaagaaggtcattcatagaacagcaacaacagatgataaaaaactgcagagtacattaaaaaa +actagcagtaaataatattccaggtatagaagaggttaatatgataaaagatgatggacaggtaatacattttaccaatccaaaagtacaggcttctctacagtcaaacacatttgctattaatgggcaagctgagacaaaacaaatcaccgaattgttgcctggtatattaaatcagctgggagcagaaagtttaacaaatctgaagaaactggctacatccg +tgactggtggagttgattctgataacaagccagaaacagcagaaattgatgaagacgatgatgatgttccagatttggttgaaaactttgacgaggcatccaagaatgaaggaacgtaatt-----------------------------------------------------------------acccagtgtagatttgt--------------------------------------------------------- + +.. class:: infomark + +| If you choose the option "many file" +| Save as *Galaxy{number}-[Alignment_locus_fasta].zip* +| If you unzip the file, a number of files are extracted (depends on the number of locus) : {name_of_file}.fasta + </help> + + <expand macro="citations" /> + +</tool>